FUNCTION AND MECHANISM STUDIES OF TRPV4 IN BREAST CANCER METASTASIS

FUNCTION AND MECHANISM OF TRPV4 IN BREAST CANCER METASTASIS CHOONG LEE YEE B.SC (HONS) UNIVERSITI TEKNOLOGI MALAYSIA A THESIS SUBMITTED FOR THE DEGREE OF MASTERS OF SCIENCES DEPARTMENT OF BIOCHEMISTRY NATIONAL UNIVERSITY OF SINGAPORE 2013 DECLARATION I hereby declare that the thesis is my original work and it has been written by me in its entirety. I have duly acknowledged all the sources of information which have been used in the thesis. This thesis has also not been submitted for any degree in any university previously. _________________ CHOONG LEE YEE 20 March 2013 II ACKNOWLEDGEMENTS First and foremost I offer my sincerest gratitude to my supervisor, Assistant Professor Dr. Lim Yoon Pin, Department of Biochemistry NUS for his endless encouragement, support, guidance and helps. I would like to thank National University of Singapore for allowing me to pursue this degree with their generous research scholarship. In my daily life I have been blessed with a friendly and cheerful group of fellow colleagues. It would have been a lonely laboratory without them. My heartfelt thanks to the past and present colleagues especially Dr. Sheryl Tan, Mdm. Pan Mengfei, Dr. Lim Shen Kiat, Dr. Law Kai Pong, Dr. Shirly Chong, Mdm. Qianfeng and Mr. Victor Tan for always willing to provide assistance. My deepest gratitude to my dearest friends, Ms. Yuki Yip and Mr. Edmus Oh for their valuable motivation and encouragement. Thanks for being such wonderful friends and I will always treasure our friendships. I would like to express my deepest appreciation to my family, especially my parents, brother and sisters for their love and blessing. Finally, I would like to thank my dearest husband Kian Chuan and my lovely daughter Avelyn who were always there cheering me up and stood by me through the good times and bad. I would like to apologize to many individuals whose valuable contributions to this project were unable to be cited due to space restrictions. Choong Lee Yee 20 March 2013 III ROLES AND CONTRIBUTIONS OF COLLABORATORS Prof. Dr. Christian Harteneck ----------- from Universitat Tǘbingen, Germany Provides TRPV4 antibodies and plasmids, RES019-29 TRPV4 blocker and TRPV4-T Rex HEK293 cells, intellectual contributions Dr. Lim Chwee Teck and Dr. ---------Vedula Sri Ram Krishna from Nanobiomechanics Lab, National University of Singapore Micropipette aspiration Dr. Low Boon Chuan, Dr.Kenny ---------Lim Gim Keat and Archna Ravi RCE mechanobiology lab, National University of Singapore GTPase assays Dr. Marie Chiew-Shia Loh previously from Cancer Science Institute of Singapore, National University of Singapore ---------- Statistical analyses Dr. Thomas Putti from National University of Hospital, National ---------- Provides clinical samples and clinicohistopathological data Dr. Wong Chow Yin from Singapore General Hospital, Singapore ---------- Provides clinical samples and clinicohistopathological data Dr. Brendan Pang and Dr. Benedict Yan from National ---------- Histological analyses University of Singapore University of Hospital, National University of Singapore IV TABLE OF CONTENTS DECLARATION II ACKNOWLEDGEMENTS III ROLES AND CONTRIBUTIONS OF COLLABORATORS IV TABLE OF CONTENTS V SUMMARY IX LIST OF FIGURES XIII LIST OF TABLES XIV LIST OF SUPPLEMENTARY TABLES XV LIST OF ABBREVIATIONS XVI Chapter 1 Introduction 1 1.1 Importance of Ca2+ homeostasis and signaling 2 Ca2+ deregulations and cancers 2 1.1.1 1.2 Tumor metastasis Ca2+ and metastatic behaviors 1.2.1 3 6 1.3 Ca2+ channels and TRP channels 8 1.4 TRPV4 11 1.4.1 Structure of TRPV4 12 1.4.2 Activation and regulation of TRPV4 14 1.4.3 TRPV4 associated proteins 15 V 1.5 1.6 When calcium transport and signaling go wrong 16 1.5.1 17 TRPV4 in human diseases Research objectives 20 Chapter 2 Materials and Methods 21 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 2.9 2.10 2.11 2.12 2.13 2.14 2.15 2.16 2.17 2.18 22 22 23 24 25 25 26 27 28 28 29 30 30 31 31 32 33 35 Chemicals and reagents Antibodies Cell culture and cell lysis Transfection Drug treatment Immunoprecipitation Immunoblotting Immunohistochemistry Immunofluorescence Cell proliferation assay Wound healing assay Chemotaxis assay Invasion assay Transendothelial migration assay Xenograft Micropipette aspiration Intracellular calcium measurement Real-time PCR Chapter 3 Results 36 3.1 TRPV4 is overexpressed in breast cancer cell lines and tissues 3.1.1 Phosphoproteome of the breast cancer metastasis model 3.1.2 Bioinformatics and the characterization of the differentially expressed phosphoproteins across the BCM model 3.1.3 Upregulation of TRPV4 protein and mRNA across the BCM model 3.1.4 Upregulation of TRPV4 in invasive human breast cancer cell lines and tissues 37 37 42 TRPV4 is a positive regulator of breast cancer metastasis 3.2.1 Function of TRPV4 in breast cancer cell movement, invasion and transendothelial migration 3.2.2 Silencing of TRPV4 reduce the nodules’ size and number in the lungs of the mice 62 62 3.2 45 52 68 VI 3.3 Cellular and molecular mechanism of TRPV4 in cellular processes associated with metastasis 3.3.1 TRPV4 maybe necessary for cancer cell plasticity that promotes the intra-/ extravasation process 74 74 77 77 83 3.4 Mapping the pathways of TRPV4 3.4.1 Activation of TRPV4 stimulate the AKT and FAK pathways 3.4.2 Does AKT activation by TRPV4 mediated downregulation of E-cadherin and β-catenin proteins? 3.5 Function of TRPV4 and its signaling during metastatic processes 87 are associated with its role in increasing intracellular Ca2+ concentration 3.6 Constitutively active AKT can rescue phenotype of TRPV4silenced cells 92 3.7 TWIST mediates downregulation of E-cadherin 93 Chapter 4 Discussion 4..1 4..2 4..3 Ca2+ mediates activation of AKT/ PI3K signaling pathway by TRPV4 Potential role of transcriptional repression and proteosomal degradation in TRPV4-mediated downregukation of E-cadherin expression Limitation of the approaches 97 98 100 102 Chapter 5 Future directions 103 5.1 104 5.2 5.3 5.4 5.5 Functional analysis of TRPV4 domains and its naturally occurring mutations TRPV4 blockers Role of proteosomal degradation, transcription repression and other regulators of TRPV4 signaling pathway Role of phosphorylation of TRPV4 in metastasis Conclusion 105 105 107 108 List of publications 109 Bibliography 110 VII Appendix I Permission to reproduce: Figure 1.1 and 1.2 126 Appendix II Permission to reproduce: Table 1.1 131 Appendix III Permission to reproduce: Figure 1.4 135 Appendix IV Permission to reproduce: Figure 1.6 140 VIII SUMMARY Transient Receptor Potential Vanilloid subtype 4 (TRPV4), a non-selective calcium-permeable cation channel was discovered by our laboratory to be a novel breast cancer metastasis-associated protein. TRPV4 was found to be upregulated in invasive breast cancer cell lines and tumor breast tissues. It has been shown that 4α-PDD induced activation of TRPV4 led to a rise in intracellular Ca2+ concentration. Our in-vitro studies indicated that silencing of TRPV4 significantly abolished the invasiveness and the ability of murine mammary breast cancer metastatic cells to transmigrate through endothelial cells, but not the proliferation of the cells. Furthermore, in-vivo studies demonstrated that knockdown of TRPV4 significantly reduced the number and size of metastatic nodules in the lungs of SCID mice. These effects of TRPV4 knockdown were associated with a reduction in the plasticity of the cancer cells and diminution of intracellular Ca2+ concentration. Interestingly, activation of TRPV4 led to Ca2+-dependent activation of AKT/ PI3K pathways and downregulation of cell adhesion proteins such as E-cadherin and β-catenin, which may account for the decrease in cancer cell plasticity following TRPV4 knockdown. Our preliminary data showed that Twist might be involved in AKT-mediated repression of E-cadherin expression. Studies are currently under way in our laboratory to also investigate the potential role of proteosomal degradation in TRPV4-mediated downregulation of Ecadherin and β-catenin. In conclusion, this study shows that TRPV4 plays a novel role in cellular processes associated with metastasis and provides insights into the mode of action of TRPV4 in metastasis. IX LIST OF FIGURES 1.1 Metastatic Tropism Carcinomas 4 1.2 The Invasion-Metastasis Cascade 5 1.3 Typical subunit arrangement of a skeletal muscle voltage-gated calcium channel 8 1.4 Intracellular location and putative activation mechanisms of TRP channels 10 1.5 Schematic overview of TRPV4’s predicted structural and functional components. 12 1.6 Most potent TRPV4 agonists 14 3.1 Pervanadate induced tyrosine phosphorylation in Breast Cancer Metastasis (BCM) model 38 3.2 Schematic diagram showing the workflow of iTRAQ-based experiments to identify PV-induced tyrosine phosphorylation substrates in Breast Cancer Metastasis (BCM) model 39 3.3 The top most canonical pathway associated with the gene list is that of leukocyte extravasation signaling 43 3.4 Biological interaction network (BIN) of the proteins identified in PVinduced phosphotyrosine-proteome 45 3.5 Validation of known and potentially novel tyrosine-phosphorylated protein identified in BCM cell lines. 46 3.6 The MS/MS spectra of the 3 iTRAQ peptides for TRPV4 inset shows the intensity of the iTRAQ reporter ions derived from TRPV4 across the cell lines in BCM model. 48 3.7A Immunoprecipitation and immunoblotting of TRPV4 in the BCM cell lines 51 3.7B Immunofluorescence (IF) of TRPV4 in the BCM cell lines 51 3.8 52 The expression of TRPV4 in BCM model was examined using realtime PCR X 3.9A Immunoblotting of TRPV4 on the MCF10AT model 54 3.9B Immunoblotting of TRPV4 on a panel of human cell lines 54 3.10 Bar chart distribution of IHC scores for TRPV4 on matched normal (N), ductal carcinoma in situ (DCIS) and invasive ductal carcinomas (IDC) 57 3.11 The expression patterns of TRPV4 in 85 samples matched metastatic breast cancers and invasive ductal carcinomas (IDC) from tissue microarray 58 3.12 Box plot distribution of IHC scores for TRPV4 on normal (N), ductal carcinoma in situ (DCIS), invasive ductal carcinomas (IDC) and metastatic breast cancers 58 3.13A Representative IHC images showing upregulation of TRPV4 in matched clinical samples across the breast cancer progression. 60 3.13B Representative IHC images showing TRPV4 expression in tissue 60 microarray of breast cancer invasion versus matched metastatic breast cancer tissues 3.13C Immunohistochemistry of TRPV4 in the absence or presence of competing or control peptides 60 3.14 62 Kaplan-Meier analysis of disease-free survival (DFS) based on TRPV4 protein expression level from the breast cancer patients dataset 3.15A 4T07 cells transfected with TRPV4-specific siRNA sequences (Seq #1 and Seq #3) or an irrelevant sequence (Luc) were analysed for their TRPV4 expression. 64 3.15B Wound-healing assays showing that TRPV4 siRNA (200nM) inhibits the migration of 4T07 murine mammary epithelial tumor cells. 64 3.15C The percentage of gaps was estimated for 0hr, 8hr, 16hr and 24hr; and 64 the chart was plotted. 3.16 Chemotaxis assays showing that TRPV4 siRNA (200nM) inhibits the migration of 4T07 murine mammary epithelial tumor cells 65 3.17 Cell invasion assays showing that TRPV4 siRNA (200nM) inhibits the 65 migration of 4T07 murine mammary epithelial tumor cells 3.18 Transendothelial migration assays showing that TRPV4 siRNA 67 XI (200nM) inhibits the transendothelial migration of 4T07 cancer cells 3.19 Proliferation assays showing that TRPV4 siRNA (200nM) has no statistically significant effect on the 4T07 cells proliferation. 68 3.20 4T1 cells transfected with TRPV4-specific siRNA sequences (Seq #1 and Seq #3) or an irrelevant sequence (Luc) were analysed for their TRPV4 expression 70 3.21 Histological analyses showing staining of lung tissue sections from mice injected with 4T1 cells transfected with TRPV4-specific siRNA sequences (Seq #1 and Seq #3) or an irrelevant sequence (Luc) 70 3.22A Number of nodules with distinct sizes present in lungs harvested from SCID mice injected with TRPV4 knocked down and control 4T1 cells. 71 3.22B Box plots showing the distribution of nodules size and number of nodules 71 3.23A Representative IHC images showing expression of TRPV4 in the lungs tissue sections from the SCID mice injected with ctrl and TRPV4-knockdown 4T1 cells 73 3.23B Box plot showing expression of TRPV4 on the lungs tissue sections from the SCID mice injected with ctrl and TRPV4-knockdown 4T1 cells 73 3.24 The percentage of 4T07 cells that formed blebs at a pressure rate of 2 Pa/sec 76 3.25 The average of pressure when the blebs were started to be formed 76 3.26 Changes in levels of phospho-proteins and non-phospho proteins upon 4α-PDD stimulation for 15 mins and 16hrs in 4T07 cell line. 80 3.27 Changes in levels of phospho-proteins and non-phospho proteins upon 4α-PDD stimulation for 15 mins and 16 hrs in TRPV4knockdown 4T07 cells 82 3.28 Immunoblotting of TRPV4 upon 10µM of 4α-PDD stimulation and/ or 10µM Ruthedium Red (RR) on 4T07 cells for 16hrs 83 3.29 Effects on expression levels of phosphorylated S6, phosphorylated AKT, phosphorylated FAK, E-cadheria and β-catenin in the presence and absence of 5µM AKT inhibitor IV 85 3.30 Lack of effects of FAK inhibitor on expression levels of E-cadherin 86 XII and β-catenin. 3.31 Intracellular Ca2+ measurement indicates that TRPV4 siRNA decrease 88 store-operated Ca2+ influx in 4T07 cells 3.32 Effects of BAPTA-AM and EGTA Ca2+ chelators on TRPV4 signaling. 