dissecting the components of a gene expression profile

IDENTIFICATION OF A MINIMAL CIS-ELEMENT AND COGNATE TRANS-FACTORS REQUIRED FOR THE REGULATION OF RAC2 GENE EXPRESSION DURING K562 CELL DIFFERENTIATION

IDENTIFICATION OF A MINIMAL CIS-ELEMENT AND COGNATE TRANS-FACTORS REQUIRED FOR THE REGULATION OF RAC2 GENE EXPRESSION DURING K562 CELL DIFFERENTIATION

... c-Fos and c-Jun (Clayton, Rose et al 2000) Protein phosphatase appears to be the histone H3 phosphatase and two kinases of the Aurora/AIK family, Aurora -A and Aurora-B, have been identified as the ... phosphate (NADPH) oxidase (Castro and Freeman 2001) The NADPH oxidases are a group of plasma membrane-associated enzymes that catalyze the production of reactive oxidants such as free radicals by the ... enzymatically inactive due to amino acid change at a potentially catalytic site (Pinarbasi, Elliott et al 1996) Human Dnmt2 does not catalyze methylation of DNA, but instead methylates a small RNA-...

Ngày tải lên: 24/08/2014, 12:22

144 242 0
List the components of a radio system

List the components of a radio system

... – Advantages • Can carry up to three times the amount of data as TDMA • Transmissions are much harder to eavesdrop on • A would-be eavesdropper must also know the exact chip in which the transmission ... data to be sent – Imprints a unique address on the data – The longer the code is, the more users will be able to share the same channel – Number of chips in the code • Determines the amount of ... Objectives • List the components of a radio system • Describe how different factors affect the design of a radio system • Explain the radio frequency spectrum Components of a Radio System • Components...

Ngày tải lên: 13/09/2012, 10:52

30 922 0
Blood on FTA™ Paper: Does Punch Location Affect the Quality of a Forensic DNA Profile?

Blood on FTA™ Paper: Does Punch Location Affect the Quality of a Forensic DNA Profile?

... partial amplifications, and one case of a discordant profile Profile quality for the majority of the samples showed a high incidence of stutter and the absence of non-template adenylation Of the ... prevent any further degradation In the case of database samples, a physical sample of the offender’s DNA must be kept in the laboratory indefinitely in case a database hit ever occurs and the sample ... in an otherwise normal sample The number of partial profiles was recorded and the percentage of total profiles at each punch location that contained any locus failures was recorded Peak characteristics...

Ngày tải lên: 24/08/2014, 12:30

169 383 0
The regulation of TXNIP gene expression

The regulation of TXNIP gene expression

... into the pdHA, pdMyc or pdFLAG vectors.  Dominant negative MLX was created as  described (Ma et al., 2005), and the RNAi‐resistant MondoA (MondoAr) was made by  25  Chapter 2  a PCR‐based approach.  A dominant negative USF  (A USF) construct was provided  ... CdR, a DNA demethylating agent; Ahsan et al., 2006) and SAHA  (a HDAC inhibitor;  Huang  and  Pardee,  2000;  Butler  et al.,  2002;  Ahsan  et al.,  2006;  Xu  et al.,  2006).  The stimulatory effect of SAHA on Txnip expression is mediated by an inverted CCAAT  ... Other than mechanisms mentioned above, the transcription can be regulated  at many other levels: by genes being located at a specific sub‐nuclear domain (Matera,  1999), at the transcription elongation level (Conaway, 2000) and at the transcription ...

Ngày tải lên: 14/09/2015, 14:09

198 126 0
Báo cáo y học: "The gene expression profile of preclinical autoimmune arthritis and its modulation by a tolerogenic disease-protective antigenic challeng" ppt

Báo cáo y học: "The gene expression profile of preclinical autoimmune arthritis and its modulation by a tolerogenic disease-protective antigenic challeng" ppt

... phase of AA The analysis of Bhsp65-induced gene expression profile of rats in the Inc phase of AA mostly reinforced the immune-based and inflammatory nature of AA Among the upregulated genes, ... significantly advance our understanding of the pathogenesis of autoimmune arthritis In particular, by revealing that the maximal changes in gene expression during the natural course of AA occur in the ... at the Inc phase of arthritis instead of the Pk phase of the disease In fact, most of the genes showed significantly reduced expression at the Pk and the Rec phase compared to the Inc phase As...

