Agents associated with colorectal cancer 1

CHAPTER INTRODUCTION Colorectal cancer is among the top three leading cancers worldwide, affecting close to a million individuals, with 500,000 of them dying from the disease annually [Stewart BW et al., 2003], and claiming more lives each year especially in the developed countries Every year, governments all over the world spend billions of dollars in research aiming for better screening, prevention and treatment of this disease Despite these intensive research efforts, its mortality rate has not declined much over the last 40 years [American Cancer Society, 2006] The five-year survival for colorectal cancer remains around 40% because of the late detection of disease From the statistics of the department that treats mainly symptomatic cases, at the time of diagnosis, more than half of the patients under review already have either distant metastasis to the lymph nodes or to other organs [Jemal A et al., 2004] Genetic predisposition, inappropriate diet, environmental factors and lack of reliable prognostic markers, are the reasons cited for the causes of colorectal cancer and its high mortality rate It is estimated that around 75% of patients suffered from spontaneous colorectal cancer that are caused by environmental factors [Winawer SJ et al., 1997] The intestinal microflora is suspected to have a role in the etiology of colon cancer However, until recently, the implication of bacteria involvement have usually been referred as their role in the initiation of colon cancer through production of carcinogenes, cocarcinogenes, or procarcinogens, for example, the harmful free radicals and metabolites generated by the breakdown of ingested foods by intestinal microflora [Drasar BS et al.,1974; Hill MJ, 1975;Julie P, 1995; Huycke MM and Gaskins HR, 2004; McGarr SE et al., 2005; Jason M et al., 2006] More evidences now indicate that commensal bacteria and their products may trigger or exacerbate chronic idiopathic intestinal inflammatory diseases, such as Crohn's disease [Sartor RB, 1994 and 2000; Darfeuille MA et al., 1998 and 2004; Seksik P et al., 2006 ] For instance, in rodent models, colitis, whether spontaneous or chemically induced, is significantly less severe if the animals are raised in germfree conditions [Garcia-Lafuente A et al., 1997] The role of bacteria in the development of colorectal cancer is also illustrated by the development of dsyplasia and cancer in 70% of the conventional mice with TCRβ/p53 double knockout while none in mice raised under germ-free housing condition [Kado S et al., 2001] Despite all these studies the direct effect of bacteria on human cells causing tumorigenesis has not been well documented Our laboratory has found that tumors dissected from colon cancer patients are enriched, relative to normal mucosa of normal subjects, in sequences found in E.coli and Shigella species We believe that there are situations where the normal gut flora, apart from carrying out its normal metabolic activity, can be exposed to very high levels of a substrate, resulting in toxic levels of carcinogens and are associated with cancers In addition, bacteria that are present in the lumen when under the right conditions may also play a part in causing cancer in the colon and rectum Their effects can be through persistent presence of the bacteria occupying receptor sites involved in cellular growth, bacteria disrupting cell to cell interaction or uptake of the bacteria and its genetic material It is therefore possible that the combination of inappropriate diet (e.g mutagens that can be activated by bacterial enzymes), the host genetic makeup (e.g susceptibility resulting from inactivation of tumor suppressor genes), colonization of pathogenic strains of bacteria, and inappropriate host response to pathogens, can, with time, provide the right environment for the selection and growth of tumorigenic cells The human large intestine that is constantly bathed in bacteria is subjected to exposure to both good and pathogenic bacteria About 1014 bacterial cells are known to be present in the colon of any given individual, consisting of hundreds of species But, to date, there is still no unanimous agreement on which specific strains or species of bacteria are able to cause such a transformation either in rodents or in humans The difficulty in reaching a consensus opinion lies with