4T07 cells were stimulated with 4α-PDD for 15 mins. 90 3.33 Effects of BAPTA-AM and EGTA Ca2+ chelators on TRPV4 signaling. 4T07 cells were stimulated with 4α-PDD for 16 hrs. 91 3.34A Overexpression of constitutively active AKT construct rescue the effect of TRPV4 silencing on the expression of phosphorylated AKT and E-cadherin 93 3.34B Overexpression of constitutively active AKT construct rescue the transmigration effect of TRPV4 knockdown 93 3.35A The mRNA expression of E-cadherin in 4T07 cells upon different time-point of 4α-PDD stimulation 94 3.35B The protein expression of E-cadherin in 4T07 cells upon different time-point of 4α-PDD stimulation 94 3.36A 4T07 cells transfected with Twist-specific siRNA sequences (Seq #1 and Seq #2) or an irrelevant sequence (Luc). The transfected lysated were analysed for the expression of Twist and E-cadherin 96 3.36B The expression of E-cadherin in 4T07 cells silenced with Twistspecific siRNA 96 4.1 100 Schematic representation of the proposed signaling mechanism that promotes metastasis through the activation of TRPV4 in breast cancer XIII LIST OF TABLES 1.1 Plasmalemmal and endolemmal Ca2+-permeable channels in migration and metastasis 7 1.2 Naturally occurring TRPV4 mutations 19 3.1 Relative quantification of 4G10 anti-phosphotyrosine antibodiesenriched proteins in PV-stimulated of Breast Cancer Metastasis (BCM) model 40 3.2 Summary of top three associated network functions. 42 3.3 Statistical analyses of the relationships between different factors using experimental and clinical data from normal and tumor samples 61 3.4 Determination of the mice with distinct number of lung metastases nodules 71 3.5 Quantification of the percentage of 4T07 cells that formed blebs and the average of pressure at which bleb developed 74 5.1 The major phosphorylation sites of TRPV4 in response to different stimulators 108 XIV LIST OF SUPPLEMENTARY TABLES Supplementary Table 1 Peptide summary Supplementary Table 2 IPA summary Supplementary Table 3 Cononical pathways Supplementary Table 4 IHC scoring and clinicohistopathological data Supplementary Table 5 Statistical analyses of IHC Supplementary Table 6 Nodules counting and IHC XV LIST OF ABBREVIATIONS °C 3'UTR 4α-PDD aa AKT BAPTA BCM model BSA Ca 2+ degree Celsius 3' untranslated region 4-alpha-Phorbol 12,13-Didecanoate amino acid AKR mouse T-cell lymphoma-derived oncogenic product 1,2-bis(o-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid breast cancer metastasis model bovine serum albumin calcium Ctrl control DMSO E. coli ECL ECM EDTA EGFR EGTA ERK ESI FBS GTP GTPase HA HGF HRP Hrs IF IGF-1 IHC IP IP3 iTRAQ Kd kDa LC-MS/MS Luc MAPK MEK MEM Dimethyl sulfoxide Escherichia coli enhanced chemiluminescence extracellular matrix ethylene-diamine tetra-acetic acid epidermal growth factor receptor ethylene glycol tetraacetic acid extracellular signal-regulated kinase electrospray ionization fetal bovine serum guanosine triphosphate guanosine triphosphatase haemagglutinin hepatocyte growth factor horseradish peroxidase hepatocyte growth factor-regulated tyrosine kinase substrate Immunofluorescence insulin growth factor 1 Immunohistochemistry staining immunoprecipitation inositol 1,3,5-trisphosphate isotope tagging for relative and absolute quantification knockdown kilo Dalton liquid chromatography-tandem mass spectrometry Luciferase mitogen-activated protein kinase mitogen activated extracellular signal regulated kinase modified eagles medium XVI Mets mg MG132 MgCl2 mL mM MMTS MTS Na3VO4 NaCL NaF ng NID N-terminal PBS PBST PDGF PDK-1 PH PI3,5P2 PI3K PI3P PIP2 PIP3 PKC PLCγ PM PMA PNS PTB PV PVDF pY PY20H Rab11 Rab4 Rab5 Rab7 Raf rpm RPMI RR RTK Metastasis milligram N-(benzyloxycarbonyl)leucinylleucinylleucinal magnesium chloride millilitre millimolar methyl methanethiosulfonate 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4sulfophenyl)-2H-tetrazolium, inner salt sodium orthovanadate sodium chloride sodium fluoride nanogram non-ionic denaturing amino (NH2)-terminal phosphate buffered saline phosphate buffered saline with Tween 20 platelet-derived growth factor phosphoinositide-dependent kinase-1 Pleckstrin homology phosphatidylinositol-3,5-bisphosphate phosphatidylinositol 3-kinase phosphatidylinositol 3-phosphate phosphatidylinositol-4,5-bisphosphate phosphatidylinositol-3,4,5-trisphosphate protein kinase C phospholipase Cγ plasma membrane phorbol myristate acetate post nuclear supernatant phosphotyrosine binding Pervanadate polyvinylidene difluoride phosphotyrosine phosphotyrosine antibody conjugated to horseradish peroxidase Ras-associated protein 11 Ras-associated protein 4 Ras-associated protein 5 Ras-associated protein 7 Rapidly growing fibrosarcoma revolutions per minute Roswell Park Memorial Institute Ruthedium red receptor tyrosine kinase XVII S1 S2 S3 SCX SDS-PAGE Ser TEMED TRP TRPC TRPM TRPV TRPV4 Tyr V WT Y g l M [Ca2+]i SiRNA sequence 1 SiRNA sequence 2 SiRNA sequence 3 strong cation exchange sodium dodecyl sulphate-polyacrylamide gel electrophoresis Serine N,N,N',N'-tetramethyl-ethylene-diamine Transient receptor potential TRP canonical proteins named after the initial member, melastatin named after the vanilloid receptor VR1 Transient receptor potential cation channel subfamily V member 4 Tyrosine voltage wild type Tyrosine microgram microlitre micromolar concentration of intracellular calcium XVIII Chapter 1 Introduction 1 1.1 Importance of Ca2+ homeostasis and signaling Ca2+ signaling is used throughout the life history of an organism. Life begins with a surge of Ca2+ at fertilization and this versatile system is then used repeatedly to control many processes during development and in adult life (Berridge et al., 2000). One of the fascinating aspects of Ca2+ is that it plays an important role in signal transduction pathways to accomplish a variety of biological functions including differentiation and proliferation (Prevarskaya et al., 2011). Ca2+ also exhibits a crosstalk among a variety of signaling pathways (Feissner et al., 2009; Memon et al., 2011). Calcium storages are intracellular organelles that constantly accumulate Ca2+ ions and release them during certain cellular events. Intracellular Ca2+ storages include mitochondria and the endoplasmic reticulum. Calcium levels in mammals are tightly regulated, with bone acting as the major mineral storage site. Calcium is released from bone into the bloodstream under controlled conditions. Calcium is transported through the bloodstream as dissolved ions or bound to proteins such as serum albumin (Jayanthi et al., 2000). 1.1.1 Ca2+ deregulations and cancers A cellular Ca2+ overload or the perturbation of intracellular Ca2+ compartmentalization can cause cytotoxicity and trigger apoptosis or necrosis (Rizzuto et al., 2003). Metastatic calcification is defined as the pathologic process whereby calcium salts accumulate in previously healthy tissues, caused by excessive levels of blood calcium, such as in hyperparathyroidism. It has been postulated that microcalcification is a result of abnormal calcium deposition and mineralization of necrotic debris (Valastyan and Weinberg, 2011). Under such circumstances, various Ca2+-dependent signaling cascades with kinases and phosphatases directly or 2 indirectly influence cellular signaling, including activation of p53 (Liu et al., 2007; Scotto et al., 1999), MAPKs (Crow et al., 2001; Stringaris et al., 2002), phosphoinositide 3-kinase (PI3K) (Liu et al., 2007; Viard et al., 2004) and Akt signaling pathways (Coticchia et al., 2008; Deb, 2004). Previous studies have shown that Ca2+ influx is essential for the adhesion and migration behaviors in several types of cancer, including breast cancer (Gruber and Pauli, 1999); (Du et al., 2012); (Davis et al., 2012); (Sergeev, 2012), melanoma (Chantome et al., 2009), leukemia (Li et al., 2009) and glioblastoma (Wondergem and Bartley, 2009); (Becchetti and Arcangeli, 2010); (Potier et al., 2011). 1.2 Tumor metastasis Tumor metastasis is very common in the late stages of cancer. The spread of metastases may occur via the blood or the lymphatics or through both routes. The most common places for the metastases to occur are the lungs, liver, brain and the bones as indicated in Figure 1.1 (Valastyan and Weinberg, 2011). Although surgical resection and adjuvant therapy can cure well confined primary tumors, metastatic disease is largely incurable because of its systemic nature and the resistance of disseminated tumor cells to existing therapeutic agents. This explains why > 90% of mortality from cancer is attributable to metastases, not the primary tumors from which these malignant lesions arise (Palmieri et al., 2006). 3 Figure 1.1 Metastatic Tropism Carcinomas originating from a particular epithelial tissue form detectable metastases in only a limited subset of theoretically possible distant organ sites. The most common sites of metastasis for six well-studied carcinoma types are shown. Primary tumors are depicted in red. Thickness of black lines reflects the relative frequencies with which a given primary tumor type metastasizes to the indicated distant organ site. (Valastyan and Weinberg, 2011) See Appendix I for permission to reproduce. The metastases spawned by carcinomas are formed following the completion of a complex succession of cell-biological events - collectively termed the invasionmetastasis cascade - whereby epithelial cells in primary tumors: (I) invade locally through surrounding extracellular matrix (ECM) and stromal cell layers, (II) 4 intravasate into the lumina of blood vessels, (III) survive the rigors of transport through the vasculature, (IV) arrest at distant organ sites, (V) extravasate into the parenchyma of distant tissues, (VI) initially survive in these foreign microenvironments in order to form micrometastases, and (VII) reinitiate their proliferative programs at metastatic sites, thereby generating macroscopic, clinically detectable neoplastic growths (the step often referred to as ‘‘metastatic colonization’’) (Figure 1.2). Figure 1.2 The Invasion-Metastasis Cascade Clinically detectable metastases represent the end products of a complex series of cell-biological events, which are collectively termed the invasionmetastasis cascade. During metastatic progression, tumor cells exit their primary sites of growth (local invasion, intravasation), translocate systemically (survival in the circulation, arrest at a distant organ site, extravasation), and adapt to survive and thrive in the foreign microenvironments of distant tissues (micrometastasis formation, metastatic colonization). Carcinoma cells are depicted in red. (Valastyan and Weinberg, 2011) See Appendix I for permission to reproduce. 5 1.2.1 Ca2+ and metastatic behavior There is an increasing amount of evidence that correlates the function of Ca2+ channels with migration, invasion and metastasis of tumor cells. As illustrated in Table 1.1, a number of known molecular players in cellular Ca2+ homeostasis, such as the Ca2+-permeable members of the transient receptor potential (TRP) channel family and the constituents of store-operated Ca2+ entry, calcium release-activated calcium channel protein 1 (ORAI1) and stromal interaction molecule 1 (STIM1), have been implicated in the development of the metastatic cell phenotype and tumor cell migration. The data linking specific TRP channels to cancer cell migration, invasion and metastasis are still largely phenomenological. In general, Ca2+-dependent mechanisms of malignant migration do not seem to be very different from those that characterize normal physiological migration. The major difference seem to arise at a quantitative level owing to the aberrant expression of Ca2+-handling proteins and/or Ca2+-dependent effectors, leading to the increased turnover of focal adhesions and more effective proteolysis of ECM (extracellular matrix) components (Prevarskaya et al., 2011). Migrating cells exhibit a stable and transient gradient of [Ca2+]i, increasing from the front of the cell to the rear, that is thought to be responsible for rear-end retraction (Hahn et al., 1992). Our knowledge of Ca2+ signaling pathology is still in its nascent state. Deeper investigations are required to understand the role Ca2+ channels in cancer in order to develop further knowledge of Ca2+ channels as valuable diagnostic and prognostic markers, as well as targets for pharmaceutical intervention and targeting. 6 Table 1.1 Plasmalemmal and endolemmal Ca2+-permeable channels in migration and metastasis. (Prevarskaya et al., 2011) See Appendix II for permission to reproduce. Abbreviations: TRP, transient receptor potential; SOC, store-operated calcium; IP3R, IP3 receptor; RYR, ryanodine receptor; ND, not determined. 