The regulation of TXNIP gene expression

    THE REGULATION OF    TXNIP GENE EXPRESSION            FAXING YU  (B.Sc. (Hons.), NUS)          A THESIS SUBMITTED  FOR THE DEGREE OF DOCTOR OF PHILOSOPHY  DEPARTMENT OF BIOCHEMISTRY  NATIONAL UNIVERSITY OF SINGAPORE  2009  Acknowledgments    I first thank my supervisor, Dr. Yan Luo, for his valuable comments on how to  design and perform experiments, for his generous giving of freedom to explore new  fields, for his enthusiastic encouragement when I encountered difficulties, and for his  critical  reading  and  suggestions  on my  manuscripts  and  thesis.    It  is  impossible  to  have  this  thesis  presented  here  without  Dr.  Luo’s  patient  guidance  throughout  my  graduate study.  I  wish  to  thank  Drs.  Edwin  Cheung  and  Xinmin  Cao,  my  thesis  advisory  committee members, for sharing their knowledge and wisdom.    I also wish to thank  Drs.  Thilo  Hagen  and  Ruping  Dai  for  their  constructive  comments  and  friendly  discussions on my projects.  I would also like to thank  past  and  present members of  Luo  lab; all  of us  have  constructed a harmonious and productive working environment.    Special thanks to  Shuangru Goh, she has experimentally contributed to a portion of results described  in this thesis, and Drs. Hongpeng He, Liling Zheng and Mingji Jin, who have given  me wonderful suggestions on thesis writing.  Finally, I thank my loving wife, my parents, my siblings, my grandpa, and other  family members for their understanding, supports and sacrifices in these years.        I  Table of Contents      page     Acknowledgments  I      Table of Contents  II      Summary  IX      List of Tables  XI      List of Figures  XII      Abbreviations  XVII      Chapter 1 Introduction  1      1.1 A General Overview of Eukaryotic Gene Transcription  1      1.1.1 RNA Polymerases  1      1.1.2 Core Promoters and General Transcription Factors (GTF)  2      1.1.3 Sequence‐specific Transcription Factors  3      1.1.4 Cofactors  4      1.1.5 Other Regulatory Mechanisms  6      1.2 Extracellular Signals Regulate Gene Transcription    7      1.2.1 Internal Sensors Regulate Transcription Factors  7      1.2.2 Cell Permeable Ligands Regulate Transcription Factors  9      1.2.3 Plasma Membrane Receptors Regulate Nuclear Transcription  9  Factors      1.2.4 Plasma Membrane Receptors Regulate Cytoplasmic Transcription  10  Factors      II  1.3 Thioredoxin Interacting Protein (Txnip)    1.4 Txnip Functions    1.4.1 Txnip and Redox State    1.4.2 Txnip and Cell Proliferation and Cell Death    1.4.3 Txnip and Cell Differentiation    1.4.4 Txnip and Cellular Metabolism    1.5 Txnip Expression in Response to Different Signals    1.6 Objectives      Chapter 2 Materials and Methods    2.1 Chemicals and Buffers    2.2 Plasmid Constructs    2.3 Purification of Bacterially Expressed Recombinant Proteins    2.4 Mammalian Cell Culture    2.5 Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis  (SDS‐PAGE)    2.6 Immuno‐Blot    2.7 RNA Extraction, RT (Reverse Transcription)‐PCR and Real‐Time PCR    2.8 Genomic DNA Extraction    2.9 Small Interfering RNAs (siRNAs) and RNA Interference Assays    2.10 Transfection    2.11 Promoter Activity (Reporter) Assays    2.12 Immunocytometry    2.13 Fluorescence‐activated Cell Sorting (FACS)  III  10    14    14    15    18    18    20    23    25    25    25    26    27    27    27    28    29    29    30    30    30    31    2.14 Electrophoresis Mobility Shift Assays (EMSA)    2.15 Chromatin Immunoprecipitation (ChIP) Assays    2.16 Thioredoxin Activity Assays    2.17 Glucose Transport Assays    2.18 Statistical Analyses    Chapter 3 Identification of Molecules Modulating Txnip Expression    3.1 Preface    3.2 Results    3.2.1 Adenosine‐containing Molecules Induce Txnip Expression    3.2.1.1 NAD(H) and ATP Stimulate Txnip Expression    3.2.1.2 Molecules Containing Adenosine Group Induce Txnip  Expression    3.2.1.3 Adenosine is Necessary and Sufficient for Inducing Txnip  Expression    3.2.1.4 Adenosine‐containing Molecules Induce Txnip Expression  in a Dose‐dependent Manner    3.2.1.5 Long Term Effect of Adenosine‐containing Molecules on  Txnip Expression    3.2.1.6 Adenosine‐containing Molecules Induce Txnip Expression  at the Transcriptional Level    3.2.1.7 Adenosine‐containing Molecules Induce Txnip Expression  Is Mediated by an Earlier Defined ChoRE    3.2.1.8 The MLX/MondoA Complex Mediates the Induction of  Txnip Expression by Adenosine‐containing Molecules    3.2.1.9 Adenosine‐containing Molecules Facilitate MondoA  Nuclear Translocation  IV    31    34    35    35    36    37    37    38    38    38    40    40    43    44    45    47    49    52    3.2.1.10 Glucose Is Required for the Induction of Txnip Expression  by Adenosine‐containing Molecules    3.2.1.11 Glucose Induced Txnip Expression Is Amplified by  Adenosine‐containing Molecules    3.2.1.12 Potential Plasma Membrane Target(s) of Adenosine‐  containing Molecules    3.2.1.12.1 