... chronic inflammation is important particularly in the intestinal type of GC The Correa hypothesis postulates that a progression from chronic gastritis to gastric atrophy, intestinal metaplasia (IM), ... curvature of the antrum and the midpoint of the greater curvature of the gastric body via endoscopic biopsy In the patients with cancer two specimens were obtained from the cancerous portion of the surgical ... or gastrin which are important markers for the intestinal type of GC but not the diffuse type [25,26] This study found that serum levels of HMGB1 were associated with depth of invasion (T stage) ,...
Ngày tải lên: 18/06/2014, 15:20
... features Page of 11 of these patients were listed in Table The patients underwent curative gastrectomy with D2 lymph nodes dissection for stages I to III cases and palliative surgery for some stage ... microenvironments at the primary tumor site, the invasive front and the metastatic site are different [21] Although no statistically significant result was showed regarding of the relationship of type IV ... was not associated with tumor stage, lymph node status, metastasis status, recurrence or not Similar unexpected result was Peng et al Journal of Translational Medicine 2010, 8:101 http://www.translational-medicine.com/content/8/1/101...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo sinh học: " Cytoreductive surgery plus hyperthermic intraperitoneal chemotherapy improves survival of gastric cancer with peritoneal carcinomatosis: evidence from an " pdf
... strategy to treat selected patients of gastric cancer with PC Acknowledgements Supported by the grants supporting New Strategies to Treat Peritoneal Carcinomatosis from Hubei Sciences and Technology ... established a stable rabbit model of gastric cancer with PC by injecting VX2 cancer cells into the submucosal layer of the stomach The model is characterized by typical ulcerative gastric cancer ... rank test) Tang et al Journal of Translational Medicine 2011, 9:53 http://www.translational-medicine.com/content/9/1/53 Page of Table Results of post mortem pathological study in groups* Control...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo sinh học: "Combination immunotherapy and active-specific tumor cell vaccination augments anti-cancer immunity in a mouse model of gastric cancer" pdf
... potentially also impacts tumor growth of established s.c tumors After identifying LRAST as an effective treatment to protect against s.c growing gastric tumors (prophylactic setting), we determined ... treatment We observed that approximately two months after LRAST treatment, the proportion of FoxP3+CD25 + CD4+ T cells had increased again to the frequencies of the other treatment groups without ... the treatment It remains to be determined whether late appearance of Tregs actually has an impact on the therapeutic efficacy of the overall anti-tumor response A recent study reported that the...
Ngày tải lên: 18/06/2014, 22:20
báo cáo hóa học:" Cytoreductive surgery plus hyperthermic intraperitoneal chemotherapy improves survival of gastric cancer with peritoneal carcinomatosis: evidence from an experimental study" doc
... strategy to treat selected patients of gastric cancer with PC Acknowledgements Supported by the grants supporting New Strategies to Treat Peritoneal Carcinomatosis from Hubei Sciences and Technology ... established a stable rabbit model of gastric cancer with PC by injecting VX2 cancer cells into the submucosal layer of the stomach The model is characterized by typical ulcerative gastric cancer ... rank test) Tang et al Journal of Translational Medicine 2011, 9:53 http://www.translational-medicine.com/content/9/1/53 Page of Table Results of post mortem pathological study in groups* Control...
Ngày tải lên: 20/06/2014, 03:20
MANAGEMENT OF GASTRIC CANCER potx
... according to the UICC TNM staging for the T stage, N stage and M stage The T stage refers to the depth of the invasion of the primary tumour, the N stage refers to the number of metastatic lymph ... reported that the normal gastric wall frequently showed a two- or three-layer pattern that was interrupted by a tumor; thus, more accurate staging of the T factor could be expected In addition, the ... (2/5) of pT4 tumors One pT2 tumor is under staged as MRT1, two pT3 tumors are under staged as MRT2, and three of the pT4 tumors are under staged as MRT3 One pT1 tumor is over staged as MRT2, and...
Ngày tải lên: 28/06/2014, 05:20
Báo cáo lâm nghiệp: "Ultrastructural and biochemical changes at the preinfection stage of mycorrhizal formation by two isolates of Pisolithus tinctorius" ppt
... P tinctorius shows important differences at the interface Indeed, it seems that the plant reacts to the presence of P tinctorius isolated from under pine, as if it were in contact with a pathogenic ... along the plasmalemma With strain 270, acid phosphatase days 445, acid phosphatase activity The ultrastructural comparison of the early events of infection between E urophylla and both strains of ... plasmalemmal activity was detected when the hyphae were close to the roots, while it was nearly absent in hyphae distant from the root (Fig 7, x 4000) In the host-plant cells, acid phosphatase activities...