7 1.3 Ca2+ channels and TRP channels In all eukaryotic cells, the cytosolic concentration of Ca2+ ions is tightly regulated by interactions among transporters, pumps, Ca2+ channels and binding proteins. Ca2+ channels are found in the plasma membrane and in the membranes of intracellular Ca2+ stores such as the sarcoplasmic/endoplasmic reticulum. These channels transport positively charged calcium atoms (calcium ions) into cells. Ca2+ channels play key roles in a cell's ability to generate and transmit electrical signals. Ca2+ ions are involved in many different cellular functions, including cell-to-cell communication, the tensing of muscle fibers (muscle contraction) and the regulation of certain genes (Lee et al., 2006). Ca2+ channels are made up of several protein components (subunits), each of which is produced from a particular gene. The α1 (alpha-1) subunit is the largest and most important component of a Ca2+ channels. It forms the pore in which calcium ions can flow. Several other subunits interact with the α1 subunit such as β, α2, δ and γ to help regulate the channel's function as illustrated in Figure 1.3 (Van Petegem et al., 2004). Figure 1.3 Typical subunit arrangement of a skeletal muscle voltage-gated calcium channel. Adapted from image obtained from Dr. Filip Van Petegem's website: http://research.biochem.ubc.ca/fac_research/faculty/Van%20petegem.html 8 Multiple types of voltage-gated Ca2+ channels were first distinguished by voltage- and time-dependence of channel gating, single channel conductance and pharmacology (Carbone and Lux, 1984); (Nowycky et al., 1985). One physiologically relevant characteristic which varies considerably among the different Ca2+ channel types is the degree of depolarization required to cause significant opening. Based on this criterion, voltage-gated Ca2+ channels are divided into two groups, low voltageactivated (LVA) and high voltage-activated (HVA). Use of all the criteria listed above has led to a more specific classification of native Ca2+ channels as T-, L- N-, P/Q- and R-type (Llinas et al., 1992); (Randall and Tsien, 1995). The ‘T’ stands for transient referring to the length of activation. Transient receptor potential (TRP) superfamily of cation channels is the T-type Ca2+ channels as described in more detail below. Transient receptor potential (TRP) channels can be divided into six subfamilies: TRPC (Canonical), TRPV (Vanilloid), TRPM (Melastatin), TRPML (Mucolipin), TRPP (Polycystin), and TRPA (Ankyrin transmembrane protein) as illustrated in Figure 1.4 (Dong et al., 2010). There is another subfamily had been identified currently which is TRPN (NomPC-like) (Santoni and Farfariello, 2011). TRP channels were originally identified in Drosophila photo-transduction,whereby spontaneously occurring mutants areunable to sustain a response to continuous light, insteadshowing a transient receptor potential (TRP), hence the name TRP was given (Montell and Rubin, 1989). Apart from mediating responses to light, TRP channels are sensitive to mechanical, chemical, thermal and osmotic stimuli (Minke and Cook, 2002). 9 Figure 1.4 Intracellular location and putative activation mechanisms of TRP channels. TRPs can be divided into six groups (TRPC, TRPV, TRPM, TRPA, TRPML, and TRPP). TRPML1-3, TRPV2, and TRPY1 (yeast TRP yvc1), and TRPM7 (in red) are likely to play active roles in membrane traffic and exocytosis. TRPM2, TRPM8, TRPV1, TRPP1, TRPA1, and TRPV4 (in green) have been shown to be active in intracellular membranes and may play roles in intracellular signal transduction. TRPC3-6, TRPMV5/6, TRPM1, TRPM7, and TRPML2/3 (in blue) have been shown to undergo regulated exocytosis. Intracellular localization of other TRPs (in black) has not been well documented. (Dong et al., 2010) See Appendix III for permission to reproduce. TRP channels with diverse physiological functions including thermosensation and mechanosensation have been identified to profoundly affect a variety of physiological and pathological processes as excellently described by (Clapham, 2003); (Montell, 2005); (Lee et al., 2006); (Nilius, 2007). Among the TRP families, the expression levels and activity of some members of the TRPC, TRPM and TRPV families have been correlated with cancer, leading to the discovery of tumor-related functions such as regulation of proliferation, differentiation, apoptotis, angiogenesis, migration and invasion during cancer progression (Duncan et al., 1998); (Wissenbach 10 et al., 2001); (Thebault et al., 2006); (Kiselyov et al., 2007); (Amantini et al., 2007); (Caprodossi et al., 2008); (Nabissi et al., 2010). TRP channels may regulate cancer progression at different levels (Gupta and Massague, 2006): by interacting with specific G protein-coupled receptors (GPCRs) at the plasma membrane (Zhang and Oppenheim, 2005), by regulating the expression and the activity of cell-surface glycoproteins (Chang et al., 2005); (Cha et al., 2008), by acting as Ca2+ entry pathways in the plasma membrane (Prevarskaya et al., 2007); (Flourakis and Prevarskaya, 2009) or by regulating the binding, trafficking and functional activity of several growth factors (Bode et al., 2009). The vanilloid receptor family (TRPV) is a subgroup of the transient receptor potential (TRP) superfamily of ion channels, and six members (TRPV1-6) have so far been identified. The six vanilloid receptor members have been divided into four groups on the basis of structure and function: TRPV1/2, TRPV3, TRPV4 and TRPV5/6. In this project, we will focus on TRPV4 as discussed in the following sections. 1.4 TRPV4 Transient receptor potential cation channel subfamily V member 4 (TRPV4) formerly known as CMT2C, OTRPC4, TRP12, VRL-2 or VR-OAC is distributed in central and peripheral nervous systems, liver, kidney, adipose tissue, lung, brain, heart and testis. The human TRPV4 gene is localized on chromosome 12q23-q24.1 and consists of 12 exons (ENSEMBL: ENSG00000111199). 11 1.4.1 Structure of TRPV4 As illustrated in Figure 1.5, the putative transmembrane structure of TRPV4 is consisting of 871 amino acids (aa) with intracellular Amino (N-) and Carboxyl (C-) terminus, six transmembrane-spanning domains (TM1–6), and a pore-forming loop between TM5 and TM6 (Liedtke et al., 2000); (Heller and O'Neil, 2007). Even though TRPV4 shows sequence similarity to other members of the TRPV family, particularly to TRPV1–3, a coexpression study has indicated that TRPV4 preferentially forms homomers (Hellwig et al., 2005), however, there is no evidence for heteromultimeric combinations with other TRPVs. A. Amino terminus, aa 1-470 Bipartite nuclear targeting sequence Src family tyrosine phosphorylation ARD1 Protein kinase C phosphorylation N-myristoylation ARD2 ARD3 Protein kinase C phosphorylation cAMP phosphorylation B. Membrane-spanning core region, aa 471-713 Extracellular TM1 TM2 TM3 TM4 TM5 ASN glycosylation Protein kinase C phosphorylation Y555, required for activation by 4α-PDD PL TM6 Pore helix Potential selectivity filter SETFSTFLLD472LFKLTIGMGD682 50-75% conserved with TRPV1-3 100% conserved with TRPV1-3 C. Carboxyl terminus, aa 713-871 50 amino acids Region involved in MAP7 interaction Calmodulinbinding region Figure 1.5 Schematic overview of TRPV4’s predicted structural and functional components. Shown are schematic representations of TRPV4’s amino terminus (A), its central region with the membrane-spanning domains and the pore loop (B), and the channel’s carboxyl terminus (C). Specific domains and amino acids are indicated. Regions that are predicted to be extracellularly located are indicated with a black horizontal bar in B. Also shown in B are the proposed pore helix and selectivity filter displaying the ‘TIGMGD’ region similar to the K+ channel selectivity filter signature sequence. Adapted from (Heller and O'Neil, 2007). 12 The amino-terminal part of TRPV4 as shown in Figure 1.5A likely has three ankyrin repeat domains (ARD1–3) within an ankyrin repeat region from aa235 to aa367, a cluster of four protein kinase C (PKC)–phosphorylation sites and a cAMPdependent–phosphorylation site upstream of the ankyrin repeat region, and a cluster of two PKC sites within and downstream of ARD3. It has been hypothesized that activation of PKC with phorbol esters leads to opening of TRPV4 and increase of intracellular Ca2+ concentration (Xu et al., 2003a); (Gao et al., 2003). Figure 1.5B showing the 242-aa-long central domain of TRPV4 consists of TM1–6, which between TM5 and TM6, a short hydrophobic stretch that is the putative pore region or pore loop. The channel appears to be posttranslationally modified by glycosylation (Arniges et al., 2006), and a bona fide Asn glycosylation site within the extracellular stretch between TM5 and the PL has been shown to be glycosylated in heterologously expressed TRPV4 (Xu et al., 2006). A PKC phosphorylation site downstream of TM2 is potentially involved in the abovementioned PKC regulation of TRPV4 activation. Moreover, phorbol esters can activate TRPV4 via direct interactions with residues inTM3 and TM4 (Gevaert et al., 2007). The TRPV4’s carboxyl-terminal tail as illustrated in Figure 1.5C appears to be the docking site for at least two interacting sites including calmodulin (CAM) binding sites and region involved in microfilament-associated protein 7 (MAP7) interaction sites. The best characterized CAM domain is located between aa812-aa831 and is involved in Ca2þ-dependent activation of TRPV4 (Strotmann et al., 2003); (Garcia-Elias et al., 2008). Mutations within this region resulted in a loss of Ca2+dependent calmodulin binding and a loss of Ca2+-dependent potentiation of TRPV4 13 currents (Liedtke et al., 2000); (Watanabe et al., 2003). Coexpression of TRPV4 with MAP7 in CHO cells apparently increases the amount of TRPV4 protein associated with the plasma membrane, which could be a method employed by cells to control the density of TRPV4 in the plasma membrane (Suzuki et al., 2003). 1.4.2 Activation and regulation of TRPV4 TRPV4 can be activated by a wide variety of stimuli including physical (low pH, cell swelling, heat and mechanical stimulation) and chemical (endocannabinoids, arachidonic acid and 4α-phorbol esters). Some of the most potent TRPV4 agonists as revealed in the Figure 1.6. Figure 1.6 Potent TRPV4 agonists. A. 4-phorbol 12,13-didecanoate (4-PDD; EC50 200-400 nM) and its putative binding pocket between TM3-TM4 of TRPV4 (Gevaert et al., 2007). B. 4α- phorbol 12,13-dihexanoate (4α-PDH) is a 5-fold more potent TRPV4 activator than 4α-PDD (EC50 ~ 70 nM) (Klausen et al., 2009). C. Recently described TRPV4 agonist GSK1016790A (EC50 ~ 1-10 nM). (Thorneloe et al., 2008) See Appendix IV for permission to reproduce (Everaerts et al., 2010). 14 TRPV4’s activity seems to be regulated by a calmodulin-dependent mechanism with a negative feedback mechanism. It promotes cell-cell junction formation in skin keratinocytes and plays an important role in the formation and maintenance of functional intercellular barriers. It also acts as a regulator of [Ca2+]i in synoviocytes and confers many distinct cellular functions in various cell types throughout the body (Estevez and Strange, 2005). Like many other Ca2+-permeable ion channels, the activity of TRPV4 is strongly regulated by Ca2+. The Ca2+ regulates the channels in both directions; it controls both the activation and inactivation of TRPV4. Spontaneous TRPV4 activity is strongly reduced in the absence of extracellular Ca2+, or by the replacement of extracellular Ca2+ by ion Strontium (Sr2+) or ion Barium (Ba2+) (Strotmann et al., 2003). 1.4.3 TRPV4-associated proteins TRPV4 is associated with proteins such as TRPV2, Akt, progesterone receptors, integrin, MAP7 and OS-9. TRPV4 had been reported to associate with TRPP2, a member of the polycystin subfamily of TRP channels, and forms a mechano- and thermosensitive molecular sensor in the primary ciliumof vertebral epithelial cells. Although TRPP2 itself is not considered to be mechano-sensitive, polycystic kidney disease (PKD) cilia that express mutant TRPP2 channels lack mechanosensitive properties, suggesting a pathogenic role of TRPV4 in PKD (Kottgen et al., 2008). TRPV4 activation was linked to Akt phosphorylation and β-Raf and Erk1/2 inhibition (Gradilone et al., 2010). Its activation in polycystic kidney (PCK) cholangiocytes led to an increase in [Ca2+]i and inhibition of cell proliferation and 15 cyst growth in 3-dimensional culture (3-fold). Moreover, TRPV4 stimulated phosphatidylinositol 3 kinase–dependent activation and binding of additional β1 integrin receptors, which promoted cytoskeletal remodeling and cell reorientation (Thodeti et al., 2009). Thus, TRPV4 appears to mediate a novel stretchsensitive ‘integrin-to-integrin’ signaling mechanism that is required for capillary endothelial (CE) cell reorientation during angiogenesis. There are some reports regarding the regulation of TRP channels by sex hormones: Estrogen downregulates expression of TRPC4 in aortic endothelial cells (Chang et al., 1997), testosterone up-regulates expression of TRPM8 in prostate epithelial cells (Bidaux et al., 2005), and progesterone increases TRPV6 expression in breast cancer cells (Bolanz et al., 2008). Interestingly, it had been demonstrated that TRPV4 promoter activity was reduced by coexpression with progesterone receptors (PR) and further reduced in the presence of hormone progesterone (PG) (Jung et al., 2009). Apart from these, the microtubule-associated protein 7 (MAP 7) interacts with the C terminus of TRPV4. It had been reported that MAP7 enhances expression of TRPV4 in the plasma membrane and links the channel to the cytoskeletal microtubules, forming a mechano-sensitive molecular complex (Suzuki et al., 2003). Furthermore, it had been shown that OS-9 binds to N-terminus of monomeric TRPV4 at the endoplasmic reticulum (ER) to regulate its biogenesis and prevents its polyubiquitination and subsequent proteosomal degradation (Wang et al., 2007). 