Purinergic Receptors Are Not Required for the  Induction of Txnip Expression    3.2.1.12.2 Adenosine‐containing Molecules May Target  Adenosine Transporters    3.2.1.13 Signaling Pathway(s) Evoked by Adenosine‐containing  Molecules for Regulating Txnip Expression    3.2.1.13.1 The Induction of Txnip Expression Requires  Intracellular Ca2+    3.2.1.13.2 The Induction of Txnip Expression Does Not  Require cAMP    3.2.1.13.3 The Involvement of MAPK in the Induction of  Txnip Expression    3.2.1.13.4 Non‐involvement of AMPK in the Induction of  Txnip Expression    3.2.1.14 Adenosine‐containing Molecules Repress Thioredoxin  Activity and Glucose Transport    3.2.1.15 Adenosine‐containing Molecules Affect Cell Cycle  Progression    3.2.2 Effects of Glucose Analogs on Txnip Expression    3.2.2.1 Effects of Selected Monosaccharides and Disaccharides on  Txnip Expression    3.2.2.2 Effect of PD169316 on Glucose, 2DG or Maltose/NAD+  Induced Txnip Expression  V    54    56    57    59    59    62    62    64    64    66    67    69    70    70    75    3.2.2.3 A Ca2+ Chelator Abolishes the Stimulatory Effect of Glucose  on Txnip Expression    3.2.3 Inhibitors of Oxidation Phosphorylation Repressed Txnip  Expression    3.2.3.1 Nitric Oxide (NO) and Sodium Azide (NaN3) Repress Txnip  Expression    3.2.3.2 Inhibition of Oxidative Phosphorylation Represses Txnip  Expression    3.2.3.3 A Ca2+ Chelator Rescues Txnip Expression in the Presence of  Oxidative Phosphorylation Inhibitors    3.3 Discussion    3.3.1 Adenosine‐containing Molecules May Remain Extracellular to  Induce Txnip Expression    3.3.2 Potential Membrane Targets for Adenosine‐containing Molecules    3.3.3 Signaling Pathway(s) Involved in the Induction of Txnip  Expression by Adenosine‐containing Molecules    3.3.4 The MondoA/MLX Complex Mediates Txnip Expression    3.3.5 Physiological Significance    3.3.6 Two Signaling Pathways Evoked by Glucose for Inducing Txnip  Expression    3.3.7 Txnip Expression Is a Sensor of Oxidative Phosphorylation Status    3.4 Conclusion and Perspectives    Chapter 4 Regulatory Mechanisms Underlying the Induction of Txnip  Expression by Glucose or Adenosine‐containing Molecules    4.1 Preface    4.2 Results    VI    75    76    76    80    82    83    83    84    85    87    89    91    93    94    96    96    98    4.2.1 Regulatory Mechanisms at the Promoter Level Governing  Glucose or Adenosine‐containing Molecules Induced Txnip  Expression    4.2.1.1 Txnip Promoter Regions Critical for Expression Induction  by NAD+ or Glucose    4.2.1.2 Tandem ChoREs on Txnip Promoters    4.2.1.3 The MondoA/MLX Complex Binds to Both ChoREs in vitro    4.2.1.4 Both ChoREs are Required for Optimal Txnip Promoter  Activity    4.2.1.5 ChoREs Are Not Sufficient for the Induction of Txnip  Expression    4.2.1.6 Tandem NF‐Y Binding Sites Are Required for the Induction  of Txnip Expression    4.2.1.7 NF‐Y Mediated Induction of Txnip Expression by SAHA  Requires MondoA/MLX    4.2.1.8 Txnip Promoter Recruits MondoA/MLX Complex in an  NF‐Y Dependent Manner    4.3 The Role of USFs in Txnip Expression    4.3.1 Expression and Purification of His‐tagged USF1    4.3.2 USF1 Interacts with ChoRE Sites in vitro    4.3.3 Down‐regulation of USFs Reduces Txnip Expression    4.3.4 Over‐expression of USFs Induces Txnip Promoter Activity    4.3.5 USF Is Not Involved in the Txnip Induction by  Adenosine‐containing Molecules    4.3.6 USF Is Not Involved in the Txnip Induction by Glucose    4.4 Discussion    4.4.1 Tandem ChoREs on the Txnip Gene Promoter  VII  98    98    102    105    108    111    111    114    116    121    121    122    125    127    129    132    133    133    4.4.2 Full Induction of Txnip Expression Requires Both ChoREs and  CCAAT Boxes    4.4.3 NF‐Y and MondoA/MLX Cooperate to Stimulate Txnip  Expression    4.4.4 The Role of USFs on Txnip Expression    4.5 Conclusion and Perspectives    References    Appendices    Appendix I, Buffers/Gels Used in This Study    Appendix II, RNA Integrity    Appendix III, Primer Specificity    Appendix IV, Primers Used in This Study    Appendix V, Paper 1 (Abstract)    Appendix VI, Paper 2 (Abstract)                    VIII    134    136    138    140    143    162    162    165    166    167    172    173  Summary    Thioredoxin interacting protein (Txnip) is a multifunctional protein involved  in regulation of cell cycle events and cellular metabolism. The expression of Txnip is  induced  by  glucose,  and  this  induction  is  mediated  by  a  carbohydrate  response  element  (ChoRE)  on  Txnip  promoter  and  its  associated  transcription  factors,  MondoA  and  Max‐like  protein  X  (MLX).    In  this  study,  I  have  discovered  that  the  transcription  of  the  Txnip  gene  is  induced  by  an  array  of  adenosine‐containing  molecules,  of  which  an  intact  adenosine  moiety  is  necessary  and  sufficient.    