Ngày tải lên: 09/08/2014, 04:20
Báo cáo khoa học: "Effects of propranolol in combination with radiation on apoptosis and survival of gastric cancer cells in vitro" ppsx
... CTGGGCTGTTCTCGCTTCG CTCTCCTCTTCCTTCTCTTCTTCC 140 NM_001025370.1 EGFR 53 Forward Reverse AGG ACA GCA TAG ACG ACA C AGG ATT CTG CAC AGA GCC A 90 NM_005228.3 secondary antibody corresponding to the ... important role in the radiotherapy of gastric cancer The present study demonstrates for the first time that b-adrenergic inhibition can enhance the effect of radiotherapy on gastric cancer cells ... inhibited b-ARs Discussion Gastric cancer is one of the major causes of cancer mortalities in the world, and radiotherapy is an important treatment for gastric cancer patients with a high risk of...
Ngày tải lên: 09/08/2014, 09:20
báo cáo khoa học: " The function and mechanism of COX-2 in angiogenesis of gastric cancer cells" pdf
... database in a BLAST search to ensure that the choosing sequences were not highly homologous with other genes For oligo-1, S: 5’-tttgcatcgatgtcaccatagaacatctatggtgacatcgatgcttttt-3’, AS: 5’-ctagaaaaagcatcgatgtcacc ... of the version to be published All authors read and approved the final manuscript Competing interests There is no conflict of interest The authors declare that they have no competing interests ... shown was the mean of three determinations B, tumorigenicity of the cells in BALB/c nu/nu mice was detected Each group had at least mice The volumes of tumors were monitored at the indicated time...
Ngày tải lên: 10/08/2014, 10:21
báo cáo khoa học: " Down-regulation of miR-27a might inhibit proliferation and drug resistance of gastric cancer cells" docx
... that down-regulation of miR-27a inhibited cell growth of gastric cancer cells in vitro, which was consistent with the data of nude mice assay The study was aimed at investigating the effect of ... cells were detected in soft agar D, tumorigenicity of the cells in BALB/c nu/nu mice was detected The volumes of tumors were monitored at the indicated time results of MTT assay and soft agar assay ... facilitating the transition from G1 phase into S The results of luciferase reporter assay suggested that miR-27a might be a transcriptional regulator of the cyclin D1 gene The results of MTT assay...
Ngày tải lên: 10/08/2014, 10:21
báo cáo khoa học: " Increased IL-10 mRNA expression in tumorassociated macrophage correlated with late stage of lung cancer" pps
... reverse(R) 5’GTCATCTTCTCGCGGTTG3’; IL-10 F 5’ AGAACCT GAAGACCCTCAGGC3’, IL-10 R 5’ CCACGGCCTT GCTCTTGTT 3’; cathepsin B F 5’ TGCA GCGCTGG GTGGATCTA 3’; cathepsin B R 5’ ATTGGCCAACACCAGCAGGC 3’; cathepsin ... F 5’ GCTTCTCTTGGT GTCCATAC 3’, cathepsin S R 5’ CATTACTGCGGGAATGAGAC 3’ The amplification protocol consisted of an initial 10 denaturation step at 95°C, followed by 40 cycles of PCR at 95°C for ... patients (48%) were stage I (early stage) , and the remaining 34 patients were (52%) stages II, III or IV (late stage) of the disease Table characteristics for the patients included in this study...
Ngày tải lên: 10/08/2014, 10:21
báo cáo khoa học: "Recombinant immunotoxin anti-c-Met/PE38KDEL inhibits proliferation and promotes apoptosis of gastric cancer cells" docx
... calculating the relative change increase in caspase activity in the IT-induced samples compared to that of the control IT treated samples were normalized to the caspase activity of the untreated ... hypothesize that anti-c-Met/ PE38KDEL can attenuate cancer cell growth through inhibition of protein synthesis via c-Met inhibition The effects of anti-c-Met/PE38KDEL on protein synthesis in GES-1, ... c-Met is considered a promsing therapeutic target for this type of cancer [3] The aim of this study was to evaluate the effects of recombinant immunotoxin anti-c-Met/PE38KDEL on proliferation...
Ngày tải lên: 10/08/2014, 10:21
báo cáo khoa học: "BRCAA1 monoclonal antibody conjugated fluorescent magnetic nanoparticles for in vivo targeted magnetofluorescent imaging of gastric cancer" ppsx
... great potential in imaging and therapy of gastric cancer However, up to date, no report shows that targeted imaging and therapy of in vivo gastric cancer is based on biomarkers associated with gastric ... early gastric cancer in near future Background Gastric cancer was once the second most common cancer in the word [1] Up to date, in the United States, stomach malignancy is currently the 14th most ... is the first time to report dual-modal targeting imaging of in vivo gastric cancer tissues How to target in vivo gastric cancer tissues is also a challengeable problem Up to date, no specific gastric...