1.5 When calcium transport and signaling go wrong Calcium signaling is an important factor in the metastatic behaviour of cancer cells. There are promising developments in the targeting the molecular constituents of 16 calcium signalling for restraining metastasis. The importance of Ca2+-permeable ion channels is not limited to cancer therapies, but it also might be useful for diagnostic purposes. A good example is the highly Ca2+- selective TRPV6. Its expression and function was shown to correlate with prostate cancer grade (Lehen'kyi et al., 2007); (Valero et al., 2011). Importantly, the TRPV6 channel is consistently overexpressed not only in prostate cancer but also in breast, thyroid, colon, and ovarian carcinomas (Zhuang et al., 2002). Decreased expression of TRPM1 has been shown to correlate with melanoma cell transition from a low to a high metastatic phenotype (Miller et al., 2004). TRPC6 had been identified as a novel therapeutic target for esophageal carcinoma, whereas high levels of TRPC3 expression correlate with a favorable prognosis in patients with lung adenocarcinoma (Ouadid-Ahidouch et al., 2012). Interestingly the role for store-operated Ca2+ entry in tumor metastasis had been reported recently. SiRNA-mediated reduction of Orai1 or STIM1 expression in highly metastatic human breast cancer cells or the treatment with a pharmacological inhibitor of store-operated calcium channels was shown to decrease tumor metastasis in animal models (Yang et al., 2009). In addition, transcriptional profiling of primary breast cancer specimens using DNA microarrays has identified that alteration in the ratio of STIM1 to STIM2 is associated with poor breast cancer prognosis (McAndrew et al., 2011). 1.5.1 TRPV4 in human diseases Recently, several studies have demonstrated that mutations in the TRPV4 gene can results in genetic disorders such as Brachyolmia, Charcot-Marie-Tooth disease type 2C (CMT2C), Spinal Muscular Atrophy (SMA), Hereditary Motor and Sensory 17 Neuropathy type 2 (HMSN2C), Spondylometaphyseal dysplasias (SMDK) and metatropic dyplasia. Most of these missense and nonsense point mutations are linked to the development of genetic disorders in human and a detailed list of naturally occurring TRPV4 mutations and related disease is documented in Table 1.2. All these studies had highlighted an important role for TRPV4 in the human pathogenesis. Thus, TRPV4 seems to be an important pharmacological target in the treatment of various diseases such as arthritis, interstitial cystitis, hypotonic hyperalgesia, allodynia, asthma, bronchial hyperresponsiveness, neuropathic pain, impairment of osmoregulation, hypertension and defective environmental themosensation. As TRPV4 is involved in the control of proliferation and growth in normal cells (Nilius et al., 2007), dysfunctions may lead to growth disturbances, altered organogenesis or cancer. TRPV4 has never been implicated in human cancers although the transcript of TRPV4 was inadvertently observed in a DNA microarray study to be more in colon cancer compared to normal tissue. TRPV4 was detected to be over-expressed in colon cancer at the mRNA level (https://www.oncomine.org/resource/login.html). The human gastrointestinal tract is innervated by primary visceral afferents that express at least three of these channels including TRPV1, TRPA1 and TRPV4. TRPV4 has recently been shown to be expressed in colon afferents, where it appears to have a significant role in nociception and the development of hypersensitivity (Christianson et al., 2009). 18 Table 1.2 Naturally occurring TRPV4 mutations. Table adapted from (Verma et al., 2010) Mutation 1 C366T Residue T89I (exon 2) Change in Domain/ Effects on Genetic charge motif ion disorder effected conductivity N-terminal Not done Polar (uncharged) to Metatropic dysplasia 24 nonpolar 2 G547A E183K Negative to plus ARD1 Not done SEDM-PM2 K197R Plus to plus ARD2 Not done Metatropic (exon 3) 3 A590G (exon 4) 4 G806A dysplasia R269C (exon 5) 5 G806A Plus to polar un ARD3 charged R269H Plus to plus C946T ARD3 A992G R316C A1805G Plus to polar ARD4 (uncharged) D333G (exon 6) 8 More CMT2C conductivity (exon 6) 7 CMT2C conductivity (exon 5) 6 More Negative to Less HMSN2C 4 conductivity ARD4 nonploar More SMDK conductivity Y602C Aromatic to polar TM4-TM5 Not done SEDM-PM2 V620I Nonpolar to TM5, pore More Brachylomia nonpolar region conductivity Nonpolar to polar Cytoplasmic Same as wild side type (exon 11) 9 G858A (exon 12) 10 C2146T A716S (exon 13) SMDK of TM6 11 C2396T (exon 15) P799L Nonpolar to C-terminal Not done SMDK nonpolar 19 1.6 Research objectives Investigation of target genes that are associated with metastasis progression is critical for improving the outcomes of our patients. In recent years, metastasis research has entered into a stage of remarkable progress. In an attempt to map the molecular changes associated with metastasis, our lab conducted phosphoproteomics analysis on a murine breast cancer metastasis model comprising a series of isogenic breast cancer cell lines with increasing metastatic potential. TRPV4 was subsequently discovered to be a novel phosphoprotein that is associated with breast cancer metastasis. Although TRPV4 is one of the most studied channels of the entire TRP superfamily in term of its structure, activators, localization, tracfficking and biophysical properties, its roles and modes of actions in breast cancer metastasis remain obscure. We hypothesize that TRPV4 is a positive regulator in breast cancer metastasis. In this project, we focus on understanding the function and mechanism of TRPV4 in breast cancer metastasis through the use of a selective activator 4α-PDD, in-vitro based assays, signal transduction tools and mouse models. We believe that further efforts to unravel the modus operandi of the TRPV4 channel will lead a better understanding about the molecular etiology of breast cancer metastasis. This has implications on the development of improved molecularly targeted approaches for diagnosis and treatment of cancer. 20 Chapter 2 Materials and Methods 21 2.1 Chemicals and reagents The IGEPAL, NaCl, Triton-X, sodium fluoride, sodium orthovanadate and DMSO were purchased from Sigma Chemical (St Louis, MO). The protease inhibitors were from Roche (Nutley, CA). The Tris-base and EDTA were from First Base Laboratories Sdn Bhd (Selangor Darul Ehsan, Malaysia). The transfection reagent JetPRIME™ was supplied by Polyplus-transfection Inc. (New York, USA). MTS assay was obtained from Promega (San Luis, CA). Ruthenium Red from Tocris Bioscience (Bristol, UK). 4 alpha-Phorbol 12,13-Didecanoate, BAPTA-AM and AKT inhibitor IV were from Merck KGaA (Darmstadt, Germany), whole MG132, EGTA and FAK inhibitor were from Sigma-Aldrich (St. Louis, MO). TRPV4-specific siRNA oligos were purchased from Invitrogen (Carlsbad, CA) and the siRNA sequences are as following: Luciferase GL2: 5’-CGUACG CGGAAUACUUCGA-3’; TRPV4 siRNA1: 5’-AGAAGCAGCAGGUCGUACAUCUUGG-3’; TRPV4 siRNA2: 5’-UAAUGGGCUCUACAGCCAGCAUCUC-3’; TRPV4 siRNA3: 5’-AAACUUGGUGUUCUCUCGGGUGUUG-3’; Twist siRNA1: 5’- GGCAGAGAUCCGUAGUACUUGCGUU -3’ Twist siRNA2: 5’- GCCCAGAGAUCUGUAUUACGGGUUU -3’ Twist siRNA3: 5’- AAUAGAUCCGGUGUCUAAAUGCAUU -3’ 2.2 Antibodies Anti-TRPV4 polyclonal antibodies were kindly provided by Prof. Dr. Christian Harteneck; Institut fUr Experimentelle & Klinische Pharrnakologie & Toxikologie Eberhard-Karls-Universitat Tǘbingen, Germany. E-cadherin polyclonal antibodies, phospho-AKT (S473) polyclonal antibodies, AKT polyclonal antibodies, 22 phospho-MAK (T202/Y204) monoclonal antibodies, phospho-S6 (Ser235/236) polyclonal antibodies, anti-S6 ribosomal protein (54D2) monoclonal antibodies and anti-Ezrin polyclonal antibodies were purchased from Cell Signaling Technology Inc. (Danvers, MA). β-catenin monoclonal antibodies, ERK1 monoclonal antibodies, and FAK1 monoclonal antibodies were from BD Transduction (San Jose, CA). P13 Kinase p85 alpha monoclonal antibodies, phospho FAK (Y397) polyclonal antibodies and phospho PLCgamma1 (Y783) polyclonal antibodies were from Abcam (Cambridge, MA). Peroxidase-conjugated anti-phosphotyrosine antibodies (PY20H), peroxidase-conjugated anti-actin antibodies, PLCgamma1 monoclonal antibodies and anti-Twist monoclonal antibodies were purchased from Santa Cruz Technology, Inc (Santa Cruz, CA). Anti-mouse IgG (whole molecule) and anti-rabbit IgG (whole molecule) horseradish peroxidase (HRP) conjugates, anti-mouse and anti-rabbit antibodies conjugated to agarose were obtained from Sigma Aldrich (St. Louis, MO). Anti-mouse IgG and anti-rabbit IgG conjugated to flurophores Alex Fluor 488 and 568 were obtained from Invitrogen Corporation (Carlsbad, CA). 2.3 Cell culture and cell lysis The breast cancer metastasis model series (67NR, 168FARN, 4TO7 and 4T1) were obtained from a single spontaneously arising mouse mammary tumor in a Balb/C mouse and xenograft-derived breast cancer cell lines (MCF10A1, MCF10AT1KCl.2, MCF10CA1h and MCF10CA1aCl.1) were obtained from Dr Fred Miller at the Barbara Ann Karmanos Cancer Institute (Detroit, MI). The 67NR, 168FARN, 4TO7 and 4T1 cell lines were cultured in DMEM supplemented with 10% fetal bovine serum, 100U/ml penicillin, and 292mg/mL streptomycin. Whereas the MCF10A1, MCF10AT1KCl.2, MCF10CA1h and MCF10CA1aCl.1 cell lines were 23 cultured in DMEM/F12 with 10mM HEPES and 5% horse serum, 20 ng/ml epidermal growth factor (Upstate Biotechnology Inc, Lake Placid, NY), 10mg/ml insulin (Sigma Chemical, St Louis, MO), 100 ng/ml cholera enterotoxin (Calbiochem, La Jolla, CA), and 0.5mg/ml hydrocortisone (Sigma Chemical). HMEC cells (kindly provided by Prof Peter Lobie from Cancer Science Institute of Singapore, National University of Singapore) were grown using Invitrogen HMEC media kit, whereas MCF10A cells were cultured in DMEM-F12 media supplemented with 5% horse serum, 100 U/mL penicillin, and 292 mg/mL streptomycin. MCF7, T47D, SKBR3, MDA-MB157, MDA-MB231, MDA-MB453, MDA-MB468, BT20, BT474 and BT549 were cultured in RPMI 1640 (Sigma) containing 10% FBS (Hyclone) and 100U Penicillin/Streptomycin (Invitrogen). Cells were incubated at 37˚C in a humidified atmosphere containing 5 % CO2 until confluence then lysed. Cells were rinsed with ice-cold PBS and lysed on ice for protein extraction with non-ionic detergent lysis buffer (50mM pH7.5 Tris-HCl, 0.5% IGEPAL, 150mM NaCl, 1mM pH8.0 EDTA, 0.5% Triton X, 50mM sodium fluoride 1mM sodium orthovanadate and protease inhibitors). Protein lysates were then clarified by centrifugation at 4°C at 14,000 rpm for 10min. The total protein was determined using the bicinchoninic acid assay (BCA) kit (Thermo Fisher Scientific, Rockford, IL). 2.4 Transfection For knockdown experiments, cells were seeded at 70-80% confluency in 60- mm dish in medium containing 10% FBS and 100U Penicillin/Streptomycin one day before transfection and transfected with 200nM siRNA and 10µl jetPRIME™ reagent (Polyplus Transfection Inc.) according to the manufacturer’s instructions. Cells were 24 harvested 48 hr post-transfection. Mock transfections and non-specific siRNA duplexes were used as the negative controls. Cells were treated for 48 to 72 hr to allow maximum knockdown, after which they were either harvested for Western blot analysis or used for functional assays. For overexpression experiments, cells were seeded at 70-80% confluency in 60-mm dish in medium containing 10% FBS and 100U Penicillin/Streptomycin one day before transfection. Constitutively active AKT construct or Myr-AKT (plasmid 1036) was purchased from Addgene (Cambridge, MA). According to the manufacturer, the cDNA encoding myristoylated-human AKT lacking the PH domain (Myr-AKT) was cloned into the pcDNA3 vector to produce the active AKT expression plasmid. The vector contains the bacterial origin of replication, ampicillinresistance gene and neomycin resistance gene for the growth of infected mammalian cells to select stable cell lines. 4T07 cells were transfected with 4µg of Myr-AKT or empty vector pcDNA3 using 10µl jetPRIME™ reagent (Polyplus Transfection Inc.). 2.5 Drug Treatment To activate TRPV4 calcium channels, cells were treated with 10µM of 4alpha- Phorbol 12,13-Didecanoate. To inhibit TRPV4 calcium channels, cells were treated with 10µM of Ruthenium Red. For chelation of intracellular calcium and extracellular calcium, 10µM of BAPTA-AM or 2mM of EGTA was added for 1hr prior to other treatments. For AKT and FAK inhibition, 5µM of AKT inhibitor IV or 10µM of FAK inhibitor was added into the cells for 1hr prior to calcium stimulation. 25 2.6 Immunoprecipitation Five hundred µg to 1 mg of proteins were incubated overnight with end-to-end rotation at 4ºC with specific antibodies and anti-mouse or anti-rabbit IgG-agarose beads. The immunoprecipitates were centrifuged and washed thrice with 0.8-1 ml of non-ionic detergent lysis buffer (50mM pH7.5 Tris-HCl, 0.5% IGEPAL, 150mM NaCl, 1mM pH8.0 EDTA, 0.5% Triton X). After washing for 3 times, 1 min each, 2x Laemmli buffer was added to the immunoprecipitates and boiled at 95ºC for 5 min. The eluted proteins were then subjected to SDS-PAGE. 2.7 Immunoblotting Cell lysates were resolved on 10% SDS-PAGE using the Bio-Rad Mini- Protean II system. Equal volume of 2x Laemmli buffer was added to the cell lysates containing 30 g of proteins and boiled at 95 ºC for 5 min before loading into the wells. The electrophoresis was performed in 25 mM Tris, 192 mM glycine and 0.1% SDS at 30 mA per gel for 90 min. The resolved proteins were subsequently transferred to the PVDF membrane (Bio-Rad) with Bio-Rad Trans-Blot system for 1 hr, 4 ºC at 100 V in a transfer buffer (25 mM Tris, 192 mM glycine, 10% SDS and 20% methanol). Membranes were blocked in 1% BSA or 5% non-fat milk in PBS with 0.1% Tween 20 for 1 hr at room temperature and incubated with primary antibodies [anti-TRPV4 (1:500), anti-phosphoAKT (S473) (1:1000), anti-AKT (1:1000), anti-phosphoMAPK (1:1000), anti-Erk1 (1:5000), anti-phosphoFAK (Tyr397) (1:1000), FAK (1:1000), anti-pPLCgamma1 (Tyr783) (1:1000), PLCgamma1 (1:1000), anti-E-cadherin (1:1000), anti-ßcatenin (1:1000), antiPI3Kinase p85 alpha (1:1000), anti-Ezrin (1:1000), anti-Actin (1:1000), anti-Twist (1:250)] for overnight at 4 ºC. Blots were then washed with PBST for 3 times, 5 min 26 each and incubated with secondary antibody conjugated to horseradish peroxidase for 1 hr. After secondary antibody incubation, membranes were washed 3 times with PBST for 10 min each before the immunoreactive bands were detected using the enhanced chemiluminescence (ECL) detection reagents (Merck or Pierce Biotechnology). Band intensities were measured using a densitometry program, called ImageQuant from GE Healthcare. The detection of the bands is based on the emission of light by the HRP-catalyzed oxidation of luminol which is captured on the X-ray film (Konica Minolta, Tokyo, Japan). 