Ngày tải lên: 12/08/2014, 18:20

48 317 0
Báo cáo y học: "Deciphering the molecular machinery of stem cells: a look at the neoblast gene expression profile" pps

Báo cáo y học: "Deciphering the molecular machinery of stem cells: a look at the neoblast gene expression profile" pps

... an untreated planarian and (d) a planarian days after 30 Gy X-ray treatment Expression of the EST clone 32903884 (Sam68-like mammalian protein 1) in (e) an untreated planarian and (f) a planarian ... Taira M, Sanchez Alvarado A, Agata K: FGFRrelated gene nou-darake restricts brain tissues to the head region of planarians Nature 2002, 419:620-624 Ogawa K, Ishihara S, Saito Y, Mineta K, Nakazawa ... Intact planarians day after Gy X-ray exposure Test 5Gy3D Intact planarians day after Gy X-ray exposure Test 5Gy4D Intact planarians day after Gy X-ray exposure Test 5Gy5D Intact planarians day after...

Ngày tải lên: 14/08/2014, 20:22

17 310 0
A gene expression database for the molecular pharmacology of cancer pptx

A gene expression database for the molecular pharmacology of cancer pptx

... clinical decisions regarding L-asparaginase therapy as well as a closer look at the use of Lasparaginase therapy for solid tumours Discussion We have described the pharmacological implications of geneexpression ... schematic overview of database generation in relation to the NCI drug discovery program Each row of the activity database (A) represents the pattern of activity of a particular high-concentration ... boundary Each block of red or blue may represent a causal correlation, an epiphenomenal association or a statistical artefact Appropriate randomization studies can often rule out statistical artefact,...

Ngày tải lên: 30/03/2014, 13:20

9 484 0
Báo cáo khoa học: Molecular cloning and functional expression of a gene encoding an antiarrhythmia peptide derived from the scorpion toxin pptx

Báo cáo khoa học: Molecular cloning and functional expression of a gene encoding an antiarrhythmia peptide derived from the scorpion toxin pptx

... obtained was displayed an ORF of 258 bp encoding a polypeptide of 85 amino acids and termed BmKIM The 5¢ and 3¢ UTRs of BmKIM cDNA are 17 bp and 76 bp, respectively A single AATAAA polyadenylation ... rBmKIM The LD50 was about 0.8 mgÆkg)1 These data indicated that rBmKIM had toxicity to both mammals and insects, though the toxicity was at a lower level Assay of antiarrhythmia activity Table ... such as A (Ala) or D (Asp) Only AaHIT4 and BmKAS, a specific anti-insect toxin, also contained a Tyr residue at this position AaHIT4, the unique anti-insect toxin also has a toxic effect on mammals...

Ngày tải lên: 31/03/2014, 09:20

8 474 0
Báo cáo hóa học: " Changes in the gene expression profile of Arabidopsis thaliana after infection with Tobacco etch virus" potx

Báo cáo hóa học: " Changes in the gene expression profile of Arabidopsis thaliana after infection with Tobacco etch virus" potx

... metabolic pathways from gene expression data are the 119 A thaliana pathways available in the January 2008 release of KEGG database http://www.genome.jp/ Page of 11 (page number not for citation ... alterations in the gene expression profile of Arabidopsis thaliana Mol PlantMicrob Interact 2003, 16(8):681-688 Ishihara T, Sakurai N, Sekine KT, Hase S, Ikegami M, Shibata D, Takahashi H: Comparative ... hybridizations MAPA analyzed the microarray data and supervised microarray work JC, GR and AJ developed the algorithm and analyzed the overlap between GO categories and KEGG pathways SFE conceived and designed...

Ngày tải lên: 20/06/2014, 01:20

11 436 0
Báo cáo y học: "Insights in to the pathogenesis of axial spondyloarthropathy based on gene expression profiles" ppt

Báo cáo y học: "Insights in to the pathogenesis of axial spondyloarthropathy based on gene expression profiles" ppt

... subject characteristics Subject Data-set Gender Race Medications 19 F Caucasian Alphagan OP, Xalatan OP 20 F Caucasian _ 21 F Caucasian Atorvastatin, losartan, atenolol, aspirin, hydrochlorothiazide ... was defined as a 1.5-fold change with a q value less than 5% The q value is a Bayesian equivalent to the false discovery rate adjusted P value [9] Statistical analysis was performed at an array ... sulfasalazine, indomethacin M Caucasian 558 Ibuprofen F Caucasian 11383 Piroxicam, indomethacin 10 F Caucasian 7115 Rofecoxib 11 M Caucasian 255 Acetaminophen, ramipril, omeprazole, aspirin, atorvastatin...

Ngày tải lên: 09/08/2014, 14:22

9 333 0
Báo cáo y học: "Effects of typical and atypical antipsychotic drugs on gene expression profiles in the liver of schizophrenia subjects" docx

Báo cáo y học: "Effects of typical and atypical antipsychotic drugs on gene expression profiles in the liver of schizophrenia subjects" docx

... atypical AP treatment may increase levels of liver enzymes such as alanine aminotransfeaminotransferase (ALT), aspartate aminotransferase (AST), gamma-glutamyl transferase (GGT), and alkaline ... IL and JD acquisition of data, analysis and interpretation of data RY and MW interpretation of data, revisions of the manuscript Additional material Additional file Typical AP vs Ctrl A list of ... demographic and clinical variables Demographic variables such as age, gender, race and BMI are matched between the controls, the typical AP and the atypical AP group Both typical and atypical AP groups...