The  induction  of  Txnip  expression  by  adenosine‐containing  molecules  is  glucose  dependent, and MondoA and MLX have been shown to convey stimulatory signals  from  extracellular  molecules  to  the  Txnip  promoter.   Therefore,  the  regulatory  role  of  adenosine‐containing  molecules  is  exerted  via  amplifying  glucose  signaling,  and  this suggests that these molecules may modulate the kinetics of glucose homeostasis.  I  have  also  studied  the  underlying  regulatory  mechanisms  of  glucose  and  adenosine‐containing molecules on Txnip expression.    An additional ChoRE on the  promoter  of  Txnip  gene  has  been  identified,  and  this  ChoRE  is  able  to  recruit  MondoA  and  MLX  in  a  similar  fashion  as  the  previously  identified  ChoRE  in  vitro  and  in  vivo.    Both  ChoREs  function  cooperatively  to  mediate  optimal  Txnip  expression  under  glucose  or  adenosine‐containing  molecules  treatment.    However,  these two ChoREs are not sufficient to mediate the induction of Txnip expression by  glucose or adenosine‐containing molecules, and two CCAAT boxes, both can recruit  IX  References  Simmons,D.G.,  Kennedy,T.G.  (2004)  Rat  endometrial  Vdup1  expression:  changes  related  to  sensitization  for  the  decidual  cell  reaction  and  hormonal  control  Reproduction. 127: 475‐482.  Sklar,V.E.,  Schwartz,L.B.,  and  Roeder,R.G.  (1975)  Distinct  molecular  structures  of  nuclear class I, II, and III DNA‐dependent RNA polymerases Proc Natl Acad Sci U S A  72: 348‐352.  Son,A.,  Nakamura,H.,  Okuyama,H.,  Oka,S.,  Yoshihara,E.,  Liu,W.,  Matsuo,Y.,  Kondo,N.,  Masutani,H.,  Ishii,Y.,  Iyoda,T.,  Inaba,K.,  and  Yodoi,J.  (2008)  Dendritic  cells  derived  from  TBP‐2‐deficient  mice  are  defective  in  inducing  T  cell  responses  Eur.J Immunol 38: 1358‐1367.  Song,H., Cho,D., Jeon,J.H., Han,S.H., Hur,D.Y., Kim,Y.S., and Choi,I. (2003) Vitamin  D(3) up‐regulating protein  1 (VDUP1)  antisense  DNA  regulates  tumorigenicity  and  melanogenesis of murine melanoma cells via regulating the expression of fas ligand  and reactive oxygen species Immunol Lett. 86: 235‐247.  Stark,G.R.,  Kerr,I.M.,  Williams,B.R.,  Silverman,R.H.,  and  Schreiber,R.D.  (1998)  How  cells respond to interferons Annu Rev Biochem 67: 227‐264.  Stoeckman,A.K.,  Ma,L.,  and  Towle,H.C.  (2004)  Mlx  is  the  functional  heteromeric  partner of the carbohydrate response element‐binding protein in glucose regulation  of lipogenic enzyme genes J Biol Chem 279: 15662‐15669.  Stoltzman,C.A.,  Peterson,C.W.,  Breen,K.T.,  Muoio,D.M.,  Billin,A.N.,  and  Ayer,D.E.  (2008) Glucose sensing by MondoA:Mlx complexes: a role for hexokinases and direct  regulation of thioredoxin‐interacting protein expression Proc Natl Acad Sci U S A 105:  6912‐6917.  Taatjes,D.J., Marr,M.T., and Tjian,R. (2004) Regulatory diversity among metazoan co‐ activator complexes Nat Rev Mol Cell Biol 5: 403‐410.  Takahashi,Y.,  Nagata,T.,  Ishii,Y.,  Ikarashi,M.,  Ishikawa,K.,  and  Asai,S.  (2002)  Up‐ regulation of vitamin D3 up‐regulated protein 1 gene in response to 5‐fluorouracil in  colon carcinoma SW620 Oncol.Rep. 9: 75‐79.  Taparia,S.,  Fleet,J.C.,  Peng,J.B.,  Wang,X.D.,  and  Wood,R.J.  (2006)  1,25‐ Dihydroxyvitamin  D  and  25‐hydroxyvitamin  D‐‐mediated  regulation  of  TRPV6  (a  putative epithelial calcium channel) mRNA expression in Caco‐2 cells Eur.J Nutr. 45:  196‐204.  Thorn,J.A., Jarvis,S.M. (1996) Adenosine transporters Gen.Pharmacol. 27: 613‐620.  Tissing,W.J.,  den  Boer,M.L.,  Meijerink,J.P.,  Menezes,R.X.,  Swagemakers,S.,  van  der  Spek,P.J.,  Sallan,S.E.,  Armstrong,S.A.,  and  Pieters,R.  (2007)  Genomewide  identification  of  prednisolone‐responsive  genes  in  acute  lymphoblastic  leukemia  cells Blood 109: 3929‐3935.  158  References  Tomoda,K.,  Kubota,Y.,  and  Kato,J.  (1999)  Degradation  of  the  cyclin‐dependent‐ kinase inhibitor p27Kip1 is instigated by Jab1 Nature 398: 160‐165.  Turturro,F.,  Friday,E.,  and  Welbourne,T.  (2007)  Hyperglycemia  regulates  thioredoxin‐ROS  activity  through  induction  of  thioredoxin‐interacting  protein  (TXNIP) in metastatic breast cancer‐derived cells MDA‐MB‐231 BMC.Cancer 7: 96.  van  der  Vleuten,G.M.,  Hijmans,A.,  Kluijtmans,L.A.,  Blom,H.J.,  Stalenhoef,A.F.,  and  de  Graaf,J.  (2004)  Thioredoxin  interacting  protein  in  Dutch  families  with  familial  combined hyperlipidemia Am.J Med.Genet.A 130A: 73‐75.  Van  Dyke,M.W.,  Roeder,R.G.,  and  Sawadogo,M.  (1988)  Physical  analysis  of  transcription preinitiation complex assembly on a class II gene promoter Science 241:  1335‐1338.  van  Greevenbroek,M.M.,  Vermeulen,V.M.,  Feskens,E.J.,  Evelo,C.T.,  Kruijshoop,M.,  Hoebee,B.,  van  der  Kallen,C.J.,  and  de  Bruin,T.W.  (2007)  Genetic  variation  in  thioredoxin  interacting  protein  (TXNIP)  is  associated  with  hypertriglyceridaemia  and blood pressure in diabetes mellitus Diabet.Med. 24: 498‐504.  Villalobo,A. (2006) Nitric oxide and cell proliferation FEBS J 273: 2329‐2344.  Villard,J., Peretti,M., Masternak,K., Barras,E., Caretti,G., Mantovani,R., and Reith,W.  (2000)  A  functionally  essential  domain  of  RFX5  mediates  activation  of  major  histocompatibility  complex  class  II  promoters  by  promoting  cooperative  binding  between RFX and NF‐Y Mol Cell Biol 20: 3364‐3376.  Wang,Y.,  De  Keulenaer,G.W.,  and  Lee,R.T.  (2002)  Vitamin  D(3)‐up‐regulated  protein‐1  is  a  stress‐responsive  gene  that  regulates  cardiomyocyte  viability  through  interaction with thioredoxin J Biol Chem 277: 26496‐26500.  Wang,Z., Rong,Y.P., Malone,M.H., Davis,M.C., Zhong,F., and Distelhorst,C.W. (2006)  Thioredoxin‐interacting  protein  (txnip)  is  a  glucocorticoid‐regulated  primary  response gene involved in mediating glucocorticoid‐induced apoptosis Oncogene 25:  1903‐1913.  Weil,P.A.,  Luse,D.S.,  Segall,J.,  and  Roeder,R.G.  (1979)  Selective  and  accurate  initiation  of  transcription  at  the  Ad2  major  late  promotor  in  a  soluble  system  dependent on purified RNA polymerase II and DNA Cell 18: 469‐484.  Wen,L.T.,  Knowles,A.F.  (2003)  Extracellular  ATP  and  adenosine  induce  cell  apoptosis  of  human  hepatoma  Li‐7A  cells  via  the  A3  adenosine  receptor  Br.J  Pharmacol. 140: 1009‐1018.  Wu,C. (1995) Heat shock transcription factors: structure and regulation Annu Rev Cell  Dev Biol 11: 441‐469.  Xiang,G.,  Seki,T.,  Schuster,M.D.,  Witkowski,P.,  Boyle,A.J.,  See,F.,  Martens,T.P.,  Kocher,A.,  Sondermeijer,H.,  Krum,H.,  and  Itescu,S.  (2005)  Catalytic  degradation  of  159  References  vitamin  D  up‐regulated  protein  1  mRNA  enhances  cardiomyocyte  survival  and  prevents  left  ventricular  remodeling  after  myocardial  ischemia  J  Biol  Chem  280:  39394‐39402.  Xu,W.,  Ngo,L.,  Perez,G.,  Dokmanovic,M.,  and  Marks,P.A.  (2006)  Intrinsic  apoptotic  and  thioredoxin  pathways  in  human  prostate  cancer  cell  response  to  histone  deacetylase inhibitor Proc Natl Acad Sci U S A 103: 15540‐15545.  Yamada,K., Tanaka,T., Miyamoto,K., and Noguchi,T. (2000) Sp family members and  nuclear factor‐Y cooperatively stimulate transcription from the rat pyruvate kinase M  gene distal promoter region via their direct interactions J Biol Chem 275: 18129‐18137.  Yamaguchi,F.,  Takata,M.,  Kamitori,K.,  Nonaka,M.,  Dong,Y.,  Sui,L.,  and  Tokuda,M.  (2008) Rare sugar D‐allose induces specific up‐regulation of TXNIP and subsequent  G1 cell cycle arrest in hepatocellular carcinoma cells by stabilization of p27kip1 Int.J  Oncol. 32: 377‐385.  Yamamoto,Y., Sakamoto,M., Fujii,G., Kanetaka,K., Asaka,M., and Hirohashi,S. (2001)  Cloning  and  characterization  of  a  novel  gene,  DRH1,  down‐regulated  in  advanced  human hepatocellular carcinoma Clin Cancer Res 7: 297‐303.  Yamanaka,H.,  Maehira,F.,  Oshiro,M.,  Asato,T.,  Yanagawa,Y.,  Takei,H.,  and  Nakashima,Y. (2000) A possible interaction of thioredoxin with VDUP1 in HeLa cells  detected in a yeast two‐hybrid system Biochem Biophys.Res Commun. 271: 796‐800.  Yamashita,H.,  Takenoshita,M.,  Sakurai,M.,  Bruick,R.K.,  Henzel,W.J.,  Shillinglaw,W.,  Arnot,D.,  and  Uyeda,K.  (2001)  A  glucose‐responsive  transcription  factor  that  regulates carbohydrate metabolism in the liver Proc Natl Acad Sci U S A 98: 9116‐9121.  Yamawaki,H.,  Pan,S.,  Lee,R.T.,  and  Berk,B.C.  (2005)  Fluid  shear  stress  inhibits  vascular  inflammation  by  decreasing  thioredoxin‐interacting  protein  in  endothelial  cells J Clin Invest 115: 733‐738.  Yin,J.,  Xu,K.,  Zhang,J.,  Kumar,A.,  and  Yu,F.S.  (2007)  Wound‐induced  ATP  release  and EGF receptor activation in epithelial cells J Cell Sci 120: 815‐825.  Yoshida,T.,  Nakamura,H.,  Masutani,H.,  and  Yodoi,J.  (2005)  The  involvement  of  thioredoxin  and  thioredoxin  binding  protein‐2  on  cellular  proliferation  and  aging  process Ann.N.Y.Acad Sci 1055: 1‐12.  Yoshida,T., Kondo,N., Oka,S., Ahsan,M.K., Hara,T., Masutani,H., Nakamura,H., and  Yodoi,J. (2006) Thioredoxin‐binding protein‐2 (TBP‐2): its potential roles in the aging  process Biofactors 27: 47‐51.  Yoshioka,J.,  Imahashi,K.,  Gabel,S.A.,  Chutkow,W.A.,  Burds,A.A.,  Gannon,J.,  Schulze,P.C., MacGillivray,C., London,R.E., Murphy,E., and Lee,R.T. (2007) Targeted  deletion of thioredoxin‐interacting protein regulates cardiac dysfunction in response  to pressure overload Circ Res 101: 1328‐1338.  160  References  Zhou,J., Cidlowski,J.A. (2005) The human glucocorticoid receptor: one gene, multiple  proteins and diverse responses Steroids 70: 407‐417.  Zhu,J.,  Giannola,D.M.,  Zhang,Y.,  Rivera,A.J.,  and  Emerson,S.G.  (2003)  NF‐Y  cooperates with USF1/2 to induce the hematopoietic expression of HOXB4 Blood 102:  2420‐2427.  Zimmermann,H.  (2000)  Extracellular  metabolism  of  ATP  and  other  nucleotides  Naunyn Schmiedebergs Arch.Pharmacol. 362: 299‐309.  161  Appendices  Appendix I    Buffers/Gels Used in This Study    SDS‐PAGE sample buffer (5×)    10% w/v    SDS    10 mM     Dithiothreitol (DTT)    10% v/v    Glycerol    0.2 M      Tris‐HCl, pH6.8    0.05% w/v    Bromophenolblue    SDS‐PAGE running buffer (1×)    for 10 L    Tris base        30 g    Glycine        144 g    SDS          10 g    It is not necessary to adjust pH.    