2.8 Immunohistochemistry Matched malignant and adjacent normal breast tissues were requested form the Tissue Repositories (TRs) of NCCS and NUH following approvals from Institutional Review Board (IRB) from the National Cancer Centre of Singapore (NCCS), National University Hospital (NUH) and the National University of Singapore. Histopathology reports were also obtained along with the samples. Frozen tissues were freshly prepared for IHC by fixing in 10% neutral buffered formalin (Sigma) for 16 hr at 4 °C, subjecting to a ThermoShandon tissue processor, and embedding in paraffin. Sections were warmed in a 60 °C oven, dewaxed in three changes of histoclear and passaged through graded ethanol (100%, 95%, and 70%) before a final wash in double distilled H2O. Antigen retrieval was performed using the Target Retrieval Solution (DakoCytomation, Glostrup, Denmark) at 95 °C for 40 min. After quenching of endogenous peroxidase activity with 3% H2O2 for 10 min and blocking with 5% BSA for 30 min, sections were incubated at 4°C for 24 hr with antibody against TRPV4 at a 1:500 dilution. Detection was achieved with the Envision+/horseradish peroxidase system (DakoCytomation). All slides were counterstained with Gill's hematoxylin for 27 1 min, dehydrated, and mounted for light microscopic evaluation. Interpretation of hematoxylin and eosin sections and analysis of IHC data were all done by the same certified pathologist to maintain consistency. All statistical tests were performed at 5% significance level with the statistical software SPSS 14.0 for Windows. All statistical analyses associated with clinical samples were done in R version 2.15.1 at 5% significance level unless otherwise stated (The R Foundation for Statistical Computing). Average IHC scores between different lesions of breast cancer tissues, as well as between lung tissue sections from SCID mice injected with ctrl and TRPV4-knockdown 4T1 cells, were compared by the 2-sample t-test. For comparison of the distribution of categorical variables (age, race and tumor grade) between TRPV4 low (IHC=0-2) and high (IHC=3) groups, the likelihood ratio and Fisher’s Exact test were used where appropriate. For the comparison of continuous variables (ErbB2 intensity, ER intensity, nodal status and tumor size), the 2-sample t-test was applied. Survival analysis was performed by the log-rank test and Kaplan-Meier curves were plotted for both overall survival (OS) and disease-free survival (DFS). 2.9 Immunofluorescence Cells were grown on Menzel microscope coverslips until 50–60% confluent. Cells were then fixed with 4% paraformaldehyde for 15 min at room temperature and washed with with 100 mM of glycine in PBS for 3 times before permeabilized with 0.5% Triton X-100 for 5 min at 4 ºC.. Following blocking with 1% BSA for 1 hr at room temperature, slides were then incubated with primary antibodies anti-TRPV4 antibodies (1:50) for overnight at 4ºC followed by secondary antibodies conjugated with Alexa Fluor 488 (Invitrogen, Molecular Probes, CA) at 1:2000 dilution for 1 hr. Cells were later counterstained with 4,6-diamidino-2-phenylindole (DAPI) at 1:1000 28 dilution for 1 min. Cells were mounted on glass slide using Prolong anti-fade reagent (Invitrogen, Molecular Probes). Analyses were done using laser confocal microscope (Olympus FluoView FV 1000) with a 60X oil immersion objective. The Olympus Fluo View™ FV10ASW-1.5 software was used to capture and analyze the images, including the measurement of Pearson coefficients of co-localization. 2.9 Cell Proliferation assay The cell proliferation was measured using the CellTiter 96® Aqueous One Solution Non-Radioactive Cell Proliferation Assay Reagent from Promega, which is based on the ability of the dehydrogenases found in metabolically active cells to convert the MTS [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4sulfophenyl)-2H-tetrazolium, inner salt] into aqueous, soluble formazan, which can be quantitatively measured at 490 nm by spectrophotometry. The amount of 490nm absorbance is directly proportional to the number of living cells in culture. Briefly, 2000-5000 cells per well were seeded in 100 µl culture medium in a 96-well plate on Day 0 and the cell growth was monitored until Day 4. Twenty µl of the MTS reagent was added to each well using a multichannel pipet and mixed by swirling the plate. The absorbance was measured within an hour on a plate reader (Tecan) at 490 nm. All experiments were performed with 3 technical replicates and across 3 independent biological experiments. 2.10 Wound Healing Assay Cells were seeded onto 6-well plate and grown until a confluent monolayer. A wound was incised onto the cell monolayer with a p200 pipet tip. The cells were washed once with growth medium to remove the cell debris and to smoothen the edge 29 of the scratch and then replaced with fresh growth medium. The cells were incubated at 37 oC and cell migration was monitored up to 24 hr. Using a phase-contrast microscope, the images were captured at 0, 8, 16 and 24 hr after scratch. The relative width of the scratch was measured quantitatively using Photoshop. The extent of gap closure over time was determined as the rate of cell migration. Experiments were performed with 3 technical replicates and independently validated across 3 biological experiments. 2.11 Chemotaxis Assay Thirty thousand serum-starved cells were added to the top chambers of the 96- well trans-well plate lined with polycarbonate membrane chambers (8 µm pore size, Cell Biolabs Inc., San Diego, CA). Medium containing 10 % fetal bovine serum (FBS) was added to the bottom chambers as a chemoattractant. Cells were allowed to migrate for 4 hr. Non-migratory cells at the top chambers were removed, while cells that have migrated to the bottom chambers were first dissociated from the membrane, then lysed and quantified using CyQuant GR fluorescent dye at 480 nm/520 nm. Experiments were performed with 3 technical replicates and independently validated across 3 biological experiments. 2.12 Invasion Assay One hundred thousand overnight serum starved cells were added to the top chambers of the 96-well trans-well plate lined with polycarbonate membrane coated with a uniform layer of dried basement membrane matrix solution (8 µm pore size, Cell Biolabs Inc., San Diego, CA). Medium containing 10% fetal bovine serum (FBS) was added to the bottom chambers. Assay was performed at 37˚C for 24 hr. Non 30 invasive cells at the top were removed, whereas cells that have invaded to the underside of the membrane were first dissociated from the membrane, then lysed and quantified using CyQuant GR fluorescent dye at 480 nm/520 nm. Experiments were done in triplicates and independently validated across 2 biological experiments. 2.13 Transendothelial Migration Assay One hundred thousand of HUVEC cells (kindly provided by Dr. Paula Lam from National Cancer Centre) were cultured on each 8 µm pore size insert (Cell Biolabs Inc., San Diego, CA) for 48hr. Five hundred thousand overnight serum starved transfected cells were added onto the monolayer of the HUVEC cells and the insert was then transferred to a new plate containing fresh medium with 10% fetal bovine serum (FBS). Assay was performed at 37˚C for 8 hr. Non migrated cells at the top were removed, whereas cells that have migrated to the bottom of the membrane were first dissociated from the membrane, then lysed and quantified using CyQuant GR fluorescent dye at 480 nm/520 nm. Experiments were performed with 3 technical replicates and independently validated across 2 biological experiments. 2.14 Xenograft The protocol for the xenograft study was reviewed and approved by the Institutional Animal Care and Use Committee (IACUC) of the National University of Singapore in compliance with international guidelines on the care and use of animals for scientific purpose. 4T1 (1 x 106) cells in 150 µL PBS were injected into the tail vein of eight-weeks-old female severe combined immunodeficiency mice. The mice were monitored for the loss of body weight and health condition. After 7 days of injection, the mice were euthanized and examined for the metastasis of the lungs by a 31 certified collaborating pathologist. The lung tissue sections containing the nodules were evaluated and the expression of the TRPV4 was scored using the IHC as described in the previous section with the dilution factor of TRPV4 (1:100). To determine the number of metastasis nodules on the surface of the lungs, mouse lungs were collected and fixed with 10% neutral buffered formalin (Sigma) for 16 hr at 4 °C, subjecting to a ThermoShandon tissue processor, and embedding in paraffin. Sections were warmed in a 60 °C oven, dewaxed in three changes of histoclear and passaged through graded ethanol (100%, 95%, and 70%) before a final wash in double distilled H2O. The nodules size was recorded from each hematoxylin and eosin (H&E)-stained section using the Olympus BX-41 light microscope (Center Valley, PA) at highpower field (HPF; x400). The maximum diameter of viable nodule was calculated by summing the largest unidimensional diameter of each fragment of nodule using the Olympus BX-41 microscope and a micrometer as indicated in the below table: Occular Field/ objective for BX 41 2 4 10 20 40 60 2.15 Field diameter/ mm 11.1 5.5 2.2 1.1 0.55 0.37 Micropipettes aspiration Micropipettes were pulled from borosilicate glass capillaries (B100-75-10, Sutter instruments) using a micropipette puller (Model P-97, Sutter Instruments) and forged to the required diameter (~7um) using a micropipette forge (MF-900, Narishige, Japan). To prevent non-specific adhesion between the capillary wall and the cell, micropipettes were filled with 3% BSA solution using a micropipette filler 32 (MicrofilTM, World Precision Instruments, Fl). The micropipette was then mounted on a micromanipulator (Eppendrof) and connected to water columns. Cells were first trypsinized, centrifuged and re-suspended in culture medium. A large drop of culture medium was placed on a hydrophobic glass cover slip and mounted on an inverted microscope (Leica). About 5µl of the cell suspension was added to this drop of the culture medium. A single suspended cell was aspirated into the micropipette. Pressure was applied to the cell at a rate of 2 Pa/sec for 200 seconds. Images of the cell were captured every 2 seconds using a 63X dry objective (Leica). Length of projection (Lp) was plotted as a function of suction of pressure (P) and a linear fit was used to extract the slope (Lp/P) which was then used in Eq.1 to compute the shear modulus. Only values of projection length for suction pressure between ~30Pa and120Pa were used for the fit. This window was used because below this value of pressure, the projection length could not be delineated clearly from the pipette edge and above 120Pa, separation of the cell membrane from the cytoskeleton was frequently observed especially in the control cells. 2.16 Intracellular Ca2+ Measurement Intracellular Ca2+ measurements in single cells were made using the fluorescent Ca2+ indicator fura-2 in combination with the RF-5301PC Intracellular Ion Measurement System Spectrofluorophotometer (Super Ion Probe); Shimadzu Corporation. Cells were loaded with 5 µM fura-2-AM (Molecular Probes) for 30 min at 37 ºC in the measuring buffer contained 88 mM NaCl, 5 mM KCl, 1 mM MgCl2, 5.5 mM glucose, 0.2% BSA, 10 mM HEPES and 1 mM CaCl2 (pH 7.4 with NaOH) and then assayed for intracellular calcium concentration ([Ca2+]i) in a cuvette under constant, gentle stirring (1ml final volume). 0.5% Triton-X was added to get Rmax (as 33 a positive control) and 20 mM EDTA was added to get Rmin (as a negative control). Fluorescent emission was monitored at 510 nm with alternate excitation at 340 and 380 nm using a RF-5301PC Intracellular Ion Measurement System Spectrofluorophotometer (Super Ion Probe); Shimadzu Corporation. When measurement is conducted at a fixed emission wavelength in the vicinity of 510nm, the free dye will exhibit an excitation wavelength maximum at about 380nm. However, when combined with calcium ion, the excitation wavelength maximum shifts to about 340nm. Thus, calcium binding is associated with an increase in dye fluorescence when excited at 340nm, and conversely a decrease in fluorescence when excited at 380nm. In the 2-wavelength method, measurement is usually conducted at a single emission wavelength of 510nm and switching excitation wavelengths between 340nm and 380nm. The ratio of these 2 fluorescence intensities is obtained and is used to calculate Ca2+ concentration. When the fluorescence intensity ratio is calculated, all factors requiring the compensation mentioned above are canceled. The formula for calculating the concentration is as follows: R - Rmin 2+ Sf2 * [Ca ] = Kd * Rmax - R Sb2 Here, Kd is the dissociation constant of Fura-2 and the calcium ion. R is the ratio of fluorescence intensities at 340 and 380nm. Rmax is the maximum ratio value between two fluorescence intensities when Fura-2 is completely combined with the calcium ion. Rmin is the minimum ratio value between two fluorescence intensities when Fura-2 is completely in the free state. Sb2 and Sf2 represent the fluorescence at 34 380nm associated with the bound and free forms of the dye respectively. In actual measurement, after observing the response of cells and agonists, Triton X-100 (digitonin) and EGTA are added to enable measurement of Rmax, Sb2, Rmin and Sf2. 