Ngày tải lên: 11/08/2014, 17:20

15 518 0
Báo cáo y học: " Effects of prostratin on Cyclin T1/P-TEFb function and the gene expression profile in primary resting CD4+ T cells" doc

Báo cáo y học: " Effects of prostratin on Cyclin T1/P-TEFb function and the gene expression profile in primary resting CD4+ T cells" doc

... GTGCTGCGGAGGCTGCTAG-3', DUSP4-R 5'-TGAAGACGAACTGCGAGGTGG-3', Cyclin T1 -A- F 5'-CACAACACGACCCAGACAATAGAC-3', Cyclin T1 -A- R 5'CCACCAGACCGAGGATTCAGATAG-3', Cyclin T1-B-F 5'GGCGTGGACCCAGATAAAG-3, Cyclin ... DEFA1-R 5'-AGGAGAATGGCAGCAAGGATGG-3', CD69-F 5'-ACACAGAGGTCAGCAGCATGG-3', CD69-R 5'ACCACAGAGCAGCATCCACTG-3', α-Tubulin-F 5'-CCTGACCACCCACACCACAC-3', α-Tubulin-R 5'-TCTGACTGATGAGGCGGTTGAG-3', DUSP4-F ... uncertain Adding flavopiridol at 10 nM also had variable effects on luciferase expression in the Tat- virus These data indicate that in the absence of Tat, prostratin has small and variable effects...

Ngày tải lên: 13/08/2014, 09:20

14 283 0
Báo cáo y học: "Evaluation of the effects of a VEGFR-2 inhibitor compound on alanine aminotransferase gene expression and enzymatic activity in the rat liver" pdf

Báo cáo y học: "Evaluation of the effects of a VEGFR-2 inhibitor compound on alanine aminotransferase gene expression and enzymatic activity in the rat liver" pdf

... Institutional compliance statement Animals were housed in facilities at Pfizer (La Jolla, CA, USA) that are approved by the American Association for the Accreditation of Laboratory Animal Care All protocols ... 5’TTCAAGCAGAGAGACAGGAG-3’ and 5’-TGAGGGAAGGAATACATGG-3.’ The primers for b-actin, used as a reference gene to normalize expression levels between samples, were: 5’- CTCACTGTCCACCTTCCAG-3’ and ... each amplification run to generate a standard curve off of which samples were quantified and expressed as a relative value Values were then normalized to the reference gene to generate gene expression...

Ngày tải lên: 13/08/2014, 13:20

7 340 0
Using biological networks and gene expression profiles for the analysis of diseases

Using biological networks and gene expression profiles for the analysis of diseases

... randomly selects a set of genes of the same size as the pathway being evaluated The p-value assigned for a pathway is the proportion of permutations that have aggregated scores higher than the score ... subnetwork generated are “star” shaped, and only provide a partial explanation to the disease, whereas diseases are usually caused by a cascade of genes whose upstream genes exert an effect on downstream ... perform PCA on the microarray data in independent datasets Samples are then plotted on the first three principle components The samples are separated based on batches rather than by their labels Figure...

Ngày tải lên: 09/09/2015, 10:15

147 703 0
Gene expression profile in the middle cerebral artery and frontal cortex of hypertensive rabbits

Gene expression profile in the middle cerebral artery and frontal cortex of hypertensive rabbits

... from the IPA library of canonical pathways that were most significant to the data set The significance of the association between the data set and the canonical pathway was measured in ways: 1) a ... microarray analysis and subjected to the Ingenuity Pathway Analysis where canonical pathways and a network of other genes related to our gene input were generated From the selection of our genes of ... used to calculate a p-value determining the probability that the association between the genes in the dataset and the canonical pathway is explained by chance alone 28 2.7 Real-Time PCR Real-time...

Ngày tải lên: 02/10/2015, 17:13

92 358 0
Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt

Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt

... gtgactgcag gaaggggatc cggctgctaa caaagcccga 280 281 aaggaagctg agttggctgc tgccaccgct gagcaataac 320 321 tagcataccc 361 TTTTTGCTGA cttggggcct AAGGAGGAAC ctaaacgggt TATATCCGGA cttgaggggt TATCCCGCAA ... taagacttttttacggcggcgctatcgctaacgggcccgcgc attctgaaaaaatgccgccgcgatagcgattgcccgggcgcg I L K K C R R D S D C P G A acgtaaacggcgccgttgccgataacgccgattgagctcggc tgcatttgccgcggcaacggctattgcggctaactcgagccg ... Gtttttgctt ggatcccagg ttgttgtaca gaatgctggt 120 121 catatgagcg gcagcgatgg cggcgtgtgc cgaaaattct 160 161 gaaaaaatgc cgccgcgata gcgattgccc gggcgcgtca 200 201 tttgccgcgg caacggctat tgcggctaac tcgagcccgg 240...