the inability to pinpoint a bacteria culprit among the ever evolving complex composition of the luminal microflora of the host This thesis provides data to support a role by bacteria, especially E.coli, in the pathogenesis of gastrointestinal carcinogenesis The evidence hinged on the ability to be able to specifically identify the bacteria in infected tissue of individuals with gastrointestinal cancer, which are not present in tissues of normal healthy individuals This thesis aims to identify a segment of DNA sequence that is unique to E.coli and Shigella species as the DNA marker sequence for specific detection of the bacteria in various stages of colorectal cancer This is very crucial for the study as only a specific E.coli DNA probe sequence devoid of sequences having homology with other bacteria can be used to study the role of E.coli in colorectal cancer to detect the presence of E.coli in the normal, pre-, malignant, and metastatic colon cancer cells Sequences within the E.coli genome, having homology with other bacteria will reduce the discriminatory power of this methodology This is followed by the isolation of the bacterial strains of interest and identification of the bacterial determinants that can be associated with or contribute to the development of colorectal cancer Characterization of the isolated bacteria is carried out to help understand their roles if any in carcinogenesis Also Included in the thesis is a study on the prevalence of the aforementioned bacteria in the fecal matter of volunteers over time so that one is able to assess the risk the general population is exposed to This is followed by an association study of the unique DNA sequences for E.coli and its bacterial determinants to colorectal cancer by determining the prevalence of these DNA markers in the various transition stages of colorectal cancer Colorectal cancer is a disease with a very obvious step-wise progression from normal through pre-malignant (polyps), malignant (cancer) and finally a metastatic stage This natural history of colorectal cancer offers multiple opportunities for assessment and intervention of the disease We hope that by identifying the etiological agents or the agents associated with the cause of the cancer, we may reduce the number of incidents and delay the onset of the disease with appropriate chemo preventive interventions CHAPTER LITERATURE SURVEY 2.1 Colorectal Cancer The colon is a highly specialized organ that is responsible for processing waste and the re-absorption of water and electrolytes/minerals into our body The rectum is the inches chamber that connects the colon to the anus It is responsible to hold the processed waste, or feces, until it is eliminated Colorectal cancer is referred to cancers that affect either of these organs Colorectal cancer occurs when the cells that line the colon or the rectum become abnormal and grow out of control It is a disease with a very obvious step-wise progression from normal through pre-malignant to localized malignant and finally a metastatic stage All three transitions have profound therapeutic and prognostic significance Benign tumors (pre-malignant stage) of the large intestine are called polyps which may be hyperplastic (nondysplastic) or dysplastic (adenomatous) Hyperplastic polyps consist of large number of cells with normal morphology that not have a tendency to become malignant On the other hand, adenomatous polyps (adenomas) contain dysplastic cells that fail to show normal intracellular and intercellular organisation Expanding adenomas can become progressively more dysplastic and may eventually become cancer cells This concept of the adenoma-carcinoma sequence was proposed by Morson in 1970 [Morson BC, 1970] It was later supported by data from the National Polyp Study [Winawer SJ et al.,1993] and by discoveries in molecular genetics [Fearson ER et al., 1990] It states that a malignant colonic tumor almost always arises in a pre-existing benign adenomas All colorectal adenomas are therefore potential precursors of cancer Cancer cells (malignant stage) can also invade and damage adjacent tissues and organs In such cases, cancer cells can break away and spread to other parts of the body (such as liver and lung) where new tumors form The spread of colon cancer to distant organs is called metastasis of the colon cancer Once metastasis has occurred in colorectal