2.17 Real-time PCR Cells were grown in a 60-mm tissue culture dish for 48 hr. Total RNA for each sample was extracted using the RevertAidTM. First Strand cDNA Synthesis Kit (Thermo Fisher Scientific) was used according to the manufacturer’s protocol. Briefly, 2 µg of RNA were reverse transcribed using the following conditions: 1 µg of oligo(dT), 1 X avian myeloblastosis virus reverse transcriptase reaction buffer, 40 units of RiboLockTM RNase Inhibitor, 1 mM of dNTP Mixture, 30 units of RevertAidTM M-MuLV Reverse Transcriptase. Each RT-PCR was then performed in triplicates and the average of the data was calculated. The integrity of the pooled cDNA was assessed by PCR amplification with a control human gene (glyceraldehyde-3-phosphate dehydrogenase, GAPDH). Negative control (without cDNA template) was also included to check for contaminating cDNA and genomic DNA. Evaluation of the gene expression of TRPV4 and E-cadherin was performed using the Taq-Man_Gene Expression Assay and gene-specific primers for TRPV4 (Mm00499025_m1), E-cadherin (Mm01247357_m1) and the endogenous control GAPDH (Mm99999915_g1) from Applied Biosystems Inc. (Foster City, CA). All quantitative PCR (qPCR) reactions were performed in triplicates and normalized against GAPDH. Data analysis was performed using CFX Manager software on a CFX96 Touch System. In all cases, data were expressed as means ±SE of at least three independent experiments. Statistical analysis was performed by unpaired twotailed Student’s t-test. 35 Chapter 3 Results 36 3.1 TRPV4 is overexpressed in breast cancer cell lines and tissues 3.1.1 Phosphoproteomics of the breast cancer metastasis (BCM) model First developed by Fred Miller’s group, the BCM model is a mouse mammary cancer metastasis model that comprises 4 isogenic tumor cell lines: 67NR, 168FARN, 4T07 and 4T1 (Aslakson and Miller, 1992; Aslakson et al., 1991); (Aslakson and Miller, 1992). Notwithstanding the intrinsic limitations and biases associated with any experimental model, the BCM model has proven to be useful in reflecting at least a subset of cancer phenotypes. For example, this model was analyzed by DNA microarray and TWIST, a master regulator of morphogenesis, was shown to play an essential role in tumor metastasis and whose expression correlates with poor outcome (Hosono et al., 2007; Yang et al., 2004). More recently, our laboratory conducted proteomics analysis of this model and identified several novel breast cancer metastasis associated genes (Ho et al., 2009). The 67NR cancer cell line can form primary tumor but no tumor cells can be detected in any distant tissues including blood, lymph nodes and the lungs. Cells of the 168FARN line disseminate from mammary fat pads and can be detected in lymph node but rarely detectable in lung indicating that they are unable to accomplish extravasation effectively. The 4T07 cells are able to spread to the lungs but cannot establish visible metastatic nodules. Finally, cells of the 4T1 lines are able to complete all steps of metastasis and form visible metastatic nodules in the lungs efficiently. The cell lines 67NR, 168FARN, 4T07 and 4T1 and are abbreviated as 67N, 168, 4T07 and 4T1 in this study. Cell lines were untreated or stimulated with PV to enhance the representation of tyrosine-phosphorylated proteins by inhibiting intracellular tyrosine phosphatases. The lysates were then probed with anti- 37 phosphotyrosine antibodies to reveal the overall cellular tyrosine phosphorylation profiles. 168 67N MW (kDa) PV (1mM) - + - + 4T07 4T1 - - + + 150 100 75 50 IB: PY20H 37 IB: Actin Figure 3.1 Pervanadate induced tyrosine phosphorylation profiles of the cell lines in Breast Cancer Metastasis (BCM) model. Cells were serum starved overnight and then untreated or treated with PV at 1 mM for 15 min. Proteins in lysates were then resolved and immunoblotted with anti-phosphotyrosine antibodies conjugated to horse-radish peroxidase (PY20H). The level of actin, as detected by anti-actin antibodies, was used as a control for equal loading of lysates. Arrows indicate examples of protein bands that displayed differential tyrosine phosphorylation across the 4 cell lines. Figure 3.1 shows that the cell lines in the BCM model possessed distinct phosphotyrosine proteomes (indicated by arrows). The phosphoproteins were then affinity captured using 4G10 anti-phosphotyrosine antibodies, Trypsin digested, labeled with Isobaric Tagging for Relative and Absolute Quantification (iTRAQTM) reagents (Ross et al., 2004) as per our previous paper (Chen et al., 2007) and analyzed using tandem mass spectrometry to determine their relative levels in the BCM cell lines as shown in the experimental design illustrated in Figure 3.2. To increase the coverage of protein identifications and/or the confidence of the data generated, two 38 separate biological preparations were performed and each analyzed by MALDI-TOFTOF. The cells 67N, 168, 4T07 and 4T1 were labeled with iTRAQ reagents 114, 115, 116 and 117 respectively. The ratios 115:114, 116:114 and 117:114 would indicate the relative abundance of tyrosine-phosphorylated proteins in 168, 4T07 and 4T1 with respect to 67N. BCM model Forms primary tumor Intravasation Extravasation Colonization Increasing metastatic potential Characteristics 67NR iTRAQ Steps: 114 Pool and nano-LC separation • PV stimulation (1mM, 15 min) 168FARN 115 • Harvest cells 4TO7 • Enrichment using 4G10 antibodies 116 MALDI TOF/TOF mass spectrometry • Tryptic digest 4T1 117 Validation Figure 3.2 Schematic diagram showing the workflow of iTRAQ-based experiments to identify PV-induced tyrosine phosphorylation substrates in Breast Cancer Metastasis (BCM) model. Two separate experiments were conducted. BCM cell lines were treated with 1 mM of pervanadate for 15 min. The cell lysates were then separately incubated with 4G10 antibodies covalently conjugated to sepharose beads. Enriched phosphoproteins from each cell line were then separately labeled with iTRAQ tags (114, 115, 116 and 117). The labeled samples were subsequently pooled and digested with Trypsin. Labeled peptides were cleaned up using C18 column and analyzed with MALDI-based tandem mass spectrometry. 39 Mild + Moderate + Aggressive (12) Mild + Aggre ssive (2) Aggressive (12) Moderate + Aggressive (7) Moderate (15) Mild + Moderate (6) Mild (6) Table 3.1 Detection and relative quantification of 4G10 anti-phosphotyrosine antibodies-enriched proteins in PV-stimulated cell lines in the Breast Cancer Metastasis (BCM) model. Molecular functions and cellular processes for each protein were found using the PANTHER (http://www.pantherdb.org/) and Ingenuity Pathways Analysis (IPA) software server (www.ingenuity.com) analysis. Detailed information is provided in Supplementary Table 1. Gene Symbol Accession Number VCP IPI00676914 168: 67N Ratio 4T07: 67N 4T1: 67N Std Deviation 168: 4T07: 4T1: 67N 67N 67N 0.76 1.04 0.95 0.17 0.28 0.27 iTRAQ Peptide 77 Molecular functions Cellular processes hydrolase apoptosis EPB41 IPI00402933 0.74 0.79 1.13 0.16 0.22 0.43 4 structural molecule activity organization of microtubules WBP2 IPI00648905 0.60 1.00 0.84 0.26 0.26 0.14 3 transcription co-activator migration and invasion of tumor cells CENTB2 IPI00867895 1.79 1.01 1.01 0.38 0.55 0.05 2 SLC12A2 IPI00755909 1.40 1.20 0.87 0.43 0.51 0.46 2 nucleic acid binding G t transporter i d l t cation G-protein coupled receptor protein signaling pathway ll dh i efflux of chloride PPFIBP1 IPI00623401 1.40 0.95 0.91 0.08 0.43 0.16 2 DNA binding protein adhesion of cells MAP1B IPI00130920 1.33 0.61 0.77 0.36 0.15 0.46 3 non-motor microtubule binding protein migration of eukaryotic cells EPS8 0.78 0.29 10 IPI00762437 1.81 2.17 1.23 0.39 SEC23B IPI00317604 1.94 2.10 1.10 0.78 0.92 0.35 5 transmembrane receptor l t /modulator d t t i G-protein transport of vesicles LFITM3 IPI00133243 1.61 2.23 0.96 0.32 0.84 0.21 4 interferon-inducible gene family mediates cellular innate immunity SEC24B IPI00652925 2.03 2.28 0.96 1.06 1.15 0.39 2 G-protein modulator transport of vesicles INPPL1 IPI00312067 1.53 0.84 0.14 0.54 0.67 2 phosphatase adhesion of tumor cell lines RASA1 IPI00130621 1.40 0.81 0.74 1.10 0.09 0.12 0.05 2 G-protein modulator apoptosis HSPA5 cell movement and proliferation of tumor cells IPI00319992 1.10 1.99 1.04 0.19 0.43 0.19 13 Hsp70 family chaperone growth of tumor cell lines SYNCRIP IPI00406118 1.19 1.76 1.14 0.13 0.23 0.23 5 EEF1A1 IPI00307837 1.30 1.77 1.02 0.18 0.12 0.01 2 mRNA processing factor ib l elongation t i translation factor tumorigenesis PLCB3 IPI00331519 1.01 1.39 0.88 0.02 0.08 0.21 2 PLCG1 IPI00753388 0.91 1.73 1.09 0.24 0.90 0.21 4 BICD2 IPI00274647 0.99 1.33 0.83 0.31 0.36 0.52 3 nuclear mRNA splicing, via spliceosome signaling molecule h h limolecule signaling h GTPase h li Rab binding protein migration of eukaryotic cells migration of eukaryotic cells microtubule anchoring CNN3 IPI00119111 0.93 1.57 1.05 0.03 0.21 0.16 2 non-motor actin binding protein PSCD2 IPI00128134 1.21 1.79 1.24 0.19 0.64 0.23 3 guanyl-nucleotide exchange factor structural constituent of cytoskeleton ti bi di protein transport,exocytosis,cellular amino intracellular EIF3A IPI00129276 1.17 1.59 0.92 0.11 0.20 0.30 2 translation initiation factor id t b li translation PARD3 IPI00309259 0.80 1.52 1.30 0.07 0.01 0.26 3 tight junction morphogenesis of cells PABPC1 IPI00331552 1.11 1.87 0.07 0.19 0.23 2 RNA binding protein decapping of RNA RPS27A IPI00470152 1.19 1.41 0.88 0.37 0.07 0.08 2 ribosomal protein tumorigenesis EWSR1 IPI00515199 0.92 1.64 0.82 0.65 1.03 0.44 2 RNA binding protein apoptosis CADM2 IPI00850457 1.05 2.25 1.07 0.14 0.02 0.09 2 receptor cell adhesion LGALS3 IPI00224486 1.01 0.59 0.40 0.23 0.37 0.24 3 cell movement of mammary tumor cells CTNND1 IPI00663949 0.92 1.42 2.38 0.25 0.39 0.57 30 signaling molecule ll dh i filament l lbinding protein intermediate 0.45 9 ll j family ti t i Hsp70 chaperone immune system process HSP70 IPI00457741 1.25 1.78 1.38 0.19 0.90 0.69 proliferation of cancer cells TUBB IPI00117352 1.20 1.92 1.34 0.34 0.31 12 tubulin tumorigenesis BAIAP2 IPI00222731 1.24 1.63 2.25 0.25 0.45 0.96 6 receptor disassembly of filaments TRPV4 IPI00776323 0.94 2.51 1.94 0.09 0.30 0.32 3 ion channel activity cation transport growth of tumor cell lines HGS IPI00649267 1.13 0.13 0.04 0.10 2 membrane traffic protein IPI00119063 0.85 1.58 0.80 1.32 LRP1 0.54 0.09 0.21 0.15 5 NCKAP1 IPI00656204 0.80 1.02 0.75 0.03 0.18 0.04 4 receptor t llbinding l ti protein ACTN1 IPI00380436 1.04 0.78 0.70 0.20 0.27 0.40 4 non-motor actin binding protein formation of focal adhesions FUS IPI00830623 1.20 1.28 0.71 0.09 0.39 0.20 3 RAB7A IPI00408892 0.99 0.82 0.45 0.34 0.45 0.26 3 transcription factor DNA bi di t i small GTPase endocytosis ACTN4 IPI00118899 1.08 0.84 0.70 0.13 0.27 0.39 4 non-motor actin binding protein growth of tumor cell lines SLC12A4 IPI00115231 0.86 0.95 0.68 0.25 0.05 0.28 2 cation transporter invasion of eukaryotic cells l t i migration of eukaryotic cells tumorigenesis efflux of chloride MLLT4 IPI00853902 0.95 0.94 1.34 0.16 0.30 0.17 9 non-motor actin binding protein adhesion of tumor cell lines DBNL IPI00378015 1.14 1.26 0.14 0.23 8 non-motor actin binding protein severing of actin filaments 1.34 0.23 TJP2 IPI00323349 0.99 1.21 5.07 0.17 0.30 3.86 8 tight junction apoptosis BCAR1 IPI00230632 1.00 1.24 1.67 0.17 0.13 0.15 4 growth of tumor cell lines DSG2 IPI00877308 1.07 1.18 5.49 0.04 0.07 1.83 2 cytoskeletal protein dh i protein l l cellll junction PRKCD IPI00227880 0.71 0.97 1.61 0.00 0.02 0.31 2 HSPA9 IPI00880839 1.31 0.96 0.69 0.27 0.08 0.11 2 EPB41L3 IPI00229294 0.44 0.33 0.27 0.08 0.07 0.04 3 structural molecule activity formation of carcinoma PVRL3 0.48 0.56 0.37 0.18 0.17 0.18 2 adhesion of tumor cell lines 6 receptor d f /i molecule it signaling 0.50 4 t kfamily l t l cytoskeletal t i actin protein CTNNB1 PXN EZR IPI00227826 IPI00753025 0.51 0.57 2.16 0.11 IPI00165881 0.69 1.54 1.68 0.25 0.14 0.29 0.55 adhesion of tumor cell lines dh i transfer/carrier protein t chaperone i /th i Hsp70 family invasion of tumor cell lines t i t i inhibition of apoptosis invasion of eukaryotic cells migration and invasion of tumor cells IPI00330862 2.13 2.43 3.05 0.62 0.70 1.84 11 actin family cytoskeletal protein invasion of tumor cell lines PLCG2 IPI00229848 2.16 1.77 2.65 1.35 0.90 2.11 7 SEC31A IPI00853859 2.57 2.53 1.40 2.30 2.08 0.55 6 signaling molecule h hcoat li protein vesicle tumorigenesis TUBA1B IPI00117348 1.36 1.82 1.40 0.09 0.32 0.45 5 tubulin apoptosis intracellular protein transport i i adhesion of tumor cell lines CDH1 IPI00318626 1.41 1.31 2.70 0.31 0.07 1.14 2 cadherin EMD IPI00652858 1.73 2.94 1.78 0.62 0.40 0.41 3 nuclear lamina-associated protein apoptosis LASP1 IPI00648086 1.48 1.45 1.87 0.25 0.08 0.31 2 non-motor actin binding protein migration of tumor cell lines SEC24A IPI00831587 2.14 2.55 1.32 0.94 0.88 0.04 2 vesicle coat protein intracellular protein transport i l di t d t t 40 Information such as peptide sequence, m/z value, ion scores, confidence intervals % and sites of iTRAQ modification of proteins detected are provided in Supplementary Table 1. Only those protein hits that were detected with a confidence interval of 85 % were included. To determine cut-off values to confidently classify proteins as differentially expressed, we implemented a 30% cut-off. This was determined from studies by others and us which demonstrated that the technical variations in large scale protein identification and relative quantification using iTRAQ approach is consistently 30% or less (Chen et al., 2007); (Gan et al., 2007); (Pierce et al., 2008). We therefore used 1.3 and 0.77 as the upper and lower potential fluctuation range, respectively. Proteins with iTRAQ ratios below the lower range were considered to be under-expressed while those above the higher range were considered over-expressed. Following implementation of the 30% cut off and considering only relative quantifications with p-value of 0.5 or less, a total of 60 protein hits were identified and shown in Table 3.1. This table shows the detection (gene symbol – column 2; accession number – column 3), and relative quantity (columns 4 to 6) of 4G10 antibodies-enriched proteins across the various cell lines. The standared deviations are shown in columns 7 to 9 and the number of peptides used for iTRAQ-based relative quantification in column 10. Identification and relative quantification of the proteins listed were based on at least 2 peptides. The molecular functions and cellular processes for each protein are listed in column 11 and 12 respectively. 