Coomassie blue staining solution  50% (v/v) methonal   0.05% coomassie brilliantblue R‐250  10% (v/v) acetic acid  40% sterile water.     Destain solution    50% v/v methanol    10% v/v acetic acid  40% sterile water.     Transfer buffer (Electro‐blotting)    for 4L    20mM Tris Base (pH8.6)    9.7g    150mM Glycine      45.0g    10% Methanol       400.0mL    TBST    100 mM Tris base, pH7.6    150 mM NaCl    0.1% v/v Tween‐20    PBS‐TX    PBS (1×)    0.1% v/v Triton X‐100    START SOLUTION (10×)  1 mM 2‐deoxyglucose  5 μCi/ml [3H]‐2‐deoxyglucose       162  Appendices  KRH Buffer          for 1L  50mM HEPES, pH 7.4     5.2g (or 20mL of 1M stock)  136mM NaCl        7.9g (or 27.2 ml of 5 stock)  4.7mM KCl        0.35g (or 4.7 ml of 1M stock)  1.25mM MgSO4      0.3g (or 1.25 ml of 1M stock)  1.25mM CaCl2       0.5ml of 2.5 M stock     Bacterial lysis buffer  20 mM Tris pH 8.0  500 mM NaCl  0.5 mg/ml Lysozyme  0.5% Triton  1 mM PMSF  1mM Beta‐Maecaptoethanol or DTT    MC buffer (for ChIP)  10 mM Tris‐HCl pH 7.5  10 mM NaCl  3 mMMgCl2  0.5% (v/v) NP‐40  Store up to 1 year at 4◦C    1× GS Buffer (for 1ml)  0.2ml      PolydI‐dC‐PolydI‐dC (1mg/ml in H2O)  0.3ml      H2O  0.5ml      2× GS  1μl      1M DTT  Aliquot and store at ‐20oC     2× GS Buffer  25mM            Hepes pH8.4  62.5mM    KCl  0.05%      NP‐40 or IGEPAL  2mM       MgCl2  8%      Ficoll‐400  500μg/ml    BSA  0.5mM     PMSF  2X      Protease Inhibitor cocktail      10× TGEMN Running Buffer   62.5mM    Tris pH8.2  500mM    Glycine  1mM      EDTA  10mM      MgCl2  0.25%      NP40 or IGEPAL  Store at RT; 1X TGEMN can be stored at 4°C, add 0.5 mM DTT freshly.  163  Appendices    BC100  20 mM Tris‐HCl, pH 7.9 at 4oC  20 % glycerol  0.25 mM EDTA  0.125 mM EGTA  0.025% Triton X‐100  100 mM KCl  Before use, freshly add 0.5 mM DTT and 0.25 mM PMSF    Gel for EMSA (4%, for 35 ml)  7ml        20% Acrylamide/Bis solution (59:1 linkage)  7ml       20% Glycerol  3.5ml       10X TGEMN  17.3ml      H2O  175μl       10% APS  17.5μl       TEMED  17.5μl       1M DTT    SDS‐PAGE Gel composition    Lower Gel (10 ml)  5%  8%  10%  12%  15%  30% Acry‐Bis (29 :1)  1.665  2.665  3.335  4  5  65% Sucrose  0.385  0.59  0.78  1.25  1.565  10× Lower Buffer  1  1  1  1  1  dH2O  6.9  5.74  4.875  3.75  2.44  10% APS  100  100  100  100  100  TEMED  10  10  10  10  10  Stacking gel (5 ml)  4%  30% Acryl‐Bis (29 :1)  0.67  4× Stacking Buffer  1.25  dH2O  3.05  10% APS  50  TEMED  10                  164  Appendices  Appendix II    RNA Integrity    RNA  (2  μg)  prepared  using  RNeasy  Mini  Kit  was  separated  and  visualized  using  ethidium  bromide  agarose  gel.    The  band  corresponding  to  28S  or  18S  rRNA  was  strong  and  sharp  (lanes  2‐6),  indicating  high‐quality  RNA.    Lane  1,  molecular  weight marker (100 bp ladder).        1         2        3        4         5         6                                                165  Appendices  Appendix III    Primer Specificity    Following  Real‐Time  PCR  (primers  against  human  Txnip  or  β‐actin),  the  dissociation  curve  of  PCR  products  were  plotted.    As  shown  below,  unique  and  sharp  peak  was  revealed  in  dissociation  curve  for  each  primer  pair,  indicating  that  primers  used  were  specific  to  their  targeting  gene.    Dissociation  curves  for  primers  against other genes were similar (single peak).      Txnip     β-actin             166  Appendices  Appendix IV    Primers Used in This Study    Primers  Remarks  GCCTCGAGCTCCAAATCGAGGAAACCG-reverse CCGGCTAGCCCAACAAGAATGAAGAGAG-1299 CCGGCTAGCGGGTACAAGCTGGGGG-760 CCGGCTAGCGAGGCCTGAAAGTTCTC-653 CCGGCTAGCCCTCAGAGACGGTGG-633 CCGGCTAGCGCACTGGCTAAGACTAG-441 CCGGCTAGCACAGCCCCCTCCTTCCC-269 CCGGCTAGCGTGTCCACGCGCCACAGC-169 CCGGCTAGCACGCGCCACAGCGATCTC-163 CCGGCTAGCACAGCGATCTCACTGATTG-157 CCGGCTAGCTCACTGATTGGTCGGGCTC-147 CCGGCTAGCGATTGGTCGGGCTCCTGG-142 Primers for  generating serial  Txnip promoter  deletions. The  reverse primer is a  common. Numbers  indicate the base  pairs upstream of  the transcription  staring site.  Restriction sites are  underlined.  CCGGCTAGCAGCCAATGGGAGGGATG-111 CCGGCTAGCGGGAGGGATGTGCACGAGGG-102 CCGGCTAGCCCTCCGGGCCAGCGCTCG-73 CCGGCTAGCCAATCCTCCGGGCCAGCGCTCG-73cat CCGGCTAGCCCCTCCCATTGGCTGCCCG-Rev95 CCGGCTAGCGGTCCGGAGGCTCGTGCTGC-Rev63 CCGGCTAGCGGTCCGGAGGCTCATACTGC-Rev63mut CCGACGCGTACAGCCCCCTCCTTCCC-269 CCGACGCGTAGCCAGGAGCACACCGTGTC-184 CCGACGCGTAGCCAGGAGTATACCGTGTC-184mut CCGACGCGTCTGATTGGTCGGGCTCCTGG-145 CGTGTCCACGCGCCACAGCGAT-d170fwd CTGGCTGGGAAAATGGTTGTTGCG-d170rev TGTCTATGCGCCACAGCGATCTCAC Primers for  generating Txnip‐ TATA fusion  promoters. 184mut  and Rev63mut were  used to generate  mutations at  ChoREs (one E‐box  mutated). Primers  with d170 label  were used to delete  sequences around ‐ 170.  