cancer, a complete cure of the cancer is unlikely Unfortunately colorectal cancer often strikes without symptoms until the later stages In general, colorectal cancer diagnosed at the early stages that are confined to the mucosa can usually be cured by surgical or colonoscopic excision with a 90% survival rate whereas patients with advanced disease have a poor prognosis and the mortality can increase to more than 90% with metastasis An early detection of the disease will definitely help in better management of this disease and better survival rate for the patients [Ries L et al., 2007] 2.1.1 Epidemiology and incidence rates Colorectal cancers are less prevalent in developing countries, but are the second most frequent malignancy in affluent societies Worldwide, there is close to a million incidences with 500,000 of them dying from the disease annually [Stewart BW et al., 2003] In Singapore, the incidence of colorectal cancer has been steadily increasing in both males and females over the last 30 years from 1067 (1968-1972) and 2857 (1983-1987) to 4324 (1993-1997) and 6101 (1998-2002) It is now the most common cancer among Singaporean residents with more than a thousand new cases diagnosed annually over the last few years [Seow A et al., 2004] Crude incidence rates show large variations among countries The variations can range from 0.6 to new cases (per 100,000) per year in several areas in the Third World (such as Senegal, Mexico and India) to 50-70 new cases (per 100,000) in North America, Western Europe, Australia and New Zealand [Stewart BW, 2003] Colorectal cancer is one of the most common cancers in Singapore which affects approximately 45 out of every 100,000 people Among the races in Singapore, the Chinese has a disproportionately higher incidence of the disease [Seow A et al., 2004] 2.1.2 Etiology and Risk Factors The majority of people who develop colorectal cancer have no known risk factors About 75% of patients with colorectal cancer are sporadic, with no apparent evidence of having inherited the disorder The remaining 25% of patients have a family history of colorectal cancer that suggests a genetic contribution or exposures to common environment among family members, or a combination of both Other undiscovered major genes and background genetic factors may also contribute to the development of colorectal cancer, in conjunction with non genetic risk factors such as the environment factors [Winawer SJ et al., 1997] Although the exact cause of colorectal cancer is not known, there are some factors that increase a person's risk of developing the disease They include: 2.1.2.1 Polyps There are different kinds of polyps, some that are likely to become cancer and some that rarely The polyps that are generally thought to be less likely to be precursors for cancer include hyperplastic, juvenile, inflammatory, and lymphoid polyps [Vainio H et al., 1994] Recently there is increasing evidence that some hyperplastic polyps may harbour genetic changes that may be preneoplastic changes [Subramony C et al., 1994; Leggett BA et al., 2001] Nevertheless, certain kinds called the adenomas are generally thought to have the potential to become cancerous If adenomas are not removed, they can become malignant (cancerous) over time [Huff J, 1998] Epidemiologic studies have shown that a personal history of colon adenoma places one at increased risk of developing colon cancer [Neugut AI et al., 1993 and 1995] When patients with adenomas are followed for 20 years, the risk of cancer at the site of the adenoma is 25%, a rate much higher than that expected in the normal population [Winawer SJ et al., 1997] In addition, removal of adenoma is associated with reduced colorectal cancer incidence [Müller AD et al., 1995] Adenomas are generally classified into three histological types with increasing malignant potential: tubular, tubulovillous, and villous Another factor that increases the likelihood of a polyp becoming cancerous is its size The larger a polyp grows, the more likely it is to become cancerous Although these evidences suggest that adenomas of the large bowel may become cancerous, and in this respect adenomatous polyps can be viewed as the single most important factor predisposing to colorectal cancer, this does not mean that all adenomatous polyps undergo malignant changes, neither does it exclude the possibility of “de