41 Table 3.2 Summary of top three associated network functions. Data sources: Ingenuity Pathways Analysis (IPA) software server (www.ingenuity.com) analysis. No. Associated Network Functions Number of proteins Gene Symbols 1 Cell Morphology, Cellular Development, Cancer 35 ACTN1,AKT,ALDH3A2,Alphacatenin,BCAR1,CDH1,CDH18, ABP2,CTNNB1,CTNND1,EPS8,ERK,EZR,FAK,Fcer1,FSH, GPR56,GPRC5A,IgG,INPPL1,LASP1,LGALS3,LRP1,NRG3 ,NRG2(includesEG:381149),PALLD,PI3K,PLCG1,PLCG2, PRKCD,PXN,RASA1,STK24,TACC1,VCP 2 Cell Death, Neurological Disease, Cell-To-Cell Signaling and Interaction 35 ACTN4,AGRN,BAIAP2,BICD2,CIT,CYFIP2 (includes EG:26999),CYTH2,DCTN1,DLG4,Dynein,EEF1A1,EPB41, GRASP,GRIK2,GRM1,HAP1,HGS,HSPA5,HSPB1,HTT, HUWE1,MAP1B,PARD3,PDE4B,PIGF,PPP1CC,PPP3CA, PRKAR2A,PVRL3,SMC3,TFAM,TP53,UBE2N,Ubiquitin, YBX1 3 Gene Expression, Infection Mechanism, Dermatological Diseases and Conditions 15 ACTB,EIF3A,EIF3B,EMD,EWSR1,FSH,FUS,HNRNPA1, NME1,PABPC1,RARA,RXRA,SYNCRIP,TAF5,TBP 3.1.2 Bioinformatics and the characterization of the differentially expressed phosphoproteins across the BCM model To characterize the 60 unique proteins detected, the gene list was uploaded into Ingenuity Pathways Analysis (IPA) software server1 and analyzed using the Core Analysis module as per manufacturer’s instructions. Analysis was performed using only IPA’s knowledgebase as reference set. Analyses considered only molecules, relationships and protein interactions reported in mammalian systems. Relationships included both direct and indirect ones. Details of the various analyses are provided in Supplementary Table 2 and some of the key highlights are shown here. The top three associated network functions is shown in Table 3.2, which shows the total of number and identities of proteins in each associated network function group. 1 www.ingenuity.com 42 Interestingly, cancer was ranked both as the top network function. Equally interesting is the fact that the most statistically significant canonical pathway associated with the gene list is that of leukocyte extravasation signaling (Figure 3.3). Leukocyte Extravasation Signaling (PXN, PRKCD, PLCG2, EZR, PLCG1, MLLT4, ACTN4, CTNNB1, BCAR1, ACTN1, CTNND1) Germ Cell-Sertoli Cell Junction Signaling (PXN, CDH1, PVRL3, MLLT4, ACTN4, TUBB, CTNNB1, BCAR1, ACTN1, CTNND1) Aldosterone Signaling in Epithelial Cells (PRKCD, PLCG2, SLC12A2, PLCG1, PLCB3, HSPA5) Actin Cytoskeleton Signaling (PXN, EZR, BAIAP2, ACTN4, BCAR1, ACTN1, NCKAP1) VEGF Signaling (PXN, PLCG2, PLCG1, ACTN4, ACTN1) 14-3-3-mediated Signaling (PRKCD, PLCG2, PLCG1, PLCB3, TUBB) Integrin Signaling (PXN, PLCG2, PLCG1, ACTN4, BCAR1, ACTN1) Macropinocytosis Signaling (PRKCD, PLCG2, PLCG1, ACTN4) Inositol Phosphate Metabolism (PRKCD, PLCG2, PLCG1, PLCB3, INPPL1) PDGF Signaling (PLCG2, PLCG1, INPPL1, RASA1) Figure 3.3 The top most canonical pathway associated with the gene list is that of leukocyte extravasation signaling. The prominent involvement of the gene list in extravasation signaling strongly supported the notion that the data obtained is robustly associated with metastasis. The genes involved in the extravasation and other process shown are listed in Figure 3.3. The complete classification into the canonical pathways is provided in Supplementary Table 3. Table 3.1 only shows a list of proteins that were induced to undergo tyrosine phosphorylation by pervanadate (PV) treatment. It lacks biochemical context. To create significance out of otherwise static data, we constructed a biological interaction 43 network (BIN) of the proteins identified in PV-induced phosphotyrosine-proteome (Figure 3.4). This was generated using the Path Designer tool within the Core Analysis module. The proteins that could be networked were linked by various relationships such as protein interactions, activation, phosphorylation and regulation of expression. These relationships are color coded and the legends provided next to the map. Although not all proteins could be networked (due to insufficient information in the database to link them to other proteins), the BIN revealed that a significant number of the proteins identified in this study were integral parts of some signaling complexes. Since the leukocyte extravasation signaling was prominently associated with the gene list, we located the molecules involved in this signaling pathway within the BIN. Remarkably, all proteins except MLLT4 and CTTN4 involved in extravasation signaling were present in the BIN obtained. This suggested that one of the key signaling complexes in the BIN shown in Figure 3.4 concerns the extravasation, a critical step in metastasis. 44 2 6 4 3 9 5 1 7 Phosphorylation Activation Phosphorylation & Activation Expression Expression & Protein Interaction Protein Interaction 8 Figure 3.4 Biological interaction network (BIN) of the proteins identified in PVinduced phosphotyrosine-proteome. Legend: Gene symbols icon in grey are those from Table 3.1 and white are those from IPA database. Nine proteins that are involved in extravasation (PXN, PRKCD, PLCG2, EZR, PLCG1, CTNNB1, BCAR1, ACTN1, CTNND1) indicated in red numbers. 3.1.3 Up-regulation of TRPV4 protein and mRNA across the BCM model To validate the data presented in Table 3.1, we examined the level of several candidate proteins in 4G10-purified immunoprecipitates using immunoblotting. The proteins tested included the well-known tyrosine-phosphorylated proteins such as EPS8, EZRIN and PXN. The latter two proteins are also proteins involved in the extravasation signaling. In addition, we included a few not-so-well-known tyrosinephosphorylated proteins (e.g. TRPV4, FUS, PSCD2 and SEC23B) to validate that these phosphoproteins were indeed differentially expressed. Following immunoblotting, densitometry was performed on the protein bands across various cell 45 lines and expression ratios obtained using 67N as the denominator. As seen in Figure 3.5, although the ratios are not the same, the expression trends of all the tested candidates in the 4G10 immunoprecipitates revealed by immunoblotting were consistent with that obtained with iTRAQ-based method. Immunoblots Gene Symbol Methods Ratio 168:67N Ratio 4TO7:67N Ratio 4T1:67N 67N EPS8 EZR FUS PSCD2 PXN SEC23B TRPV4 ITRAQ 1.810 2.175 1.226 IB 18.256 20.524 6.195 ITRAQ 2.131 2.430 3.046 IB 2.390 2.978 3.713 ITRAQ 1.205 1.281 0.713 IB 6.339 19.123 0.769 ITRAQ 1.213 1.790 1.237 IB 1.731 3.136 2.401 ITRAQ 0.688 1.537 1.684 IB 0.384 1.969 1.917 ITRAQ 1.938 2.104 1.099 IB 2.551 2.217 1.140 ITRAQ 0.938 2.514 1.941 IB 1.152 7.789 4.024 168 4TO7 4T1 Figure 3.5 Validation of known and potentially novel tyrosine-phosphorylated protein identified in BCM cell lines. Cells were serum starved overnight and then untreated or treated with PV at 1 mM for 15 min. Immunoprecipitation was then performed using 4G10 anti-phosphotyrosine antibodies. The immunoprecipitates were then immunoblotted with protein-specific antibodies to reveal the amounts of candidate proteins in the immunoprecipitates from the 4 BCM cell lines. 46 Ezrin, paxillin, EPS8 and FUS have been reported to be involved in metastastic processes such as migration, invasion and extravasation (Briggs et al., 2012; Cai et al., 2010; Chen et al., 2010; de Vreeze et al., 2010) while PSCD2, SEC23B and TRPV4 have never been previously associated with cancer metastasis until now. In other words, the latter 3 proteins are potentially novel metastasis regulators/effectors. In addition to its novelty, we are keen to study TRPV4 further with respect to metastasis because of its prominent and sharp upregulation starting from 4T07 cells. The MS/MS spectra of the 3 iTRAQ-labeled TRPV4 peptides along with the intensity of the iTRAQ tags across the BCM model are shown in Figure 3.6. All 3 peptides displayed increased levels in 4T07 and 4T1 metastatic cells compared to 67N non-metastatic cells. 47 Figure 3.6 The MS/MS spectra of the 3 iTRAQ peptides for TRPV4 inset shows the intensity of the iTRAQ reporter ions derived from TRPV4 across the cell lines in BCM model. 48 TRPV4 encodes a member in the transient receptor potential Ca2+ permeable channel family that is involved in many physiological processes and pathogenesis of various disorders (Nilius et al., 2005). Consistent with the detection of TRPV4 as a phosphoprotein in our analysis, tyrosine phosphorylation of TRPV4 has been reported to regulate its activity (Wegierski et al., 2009; Xu et al., 2003b). However, there has been no study reporting on the role of TRPV4 in breast cancer although its ability to increase cell permeability by decreasing the expressions of tight junction proteins like the Claudins and Occludins in endothelial cells is likely to have implications in cancer cell metastasis (Reiter et al., 2006). The notion that TRPV4 plays a role in intravasation/extravasation is supported by the observation that TRPV4 upregulation was detected in 4T07 cell line characterized to be capable of extravasation in the BCM model. The amount of phosphorylated proteins at steady state is maintained by the action of kinases and phosphatases. Pervanadate treatment blocks the action of tyrosine phosphatases thus favoring kinases activity and shifting the equilibrium towards phosphorylated proteins. The differential amount of tyrosine-phosphorylated proteins induced by PV treatment of various cell lines could therefore be due to i) different expression level of the tyrosine kinase substrates or ii) different amounts of tyrosine kinases and/or phosphatases. To investigate the likely mechanism behind the observed differential protein phosphorylation of TRPV4 across the BCM model, immunoprecipitation of TRPV4 was performed. For consistency, immunoprecipitation was conducted on the same lysates used to generate the phosphoproteomics data in Table 3.1. Two sets of immunoprecipitates were prepared. One set of immunoprecipitates was probed with anti-phosphotyrosine PY20H antibodies and the other probed with protein-specific 49 antibodies. Figure 3.7A confirmed TRPV4 to be tyrosine phosphorylated in our system. In addition, the tyrosine phosphorylation levels of TRPV4 correlated with protein expression levels across all 4 cell lines. This implies that the increased level of phosphorylated TRPV4 across the BCM model was likely due to upregulation of the TRPV4 protein levels. Next, we examined the expression of TRPV4 across the BCM model using Immunofluorescence. Figure 3.7B shows that 4T07 and 4T1 revealed a concentrated TRPV4 signal in the cytosol near to the plasma membrane. Wheareas 67N and 168 have a very weak or nearly no signals of TRPV4. Competition study using 10x molar excess of TRPV4-derived peptide showed that the IF signal was specific to TRPV4. Negative control using peptides from an unrelated protein did not block the signal produced by the TRPV4 antibody. To investigate whether upregulation of the TRPV4 protein level across the BCM model was associated with an increase in its mRNA level, we conducted realtime PCR (Figure 3.8). While the TRPV4 protein level was higher in 4T07 compared to 4T1, the amount of TRPV4 transcripts is higher in 4T1 compared to 4T07. This suggests that other post-transciptional factors might be involved in the steady state of TPRV4 expression. This is supported by the observation that TRPV4 is a target of E3 ligase and proteosomal degradation (Verma et al., 2010). Interestingly, 12q24, the cytogenetic band where TRPV4 resides, is frequently amplified in breast cancers and might explain the elevated level of TRPV4 at transcriptioanl and protein level across the BCM model (Aubele et al., 2002). 50 A MW (kDa) B 67N 168 4T07 4T1 100 IP: TRPV4, IB: TRPV4 100 IP: TRPV4, IB: PY20H DAPI FITC Merged 4T07 IF: TRPV4 + 10X Cep68 peptide 4T07 IF: TRPV4 + 10X TPRV4 peptide 67N IF: TRPV4 168 IF: TRPV4 4T07 IF: TRPV4 4T1 IF: TRPV4 Figure 3.7 A. Immunoprecipitation and immunoblotting of TRPV4 in the BCM cell lines. Cells were serum starved overnight and then untreated or treated with PV at 1 mM for 15 min. Two sets of immunoprecipitates were prepared. One set of immunoprecipitates was probed with anti-phosphotyrosine PY20 antibodies and the other probed with protein-specific antibodies. Tyrosine phosphorylation levels of TRPV4 correlated with protein expression levels across all 4 cell lines indicating that the differential amounts of phosphorylated TRPV4 was due to differences in TRPV4 protein levels. B. Immunofluorescence (IF) of TRPV4 in the BCM cell lines. 