Primers for ChoRE‐ b mutation  CGGTATACTCCTGGCTGGGAAAATG 167  Appendices  Primers  Remarks  GCAGTATGAGCCTCCGGGCCAGCG Primers for ChoRE‐ a mutation  CCTCATACACATCCCTCCCATTGGC Primers for inverted  CCAAT box  mutation  ACTCAGTGAGATCGCTGTGGCG AGTCGGGCTCCTGGTAAACAAG GATGGGAGGGATGTGCACGAGGGC Primers for CCAAT  box mutation  AGCTGCCCGGTCCTTGTTTACCAG CATAGAGACGTTTCCGCCTCCTGC TCGTAGCCCGGGCCAGAAGAGC Shuffle CGCGTAGCCAGGAGCACACCGTGTCCACGCGCCACCATACC TAGGACTTGGCTGGTCTGGGTGCCAGCGTAGCAAAGGACGG AGGCCACATGATAGGGTGCACGAGGGCAGCACGAGCCTCCG GACCG-fwd CTAGCGGTCCGGAGGCTCGTGCTGCCCTCGTGCACCCTATC ATGTGGCCTCCGTCCTTTGCTACGCTGGCACCCAGACCAGC CAAGTCCTAGGTATGGTGGCGCGTGGACACGGTGTGCTCCT GGCTA-rev dChoRE-b CGCGAGCACACCGTGTCCACGCGCCTGAGCACACCGTGTCC ACGCGCC-fwd CTAGGGCGCGTGGACACGGTGTGCTCAGGCGCGTGGACACG GTGTGCT-rev dChoRE-a CGCGTGCACGAGGGCAGCACGAGCCTGTGCACGAGGGCAGC ACGAGCC-fwd CTAGGGCTCGTGCTGCCCTCGTGCACAGGCTCGTGCTGCCC TCGTGCA-rev ChoRE-ab CGCGAGCACACCGTGTCCACGCGCCTGTGCACGAGGGCAGC ACGAGCC-fwd CTAGGGCTCGTGCTGCCCTCGTGCACAGGCGCGTGGACACG GTGTGCT-rev ChoRE-b CGCGAGCACACCGTGTCCACGCGCC-fwd CTAGGGCGCGTGGACACGGTGTGCT-rev ChoRE-a CGCGTGCACGAGGGCAGCACGAGCC-fwd CTAGGGCTCGTGCTGCCCTCGTGCA-rev pTxnip269_xho1 CCGCTCGAGACAGCCCCCTCCTTCCC pTxnipR_BamH1 GATGGATCCCTCCAAATCGAGGAAACCG mChREBP-EcoRI-F TCTGAATTCCTTCTTCCTGAAGACCCTA 168  Primers for TATA  box mutation  Synthesized  oligonucleotides for  making Txnip‐ TATA fusion  promoters  Transfer promoters  from pGL3‐Txnip  (WT or Mut) to  pEGFP1  Primers for cloning  of mouse ChREBPζ  Appendices  Primers  Remarks  mChREBP-EcoRI-R TAGGGTCTTCAGGAAGAAGGAATTCAGA mChREBP-Noc1-F CTGCCCCATGGGTACCTGGAACCCGTCT mChREBP-Noc1-R AGACGGGTTCCAGGTACCCATGGGGCAG mChREBP-XhoI CACCTCGAGATGGCGCGCGCGCTGGCGGATCTATCCGTGAA C mChREBP-Mlu1 TACACGCGTTATAATGGTCTCCCCAGGGTGCCCTCTGTGAC TGC mChREBP_seq680 TGCTGCTTGGGGGCTCCGA mChREBP_seq1170 CCAAGATCCCACCTGCTCC mChREBP_seq1510 CAAGCCCTCCTCCCCATCC mMlx-xho1 CACCTCGAGATGACGGAGCCGGGCGCCTC mMlx-xba1 CGCTCTAGATCAGTAGAGTTGGTTTTTCAACTG mMLX_R88S AGTGATGCTATTAAGAGAGGCTAT mMLX_R87A TGCCTTCTGTTCAGCCTGAGTGTG Mlx-Xho1 TCGCTCGAGATGACGGAGCCGGGCGCCTCTC Mlx-Stop-Not1 GTAGCGGCCGCTCAGTAAAGCTGGTTTTTCAATTGGTGCAG Mlx-EcoRVf(human) TCTGATATCATGACGGAGCCGGGCGCCTCTC Mlx-not1r(human) GTGGCGGCCGCACGTAAAGCTGGTTTTTCAATTGGTGCAG mUSF1f-mlu1 TACACGCGTAATGAAGGGGCAGCAGAAAACAGC mUSF1r-not1 TACGCGGCCGCTTAGTTGCTGTCATTCTTGATGACGAC mUSF2f-mlu1 TACACGCGTAATGGACATGCTGGACCCGGGTC mUSF2r-not1 TACGCGGCCGCTCACTGCCGGGTACTCTCGCC USF1f-sMlu1 TACACGCGTAATGTACAGGGTGATCCAGGTGTCTG USF1r-not1 TACGCGGCCGCTTAGTTGCTGTCATTCTTGATGACGAC USF1f-lMlu1 TACACGCGTAATGAAGGGGCAGCAGAAAACAGC USF2f-mlu1 Primers for cloning  of mouse ChREBPζ  169  Primers for ChREBP  sequencing   Primers for cloning  of mouse MLXβ  Primers for making  dominant negative  mouse MLX  Primers for cloning  of human MLX  Primers for cloning  of human or mouse  USF (USF1 or  USF2).            Primers for cloning  of human or mouse  USF (USF1 or  USF2).  Appendices  Primers  Remarks  TACACGCGTAATGGACATGCTGGACCCGGGTC USF2r-not1 TACGCGGCCGCTCACTGCCGGGTGCCCTCGC USF1f-lNde1 TACCATATGAAGGGGCAGCAGAAAACAGC USF1r-BamH1 TACGGATCCTTAGTTGCTGTCATTCTTGATGACGAC Primers for making  His‐USF1  (pET vector)  MondoA-EcoRVf TCTGATATCATGGCCGCCGACGTCTTCATGTGCTC MondoA-not1r GTGGCGGCCGCACGGACTCTCCCAATCTCTTGCCAATCC MondoA-EcoRIf ATGTCGGAATTCAGCGACACCCTCTT MondoA-EcoRIr AAGAGGGTGTCGCTGAATTCCGACATMondoA-Bgl2f GCATCCTGGTGACAGATCTCGGCCAT MondoA-Bgl2r ATGGCCGAGATCTGTCACCAGGATGC MondoA-Xho1 TCGCTCGAGATGGCCGCCGACGTCTTCATGTGCTC MondoA-Stop-Not1 GTAGCGGCCGCCTAGGACTCTCCCAATCTCTTGCCAATCC MondoA_Seq1 CTGGACGGCTCTGTGGACG MondoA_Seq2 ATCCCAACAACCCACCTGC MondoA_seq3 GCTGGCACTGTCTCCTGTC MondoA_seq4 ATCGGAGCAGAGCCCCAGT MondoAseqR1 CCATCCATCCCCGTGCTTGT MondoAseqR2 AAGGGCTGCGGGACACTCA MondoAsewR3 TTGGACTGGGACACGGTGG MondoA-Not1r GTAGCGGCCGCCCGGACTCTCCCAATCTCTTGCCAATCC Δ237MondoA-not1 CATGCGGCCGCCCGATGAGGACCTCTCCAGCCTGGTC CTGGCAAGTCCGACCCCAAAA Primers for cloning  of human MondoA  Primers for  MondoA  sequencing  Insert MondoA  Δ237 into cas12  vector  AACAATTATTCTGGGGAGATTGAG Primers for making  the MondoAr  gstMdaEcR1 TACGAATTCACGGTCAACAAACAGACGTGCC gstMlxEcr1 TACGAATTCCAGAAGAGGAGGGACGCCATC Primer for making  GST‐MondoA  Primer for making  GST‐MLX  170  Appendices  Primers  Remarks  NFYA-xho1 TACCTCGAGATGGAGCAGTATACAGCAAACAGCA NFYA-not1 TACGCGGCCGCTTAGGACACTCGGATGATCTGTGT pCI-rev (seq) gtatcttatcatgtctgctcg pCI-rev-2 (seq) CCCTGAACCTGAAACATAAA pCI-SEQfar CTTACTGACATCCACTTTGC GCCGACAGGATGCAGAAGGAGATCA Primers for cloing of  human NF‐YA  Sequencing primers  for pCI‐neo vector   (pdHA, pdFLAG or  pdMyc)  β‐actin  RT‐PCR primers  AAGCATTTGCGGTGGACGATGGA GGCGGGTGTCTGTCTCTGCT Human Txnip  RT‐PCR primers  GGCAAGGTAAGTGTGGCGGG GACCCCGATGATGAGGACAG MLX  RT‐PCR primers  TGTAGAACGATGGCTTTGCTG CCTCCACCGTGTCCCAGTC MondoA  RT‐PCR primers  CTGGGGCTCTGCTCCGATG TCGGACACAGACTCGGAGG ChREBP  RT‐PCR primers  AGAGGCGTGTGAGTGTGGG GAAGTTACCCGAGTCAAAGC Mouse Txnip  RT‐PCR primers  CGCAAGTAGTCCAAAGTCTG ATGGCACTGGCGGCAGGTCC Mouse cyclophilin  RT‐PCR primers  TTGCCATTCCTGGACCCAAA                           171  Appendices  Appendix V, Paper 1 (Abstract)    Yu FX, Goh SR, Dai RP, Luo Y. Mol Endocrinol. 