novo” (i.e from normal mucosa) colorectal tumorigenesis [Owen DA, 1996] 2.1.2.2 Age The risk of developing colorectal cancer increases with age The disease is more common in people over 50 years of age, and the chance of getting colorectal cancer increases with each decade However, colorectal cancer has also been known to develop in younger people [Stewart BW, 2003] 10 Table 3.1 Primer Code ECM-246 ECM-850 ECM-1163 ECM-1958 torT-5129 torT-5750 torC-7218 torC-7761 torA-8332 torA-8891 torD-10574 torD-11160 CD-415 CD-1351 agp-3151 agp-4359 Wrb-4807 Wrb-5235 ycdG-6073 ycdG-7359 81B-7223 81B-7278 81B-7754 81B-7794 OH-7419 OH-7985 New1-8160 New1-9704 New2-9731 New2-503 putP-5944 putP-6693 Oligonucleotide primers of Formula sequence Map Position Sequence 5’- 3’ Gene AE000201 246-266 AE000201 850-830 AE000201 1143-1163 AE000201 1958-1938 AE000201 5129-5148 AE000201 5750-5731 AE000201 7218-7242 AE000201 7761-7737 AE000201 8332-8356 AE000201 8891-8867 AE000201 10574-10593 AE000201 11160-11141 AE000202 415-436 AE000202 1351-1329 AE000202 3151-3172 AE000202 4359-4336 AE000202 4807-4836 AE000202 5235-5206 AE000202 6073-6094 AE000202 7359-7340 AE000202 7223-7240 AE000202 7278-7297 AE000202 7773-7754 AE000202 7794-7774 AE000202 7419-7436 AE000202 7985-7966 AE000202 8160-8179 AE000202 9704-9684 AE000202 9731-9749 AE000203 503-484 AE000203 5944 - 5963 AE000203 6693-6674 atgactggtttagtaaaatgg tcaatattcactgttaacctc cattgcgtaaccaatcaccgc gcaagtagcacgacatttgtc ggtgcaagcctctacgccgc tgccgcctctgccgcaatgg aacttgccgagcgtgaatgggcgcg gtggcctgcaacttgctccactcgg tatccgatggtacgcgtggactggc gcaatgtgcttcacatgctcgcgcc gaccacgctgacagcacaac ggtggtcgcactccactaac gctttcccccaatctttacgtg gatttacgcgagataacgctatg cgctaatcgccgcagctgtggc cgctatcaaacttatccatcgggc tgtgaaacgtcaaataattcctgcgctgcg catgtacggacatattgaaacgatggcacg ctcctgatgaacaacttctggc tcgacctctacagagagcgg ggatccagccccatcaga cgtgttgaacgcccattact gcccacattactggtgtgcc ctgcagtgtgaccgatacgcc acaagcagggcgcatcag atagcagcaagctttatgcg cggcaagttgtgggctggag cgtaattattcccgctggcag gcgatatgagcaaaggacg gcatctccatacagaacagg ctgggttacttcgggcagcc cggagccgaatgatagtgcg cspG sfa yccM yccM torT torT torC torC torA torA torD torD cbpA cbpA agp agp wrbA wrbA ycdG ycdG ycdG ycdG b1007 b1007 b1007 b1008 b1008 b1010 b1011 ycdc putP putP 49 Table 3.2a Bacteria source used in our laboratory Bacterial genus Escherichia coli (E.coli) Escherichia (non-coli) Shigella Edwardsiella Salmonella Citrobacter Klebsiella Enterobacter Hafnia Serratia Proteus Morganella Providencia Yersinia Cedecea Aeromonas Enterobacter Pseudomonas Helicobacter Human Salmon Bacteria species 078:H11 078:K80:H12 0157:H7 029:NM 0111 0142:K86(B) TG2* K12 E hermannii E vulneris E blattae S flexneri (serotype 2A) S sonnei S boydii (serotype 2) E tarda (01433:H1) S choleraesuis C freundii K pneumoniae (Ozaenae type4) E cloacae H alvei S marcescens P vulgaris M morganii P alcalifaciens Y.enterocolitica C lapagei A jandanei E agglomerans P aeruginosa H pylori Placental DNA Salmon sperm DNA Source ATCC 35401 ATCC 43896 ATCC 43895 ATCC 43892 ATCC 33780 ATCC 23985 gift ATCC 29947 ATCC 33650 ATCC 33821 ATCC 29907 ATCC 29903 ATCC 29930 ATCC 8700 ATCC 15947 ATCC 43971 ATCC 8090 ATCC 11296 ATCC 13047 ATCC 13337 ATCC 13880 ATCC 13315 ATCC 49948 ATCC 9886 ATCC 29913 ATCC 33432 ATCC 49568 field isolates field isolates field isolates Sigma (UK) Sigma (UK) * TG2: Gibson TJ: Studies on the Epstein-Bar-Virus Genome Ph.D Thesis 1984 Cambridge University, UK 50 Table 3.2b Panel of 61 non- E.coli strains tested in the E.coli reference center in US Serial no 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 Culture name Aerococcus viridans Bacillus cereus-1 Bacillus cereus-2 Citrobacter freundii-1 Citrobacter freundii-2 Enterobacter aerogenes Enterobacter cloacae-1 Enterobacter cloacae-2 Enterobacter cloacae-3 Enterococcus durans Enterococcus faecalis-1 Enterococcus faecalis-2 Enterococcus faecium Enterococcus saccharolyticus Hafnia alvei Klebsiella oxytoca Klebsiella pneumoniae-1 Klebsiella pneumoniae-2 Klebsiella pneumaoniae subsp Pneumoniae Listeria monocytogenes-1 Listeria monocytogenes-2 Pasturella haemolytica Proteus vulgaris Pseudomonas aeruginosa-1 Pseudomonas aeruginosa-2 Salmonella anatum Salmonella choleraesuis subsp choleraesuis Salmonella enteriditis-1 Salmonella enteriditis-2 Salmonella enteriditis-3 Salmonella enteriditis-4 Salmonella typhimurium-1 Salmonella typhimurium-2 