Ngày tải lên: 11/08/2014, 00:23
Molecular signatures of gastric cancer an integrated approach to molecular cytogenetics, whole genome copy number and transcriptome profiles
... summarizes the treatment options that are generally considered most appropriate for different pathologic stages of GC 13 Review of the Literature - Chapter Table 1-4: Treatment strategies with reference ... mortality rates are still alarming This dismal state of affairs is mainly due to the fact that, whereas early stage GC has an excellent prognosis, the majority of symptomatic stomach cancer patients ... Review of the Literature - Chapter number of metastatic regional lymph nodes; and 3) Metastases (M): presence or absence of distant metastases The TNM classification and stage grouping of stomach cancer...
Ngày tải lên: 14/09/2015, 08:38
Genomic and transcriptomic analysis of gastric cancer systematic studies on transcriptional bias in aneuploidy and gene coexpression meta network
... generated by the global transcription profiling studies This thesis deals with developing two new methods to investigate the expression profiles of cancers First, the existence of transcriptional ... alternative to traditional techniques for the development of disease taxonomies that are clinically relevant It is with this aim expression profiling of gastric cancers was conducted at our lab titled: ... behavior Traditional classifications of gastric cancer on the basis of mucin content, histological architecture and cellular differentiation status are highly subject to inter-observer variation...
Ngày tải lên: 15/09/2015, 17:09
Báo cáo khoa học: "A case of virilization induced by a Krukenberg tumor from gastric cancer" docx
... participated in writing the manuscript and interpretation of data, patient care, PV carried out the surgical procedure with UB, interpretation of data; TS carried out histological analyses, HJS interpretation ... ovarian tumors in the lower abdomen http://www.wjso.com/content/6/1/19 initially considered due to the advanced stage of the primary tumor Adjuvant chemotherapy was initiated and the patient received ... female patient with Krukenberg tumor and strong signs of virilization without pregnancy The case is of interest because it affected a nonpregnant patient and virilization occurred only three months...
Ngày tải lên: 09/08/2014, 07:21
Overview of Trastuzumab’s Utility for Gastric Cancer pdf
... difficult to quantify its contributions to these effects Cardiotoxicity (impairment of left ventricular ejection fraction) was evident in 27% of patients treated with trastuzumab and anthracyclines, ... activity due to immune system recruitment by antibody-dependent cell-mediated cytotoxicity (ADCC) 32 | Connection 2010 “ Trastuzumab iniscombination with chemotherapy a reasonable treatment option ... receptor dimerization followed by transactivation of the TK portion of the dimer Phosphorylation allows recruitment and activation of downstream proteins, and the signaling cascade is initiated Given...
Ngày tải lên: 06/03/2014, 02:21
Báo cáo khoa học: Inhibition of PI3K/Akt partially leads to the inhibition of PrPC-induced drug resistance in gastric cancer cells pdf
... TTTGGTGATACACATCTGCTCAACATGAGCAGATGTGTATCACCTTTTT CTAGAAAAAGGTGATACACATCTGCTCATGTTGAGCAGATGTGTATCAC TTTGTAGTCATTGTCCTCCAGCACAGCTGGAGGACAATGACTACTTTTT CTAGAAAAAGTAGTCATTGTCCTCCAGCTGTGCTGGAGGACAATGACTA ... Antisense Sense Antisense CCCAAGCTTGGGATGGCGAACCTTGGCTGCT CGGGATCCTCCCACATCAGGAAGATGAGGA TTTGTTGCTGTACTCATCCATGACACATGGATGAGTACAGCAACTTTTT CTAGAAAAAGTTGCTGTACTCATCCATGTGTCATGGATGAGTACAGCAA TTTGGTGATACACATCTGCTCAACATGAGCAGATGTGTATCACCTTTTT ... CTAGAAAAAGTAGTCATTGTCCTCCAGCTGTGCTGGAGGACAATGACTA CTCGAGGAATCAGCATTCAG AGATCTCTTTGAGCTTGGAAGAGC CTCGAGGAATCAGCATTCAG AGATCTCTTTGAGCTTGGAAGAGC FEBS Journal 276 (2009) 685–694 ª 2008 The Authors Journal compilation ª 2008 FEBS 691 PI3K/Akt...
Ngày tải lên: 07/03/2014, 03:20
Báo cáo khoa học: Investigation of the kinetics and order of tyrosine phosphorylation in the T-cell receptor f chain by the protein tyrosine kinase Lck potx
... Consequently, tyrosines located on the peptides may be expected to exhibit the same kinetics as those located on the intact protein Therefore, determination of the kinetics of phosphorylation of these ... occur at a constant rate over the 30 duration of the assay (data not shown) and was not limited by concentrations of peptide or ATP, the latter giving rise to near saturation (95%) of the enzyme ... recombinant GST–Lck, [c-32P]ATP and unlabelled ATP over 30 The excess of ATP ensured that none of the reactions were rate-limited by ATP concentration The levels of incorporation of 32P into the peptide...
Ngày tải lên: 08/03/2014, 02:20