Ngày tải lên: 12/02/2014, 10:20

9 497 0
Tài liệu Báo cáo khoa học: Induction of uPA gene expression by the blockage of E-cadherin via Src- and Shc-dependent Erk signaling docx

Tài liệu Báo cáo khoa học: Induction of uPA gene expression by the blockage of E-cadherin via Src- and Shc-dependent Erk signaling docx

... induces uPA S Kleiner et al domain), 5¢-CUACUUGGUUCGGUACAUGGG-3¢ and 5¢-CAUGUACCGAACCAAGUAGGA-3¢; control siRNA 5¢-GUACCUGACUAGUCGCAGAAG-3¢ and 5¢-UCUG CGACUAGUCAGGUACGG-3¢ The specificities of these ... tumor growth and metastasis [1] Several analyses have already made it clear that the expression of E-cadherin and the expression of MMPs are inversely correlated [11,12] and that E-cadherindependent ... E-cadherin-blocking antibodies These signals are believed to regulate dynamic organization of the actin cytoskeleton and the activity of the cadherin ⁄ catenin apparatus to support stabilization...

Ngày tải lên: 19/02/2014, 05:20

14 599 0
Tài liệu Báo cáo Y học: Analyses of the CYP11B gene family in the guinea pig suggest the existence of a primordial CYP11B gene with aldosterone synthase activity docx

Tài liệu Báo cáo Y học: Analyses of the CYP11B gene family in the guinea pig suggest the existence of a primordial CYP11B gene with aldosterone synthase activity docx

... NotI and a SmaI site was ligated to both ends of the cDNA pool Using a combination of a primer complementary to the adapter (adapter primer: 5¢-CCATCCTAATACGACTCACTA TAGGGC-3¢) and a gene- specific ... results are however, in accordance with the results of Hasegawa et al [13] who questioned the paraphyly of the order rodentia using the same data as Graur In contrast, the distance matrix algorithms ... stimulate the expression of a putative aldosterone synthase as much as possible [18], repeated screening of the cDNA library did not result in the identification of any cDNA other than CYP11B1 (data...

Ngày tải lên: 22/02/2014, 07:20

9 671 0
Tài liệu Báo cáo Y học: Dissecting the effect of trifluoroethanol on ribonuclease A Subtle structural changes detected by nonspecific proteases ppt

Tài liệu Báo cáo Y học: Dissecting the effect of trifluoroethanol on ribonuclease A Subtle structural changes detected by nonspecific proteases ppt

... trifluoroethanol (Fig 5C) is caused by the drastically decreased rate of primary cleavage of RNase A (Fig 4), as discussed below As a consequence of the breakdown of the tertiary structure of RNase A in ... Fig was obtained by relating these values to the value determined for 0% trifluoroethanol Analytical ultracentrifugation Analytical ultracentrifugation was carried out on a Beckman Optima XL -A ultracentrifuge ... is the average of three independent measurements ± SD Proteinase K activity assay Proteinase K activity was determined at 25 °C with N-succinyl-Ala-Ala-Ala-p-nitroanilide as substrate [26] Assay...

Ngày tải lên: 22/02/2014, 07:20

7 492 0
Báo cáo khoa học: Oxygen control of nif gene expression in Klebsiella pneumoniae depends on NifL reduction at the cytoplasmic membrane by electrons derived from the reduced quinone pool doc

Báo cáo khoa học: Oxygen control of nif gene expression in Klebsiella pneumoniae depends on NifL reduction at the cytoplasmic membrane by electrons derived from the reduced quinone pool doc

... containing 25 mM potassium glutamate and used subsequently for biochemical analysis The amount of FAD cofactor of the NifL fractions was calculated using a UV/Visual spectrum at 450 nm and the ... b-galactosidase synthesis rate that is equivalent to 10% of the synthesis rate in the parental strain (NCM1528) However, the ndh mutation does not affect NifA activity in the absence of NifL (Table ... UN4495 (RAS18), the fdnG mutant strain of UN4495 (RAS48) and the nuoCD mutant strain of UN4495 (RAS47) carrying a chromosomal nifK¢¢lacZ fusion (A) Synthesis rates of b-galactosidase from the nifHDK...

Ngày tải lên: 17/03/2014, 10:20

12 489 0
w