2009 Jun;23(6):932‐42  Adenosine‐containing  molecules  amplify  glucose  signaling  and  enhance  txnip  expression.      Eukaryotic cells sense extracellular glucose concentrations via diverse mechanisms to  regulate the expression of genes involved in metabolic control. One such example is  the tight correlation between the expression of thioredoxin‐interacting protein (Txnip)  and extracellular glucose levels. In this report, we show that the transcription of the  Txnip  gene  is  induced  by  adenosine‐containing  molecules,  of  which  an  intact  adenosine  moiety  is  necessary  and  sufficient.  Txnip  promoter  contains  a  carbohydrate  response  element,  which  mediates  the  induction  of  Txnip  expression  by these molecules in a glucose‐dependent manner. Max‐like protein X and MondoA  are  transcription  factors  previously  shown  to  stimulate  glucose‐dependent  Txnip  expression  and  are  shown  here  to  convey  stimulatory  signals  from  extracellular  adenosine‐containing molecules to the Txnip promoter. The regulatory role of these  molecules  may  be  exerted  via  amplifying  glucose  signaling.  Hence,  this  revelation  may  pave  the  way  for  interventions  aimed  toward  metabolic  disorders  resulting  from abnormal glucose homeostasis.                                                        172  Appendices  Appendix VI, Paper 2 (Abstract)      Yu FX and Luo Y. PLoS ONE. 2009, Dec; 4(12): e8397   Tandem  ChoRE  and  CCAAT  motifs  and  associated  factors  regulate  Txnip  expression in response to glucose or adenosine‐containing molecules.      Thioredoxin  interacting  protein  (Txnip)  is  a  multifunctional  protein  involved  in  regulation  of  cell  cycle  events  and  cellular  metabolism.    The  expression  of  Txnip  is  known to be induced by glucose, adenosine‐containing molecules, HDAC inhibitors  and  other  physiological  cues;  however,  the  underlying  regulatory  mechanisms  remain elusive.  Here, we show identification of an additional carbohydrate response  element (ChoRE) on the promoter of Txnip gene, which functions cooperatively with  the earlier identified ChoRE to mediate optimal Txnip expression.  We also show that  the  function  of  ChoREs  and  associated  factors  is  contingent  on  tandem  CCAAT  motifs,  in  that  the  occupancy  of  the  Txnip  promoter  by  the  CCAAT‐box‐associated  nuclear factor Y (NF‐Y) is a prerequisite for efficacious recruitment of MondoA/MLX  to ChoREs.  Such a strategy suggests a synergy between NF‐Y and MondoA/MLX in  enhancing  Txnip  expression  presumably  through  inducing  dynamic  chromatin  changes in response to diverse physiological inducers.  173  [...]... Figure 25. Inhibitors for purinergic receptors did not inhibit the induction of Txnip expression by NAD+ or ATP.        Figure 26. Structures of Adenosine, NBTI, Dipyridamole or Dilazep.        Figure 27. The effect of NAD+ or ATP on Txnip expression was blocked by  inhibitors of adenosine transporters.        Figure 28. Effect of Ca2+ chelators on Txnip expression.         Figure 29. cAMP signaling pathway did not mediate the induction of Txnip expression by NAD+. ... Figure 72. The response of Txnip promoter to NAD+ or ATP under USF  over expression.     Figure 73. Effects of USF over expression on the activities of truncated or  mutant Txnip promoters.    Figure 74. A‐USF did not repress the induction of Txnip promoter activity by  NAD+ or ATP.    Figure 75. A‐USF did not repress the induction of Txnip promoter activity by  glucose.    Figure 76. A model for the transcriptional regulation of the Txnip gene ...   Therefore,  ARRDC  genes  might  be  more  ancient than Txnip in evolution.  12  Chapter 1    Figure 4.  Gene structures of Txnip,  arrestin β2 and ARRDC genes.   Drawings on  the left indicate the size (in scale) and distribution of exons for each gene.   Table on  the right contains name, ID and chromosomal positions for each gene.   †: ARRDC2,  isoform 1 and 2; ‡: arrestin β2, isoform 1.  All genes shown are human genes. ... Figure 36. NAD(H) treatments elevated p21cip1 expression level.        Figure 37. Structures of glucose analogs and their fate in cellular metabolism.      Figure 38. The effect of glucose and glucose homologs on Txnip expression in  the absence or presence of NAD+.          Figure 39. The effect of PD169316 on Txnip induction by different  carbohydrates and/or NAD+.        Figure 40. Glucose induced Txnip expression was repressed by BAPTA‐AM. ... 3.    A  phylogenetic  tree  of Txnip orthologs  from  different  organisms.    The phylogenetic tree was generated using software in UCSC genome browser.    11  Chapter 1  The Txnip gene can  be  found  in  all  vertebrates  (from  fish  to  human)  with  available  genome  sequence  information;  a  phylogenetic  tree  has  been  constructed  based on the similarity of different Txnip orthologs, and clearly, this tree fit well with ... Figure 40. Glucose induced Txnip expression was repressed by BAPTA‐AM.        