4T07 and 4T1 revealed a concentrated TRPV4 signal in the cytosol near to the plasma membrane. 67N and 168 have a very weak or nearly no signals of TRPV4. IF using TRPV4 antibodies in the presence of 10 fold molar excess of TRPV4-derived peptides or 10 fold molar excess of Cep68 peptides to test the specificity of the TRPV4 antibody. 51 Normalized TRPV4 expression 675.59 700 600 484.43 500 400 300 200 100 1.00 1.12 67N 168 0 4T07 4T1 Figure 3.8 The expression of TRPV4 in BCM model was examined using real-time PCR. The mean percentages of cell-cycle phases were plotted from triplicate samples. Real-time PCR revealed heightened TRPV4 transcripts in 4T07 and 4T1 metastatic compared to non-metastatic 67N breast cancer cells indicating some form of genomic aberrations. 3.1.4 Upregulation of TRPV4 in invasive human breast cancer cell lines and tissues The data in Figure 3.7 and 3.8 corroborated on the aberrant up-regulation of TRPV4 protein expression across the BCM model and suggest that TRPV4 may confers an aggressive phenotype to cancer cells. Since the BCM model is of murine origin, we proceeded to examine the expression of TRPV4 in a panel of human breast cancer cell lines and tissues to determine whether up-regulation of TRPV4 could be observed in human cancers. We first examined the expression of TRPV4 across the human MCF10AT breast cancer progression model through immunoblotting. The MCF10AT model comprises 4 isogenic cell lines: MCF10A1, which represents non-cancer mammary epithelial cells while MCF10AT1K.cl2, MCF10CA1h, and MCF10CA1a.cl1 52 represent premalignant, low grade, and high grade cancer cells, respectively (Santner et al., 2001). A phosphoproteomics study of the MCF10AT model conducted in our lab previously led to the discovery of a novel breast cancer oncogene (Chen et al., 2007; Lim et al., 2011). Figure 3.9A shows that both 1h and 1a low and high grade cancer cells, respectively expressed elevated levels of TRVP4 compared with the premalignant 1k and non-cancer A1 epithelial cells. To further screen the expression of TRPV4 on a larger panel of wellestablished human cell lines, cell lysates from normal mammary epithelial cells (HMEC, MCF10A), non-invasive cell lines (MCF7, SKBR3, T47D) and highlyinvasive cell lines (MDA-MB-157, MDA-MB-231, MDA-MB-453, MDA-MB-468, BT20, BT474 and BT549) were probed for expression of TRPV4. Lysates from 4T07 was included as a positive control. Interesting, MDA-MB-468 and BT474 invasive breast cancer cells showed high expression of TRVP4 while most of the normal and non-invasive cancer cell lines did not express detectable levels of TRPV4 (Figure 3.9B). Taken together, endogeneous TRPV4 is prominently overexpressed in the invasive but not the non-invasive breast cancer cell lines tested. 53 Normal A MW (kDa) Pre‐ Low‐grade  High‐grade  malignant carcinoma carcinoma 1h 1k A1 1a 100 IB: TRPV4 50 IB: Actin 37 100 BT549 BT474 BT20 MDAMB453 MDAMB231 MDAMB157 SKBR3 T47D MDAMB468 Highly-invasive Non-invasive MCF7 MCF10A 4T07 MW (kDa) HMEC Normal B IB:TRPV4 50 37 IB:Actin Figure 3.9 A. Immunoblotting of TRPV4 on the MCF10AT model which comprises 4 isogenic cell lines: MCF10A1, which represents non-cancer mammary epithelial cells while MCF10AT1K.cl2, MCF10CA1h, and MCF10CA1a.cl1 represent premalignant, low grade, and high grade cancer cells, respectively. They are abbreviated as A1, 1k, 1h, and 1a in this study. B. Immunoblotting of TRPV4 on a panel of normal breast mammary epithelial cells (HMEC, MCF10A), non-invasive breast cancer cell lines (MCF7, SKBR3, T47D) and highly-invasive breast cancer cell lines (MDA-MB-157, MDA-MB-231, MDA-MB-453, MDA-MB-468, BT20, BT474 and BT549). Lysates from 4T07 was included as a positive control. The level of actin as detected by anti-actin antibodies, was used as a control for equal loading of lysates. Data are representative of three different experiments. Despite the fact that BCM model has been used by several groups, a major limitation of such in vitro or animal model is that frequently these systems lack the physiological context present in the human body. To examine the clinical relevance of TRPV4 in clinical breast cancers, we conducted immunohistochemistry of TRPV4 on on a tissue microarray containing matched normal, ductal carcinoma in situ (DCIS) and invasive ductal carcinomas (IDC) from the National University Hospital, 54 Singapore. In addition, tissue microarrays containing 80 cases of unmatched N/ IDC, 50 cases of matched IDC/ Mets, 12 cases of matched N/ IDC and 35 cases of matched IDC/ Mets from US Biomax, Inc. (Rockville, MD), and 93 more full-section cases from National University Hospital Singapore and Singapore General Hospital were tested. Note that in some cases, some normal tissues consisted of fat only and have no epithelial components which therefore could not be scored. A complete list of immunohistochemistry results with the clinicohistopathological data are provided in Supplementary Table 4. The majority of the cancers from tissue microarrays was of histological grade II (69%), followed by grade III (26%) and a minority of them was of grade I (5%). In contrast, the majority of the 93 full-section cases were of histological grade III (67%) followed by grade II (29%) and grade I (4%). The immunohistochemistry data for the tissue microarrays and full sections that contain spectrum of lesions are summarized in Figure 3.10, 40 % (10/25) of the cases exhibited statistically significant increased expression of TRPV4 when breast cancer progresses from normal to ductal carcinoma in situ and invasive ductal carcinoma, 36 % (9/25) of cases showed no change, 24 % (6/25) of cases showed reversed trend. On the other hand, 69% (41/59) exhibited increased TRPV4 expression in the invasive ductal carcinoma compared to non-cancer tissues. In contrast, only a minority of the cases - 3% (2/59) showed the reverse trend while 27 % showed no change. In another set where normal cases were not available, 27 % (4/15) of cases showed increased TRPV4 expression when disease progresses from carcinoma in situ to invasive cancer compared to only 13% (2/13) that showed the reverse trend. Despite the heterogeneity in the trend of TRPV4 expression, which is not surprising given that breast cancer is a heterogenous disease, the data revealed that in majority of the cases, TRPV4 expression increases as diseases progresses from 55 normal to preneoplastic to invasive carcioma. The representative images on IHC of TRPV4 on clinical samples are shown in Figure 3.13A. We also conducted immunohistochemistry of TRPV4 on tissue microarray (US Biomax) comprising of 85 matched invasive ductal carcinoma and metastasis breast cancer lesions. As shown in Figure 3.11, 25 % (21/85) of the cases exhibited increased expression of TRPV4 when breast cancer spread from invasive ductal carcinoma to metastatic breast cancers. There is only a minority of the cases - 14% (12/85) which showed the reverse trend. The majority of the cases, 61% (51/85) showed no difference in TRPV4 expression from invasive ductal carcinoma to metastatic breast cancers. This implies that majority of the metastatic lesions do not show differences in TRPV4 expression compared to the matched invasive carcinoma. The representative images from IHC of TRPV4 on clinical samples are shown in Figure 3.13B. The specificity of TRPV4 antibody was shown in Figure 3.13C; the immunohistochemistry of TRPV4 in the absence or presence of competing or control peptides on the breast tumor (080T). Next, we combined the IHC data from all the cases analyzed in Figure 3.10 and Figure 3.11 respectively and produced a box plot showing distribution of TRPV4 in different lesions of breast cancer tissues (Figure 3.12). Collectively, IHC of TRPV4 revealed statistically significant upregulation of TRPV4 in invasive cancers as compared to normal and preneoplastic lesions. However, there is no statistically significant difference in TRPV4 expression was observed between invasive ductal carcinomas and metastatic lesions. This suggests that metastatic potential conferred by TRPV4 might be acquired early during disease progression. The IHC data is also consistent with the in vitro observation shown in Figure 3.9 that TRPV4 overexpression is associated with a substantial subset of invasive breast cancers. 56 57 -0.5 0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 IDC IDC>DCIS=N; 3/25 (12%) IDCN; IDC=DCIS=N; 9/15 (60%) 10/25 (40%) 9/25 (36%) IDC>DCIS>N; IDC>DCIS; 3/25 (12%) 4/15 (27%) DCIS IDC>N; 41/59 (69%) IDC=N; 16/59 (27%) IDC[...]... Carboxyl terminus, aa 713-871 50 amino acids Region involved in MAP7 interaction Calmodulinbinding region Figure 1.5 Schematic overview of TRPV4 s predicted structural and functional components Shown are schematic representations of TRPV4 s amino terminus (A), its central region with the membrane-spanning domains and the pore loop (B), and the channel’s carboxyl terminus (C) Specific domains and amino acids... sites including calmodulin (CAM) binding sites and region involved in microfilament-associated protein 7 (MAP7) interaction sites The best characterized CAM domain is located between aa812-aa831 and is involved in Ca2þ-dependent activation of TRPV4 (Strotmann et al., 2003); (Garcia-Elias et al., 2008) Mutations within this region resulted in a loss of Ca2+dependent calmodulin binding and a loss of Ca2+-dependent...3.9A Immunoblotting of TRPV4 on the MCF10AT model 54 3.9B Immunoblotting of TRPV4 on a panel of human cell lines 54 3.10 Bar chart distribution of IHC scores for TRPV4 on matched normal (N), ductal carcinoma in situ (DCIS) and invasive ductal carcinomas (IDC) 57 3.11 The expression patterns of TRPV4 in 85 samples matched metastatic breast cancers and invasive ductal carcinomas (IDC) from tissue... plot distribution of IHC scores for TRPV4 on normal (N), ductal carcinoma in situ (DCIS), invasive ductal carcinomas (IDC) and metastatic breast cancers 58 3.13A Representative IHC images showing upregulation of TRPV4 in matched clinical samples across the breast cancer progression 60 3.13B Representative IHC images showing TRPV4 expression in tissue 60 microarray of breast cancer invasion versus matched... repeat domains (ARD1–3) within an ankyrin repeat region from aa235 to aa367, a cluster of four protein kinase C (PKC)–phosphorylation sites and a cAMPdependent–phosphorylation site upstream of the ankyrin repeat region, and a cluster of two PKC sites within and downstream of ARD3 It has been hypothesized that activation of PKC with phorbol esters leads to opening of TRPV4 and increase of intracellular... through the activation of TRPV4 in breast cancer XIII LIST OF TABLES 1.1 Plasmalemmal and endolemmal Ca2+-permeable channels in migration and metastasis 7 1.2 Naturally occurring TRPV4 mutations 19 3.1 Relative quantification of 4G10 anti-phosphotyrosine antibodiesenriched proteins in PV-stimulated of Breast Cancer Metastasis (BCM) model 40 3.2 Summary of top three associated network functions 42 3.3 Statistical... activation was linked to Akt phosphorylation and β-Raf and Erk1/2 inhibition (Gradilone et al., 2010) Its activation in polycystic kidney (PCK) cholangiocytes led to an increase in [Ca2+]i and inhibition of cell proliferation and 15 cyst growth in 3-dimensional culture (3-fold) Moreover, TRPV4 stimulated phosphatidylinositol 3 kinase–dependent activation and binding of additional β1 integrin receptors,... Overexpression of constitutively active AKT construct rescue the effect of TRPV4 silencing on the expression of phosphorylated AKT and E-cadherin 93 3.34B Overexpression of constitutively active AKT construct rescue the transmigration effect of TRPV4 knockdown 93 3.35A The mRNA expression of E-cadherin in 4T07 cells upon different time-point of 4α-PDD stimulation 94 3.35B The protein expression of E-cadherin in. .. ctrl and TRPV4- knockdown 4T1 cells 73 3.24 The percentage of 4T07 cells that formed blebs at a pressure rate of 2 Pa/sec 76 3.25 The average of pressure when the blebs were started to be formed 76 3.26 Changes in levels of phospho-proteins and non-phospho proteins upon 4α-PDD stimulation for 15 mins and 16hrs in 4T07 cell line 80 3.27 Changes in levels of phospho-proteins and non-phospho proteins upon... stimulation for 15 mins and 16 hrs in TRPV4knockdown 4T07 cells 82 3.28 Immunoblotting of TRPV4 upon 10µM of 4α-PDD stimulation and/ or 10µM Ruthedium Red (RR) on 4T07 cells for 16hrs 83 3.29 Effects on expression levels of phosphorylated S6, phosphorylated AKT, phosphorylated FAK, E-cadheria and β-catenin in the presence and absence of 5µM AKT inhibitor IV 85 3.30 Lack of effects of FAK inhibitor on expression ... Upregulation of TRPV4 protein and mRNA across the BCM model 3.1.4 Upregulation of TRPV4 in invasive human breast cancer cell lines and tissues 37 37 42 TRPV4 is a positive regulator of breast cancer metastasis. .. roles and modes of actions in breast cancer metastasis remain obscure We hypothesize that TRPV4 is a positive regulator in breast cancer metastasis In this project, we focus on understanding the function. .. TRPV4 in the BCM cell lines 51 3.7B Immunofluorescence (IF) of TRPV4 in the BCM cell lines 51 3.8 52 The expression of TRPV4 in BCM model was examined using realtime PCR X 3.9A Immunoblotting of TRPV4