Figure 41. Effects of NO donors and GC inhibitor on Txnip expression.         Figure 42. The effect of NO on Txnip expression was not mediated by GC.        Figure 43. The effect of NaN3 on Txnip mRNA Levels.    Figure 44. A simplified representation of oxidative phosphorylation.        Figure 45. Effects of oxidative phosphorylation inhibitors on Txnip or H2B  expression.         Figure 46. Oxidative phosphorylation inhibitors did not repress Txnip ... isoform 1 and 2; ‡: arrestin β2, isoform 1.  All genes shown are human genes.    The expression products of Txnip and ARRDC genes also shared high level of similarity (with highest similarity to ARRDC2‐4, Figure 5).  All these proteins contain  one arrestin N‐terminal domain and one arrestin C‐terminal domain, and the overall  primary  structure  of these  proteins  are  similar  to  arrestin  β2,  although  the gene structure  of arrestin  β2 ... the accumulation of dimeric HIF‐1.  This in turn induces transcription of several HIF‐ responsive genes, mediated by the HIF‐responsive element (HRE) on their promoters;  the induced  expression of these  genes  can  promote  survival  of host  cells  under  hypoxia conditions.       Figure  2.    Possible  mechanisms  for  the regulation of gene transcription  by  extracellular molecules and internal environment changes. ... Pol II is a protein complex containing 12 subunits encoded by different genes;  among  these  subunits,  some  are  Pol  II‐specific  while  others  are  shared  with  other  RNA polymerases (Sklar et al., 1975).  The synthesis of protein‐coding mRNAs by Pol  II  is  a  complicated  process  facilitated  by  many  other  factors,  and  is  controlled  by  multiple regulatory  pathways  to  meet  the spatial  and  temporal requirement for the expression of specific genes.  The last four decades have witnessed extensive studies ... Figure 46. Oxidative phosphorylation inhibitors did not repress Txnip expression in the presence BAPTA‐AM.        Figure 47. A negative feed‐back loop for glucose uptake.        Figure 48. A schematic representation of truncated Txnip promoters.        Figure 49. Responses of Txnip promoters to NAD+.        Figure 50. Responses of Txnip promoters to NAD+ or Glucose.        Figure 51. The minimal Txnip promoter sequence required for mediating the stimulatory effect of NAD+.  .   THE REGULATION OF  TXNIP GENE EXPRESSION      FAXINGYU (B.Sc.(Hons.),NUS)     ATHESISSUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF BIOCHEMISTRY NATIONALUNIVERSITY OF SINGAPORE 2009 Acknowledgments  Ifirstthankmysupervisor,Dr.YanLuo,forhisvaluablecommentsonhowto designandperformexperiments,forhisgenerousgiving of freedomtoexplorenew fields,forhisenthusiasticencouragementwhenIencountereddifficulties,andforhis criticalread. 38  3.2.1.2MoleculesContainingAdenosineGroupInduce Txnip Expression 40  3.2.1.3AdenosineisNecessaryandSufficientforInducing Txnip Expression 40  3.2.1.4Adenosine‐containingMoleculesInduce Txnip Expression inaDose‐dependentManner 43  3.2.1.5LongTermEffect of Adenosine‐containingMoleculeson Txnip Expression 44  3.2.1.6Adenosine‐containingMoleculesInduce Txnip Expression at the TranscriptionalLevel 45  3.2.1.7Adenosine‐containingMoleculesInduce Txnip Expression IsMediatedbyanEarlierDefinedChoRE 47  3.2.1.8 The MLX/MondoAComplexMediates the Induction of Txnip Expression byAdenosine‐containingMolecules 49  3.2.1.9Adenosine‐containingMoleculesFacilitateMondoA NuclearTranslocation 52 IV  3.2.1.10GlucoseIsRequiredfor the Induction of Txnip Expression byAdenosine‐containingMolecules 54  3.2.1.11GlucoseInduced Txnip Expression IsAmplifiedby Adenosine‐containingMolecules 56  3.2.1.12PotentialPlasmaMembraneTarget(s) of Adenosine‐ containingMolecules 57  3.2.1.12.1PurinergicReceptorsAreNotRequiredfor the Induction of Txnip Expression 59  3.2.1.12.2Adenosine‐containingMoleculesMayTarget AdenosineTransporters 59  3.2.1.13SignalingPathway(s)EvokedbyAdenosine‐containing MoleculesforRegulating Txnip Expression 62  3.2.1.13.1 The Induction of Txnip Expression Requires IntracellularCa 2+  62  3.2.1.13.2 The Induction of Txnip Expression DoesNot RequirecAMP 64  3.2.1.13.3 The Involvement of MAPKin the Induction of Txnip Expression 64  3.2.1.13.4Non‐involvement of AMPKin the Induction of Txnip Expression 66  3.2.1.14Adenosine‐containingMoleculesRepressThioredoxin ActivityandGlucoseTransport 67  3.2.1.15Adenosine‐containingMoleculesAffectCellCycle Progression 69  3.2.2Effects of GlucoseAnalogson Txnip Expression . 105  4.2.1.4BothChoREsareRequiredforOptimal Txnip Promoter Activity 108  4.2.1.5ChoREsAreNotSufficientfor the Induction of Txnip Expression 111  4.2.1.6TandemNF‐YBindingSitesAreRequiredfor the Induction of Txnip Expression 111  4.2.1.7NF‐YMediatedInduction of Txnip Expression bySAHA RequiresMondoA/MLX 114  4.2.1.8 Txnip PromoterRecruitsMondoA/MLXComplexinan NF‐YDependentManner 116  4.3 The Role of USFsin Txnip Expression