Serratia marcescens-1 Serratia marcescens-2 Shigella boydii Shigella flexneri Shigella sonnei 51 Table 3.2b Panel of 61 non- E.coli strains tested in the E.coli reference center in US – Continued Serial no 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 Culture name Staphylococcus aureus-1 Staphylococcus aureus-2 Staphylococcus aureus subsp aureus-1 Staphylococcus aureus subsp aureus-2 Staphylococcus chromogenes Staphylococcus cohnii subsp cohnii Staphylococcus epidermidis-1 Staphylococcus epidermidis-2 Staphylococcus hominis subsp hominis Staphylococcus simulans Staphylococcus warneri Staphylococcus xylosus Streptococcus sp (Group C) Streptococcus sp (Group C, type 7) Streptococcus sp (Group B, type 1c) Streptococcus agalactiae Streptococcus bovis Streptococcus dysgalactiae Streptococcus faecalis Streptococcus parauberis Streptococcus pyogenes Streptococcus salivarius Yersinia enterocolitis 52 Table 3.2c Panel of 110 E.coli strains tested in the E.coli reference center in US Serial no 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 Reference no 89.0511 90.0039 90.0042 91.0774 91.1576 91.1739 92.0911 93.0503 93.0509 93.0525 93.0577 93.0581 93.0602 93.0601 93.0606 93.1099 94.0618 94.0641 94.0738 95.0022 95.0071 95.0089 95.0105 95.011 95.0112 95.0113 95.0114 95.0122 95.031 95.0311 O type 157 157 157 157 134 Unknown Unknown Unknown 26 111 26 15 85 12 23 111 157 33 50 51 111 Unknown Unknown Unknown 17 111 Unknown Unknown 31 32 33 34 35 36 37 38 95.0313 95.0372 95.0773 95.0778 95.0793 95.0941 95.0943 95.1144 Unknown 82 18 45 157 26 Source Toxin/Fimbrial profile SLT I, SLT II Human SLT I, SLT II Bovine SLT I, SLT II Food (Pork) SLT I Bovine SLT I, SLT II Human SLT I, SLT II, K99 Bovine Sta, STb, SLT I, SLT II Porcine EAE Human SLT I, EAE Human SLT I, EAE Human EAE Human EAE Human SLT I, EAE Human EAE Human EAE Human SLT I Bovine SLT I, SLT II, EAE Food SLT I Bovine SLT I, CS31A Bovine SLT I, CS31A Bovine Porcine SLT I, SLT II, STb, 987P SLT I, EAE Bovine EAE Human SLT I, EAE Bovine SLT I, EAE Food EAE Food SLT I Bovine SLT I, SLT II, EAE Bovine STb, EAE Bovine SLT I, SLT II, EAE Bovine SLT I, SLT II, EAE, F1845 Bovine SLT I, SLT II Food EAE Bovine EAE Bovine EAE Bovine SLT I, Sta, STb, EAE Human SLT I, SLT II, EAE Human LT, EAE Bovine 53 Table 3.2c Panel of 110 E.coli strains tested in the E.coli reference center in US - Continued Serial no 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 Reference no 95.1165 95.4078 95.408 96.0088 96.0109 96.0339 96.0497 96.0502 96.0526 96.0582 96.0616 96.0865 96.0876 96.0898 96.1078 96.1103 96.1142 96.1156 96.1464 96.1488 96.1532 96.1536 96.1683 96.1892 96.1898 97.0014 95.037 97.0135 97.017 97.0171 97.0202 97.0261 98.236 97.0481 97.0912 97.0916 97.0998 97.1055 O type Unknown 103 Unknown 157 15 91 88 Unknown Unknown 139 76 75 Unknown 27 Unknown 84 25 21 103 50 22 106 8 111 Unknown 86 88 166 112 Unknown Source Toxin/Fimbrial profile LT, EAE Human SLT I, EAE Unknown SLT I Human Sta, EAE, F107 Bovine SLT I, EAE Human SLT I Bovine SLT I Human SLT I, SLT II Bovine Sta, SLT I, K99 Bovine Sta, STb, EAE, F107 Porcine SLT I, SLT II Human SLT I Klipspringer SLT I, K99 Gazelle, SLT I Antelope, EAE Bovine EAE, F1845 Bovine SLT I Bovine SLT I, EAE Porcine EAE Human SLT I, EAE Human SLT I, SLT II Human SLT I Human EAE Bovine SLT I Food SLT I, SLT II Food SLT I Bovine SLT I, SLT II Food Sta, SLT I, SLT II, EAE Bovine CNF Bovine CNF 2, EAE Bovine SLT I, SLT II, EAE Bovine CNF Bovine EAE, K88 Porcine CNF Bovine SLT I, SLT II Bovine CNF 1, CS31A Bovine CNF 1, CS31A Porcine CNF Mink 54 Table 3.2c Panel of 110 E.coli strains tested in the E.coli reference center in US - Continued Serial no Reference no O type Source 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 97.1105 97.1146 97.1167 97.1365 97.1476 97.2061 97.2052 98.044 97.1633 97.207 97.2071 98.0123 98.0138 98.0251 98.0357 93.0606 98.0471 98.0537 98.1595 98.1599 98.0764 98.0764 98.0555 98.2447 98.2441 98.2432 98.2277 98.1664 98.186 98.1661 98.1608 98.16 98.1567 control 166 13 10 78 Unknown 19 17 11 115 Unknown 153 25 20 Unknown 114 Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown 75 Unknown control Bovine Raccoon Deer Bovine Bovine Bovine Porcine Bovine Canine Bovine Bovine Bovine Porcine Bovine Bovine Bovine Bovine Bovine Porcine Porcine Bovine Elk Porcine Bovine Bovine Bovine Porcine Canine Porcine Canine Porcine Porcine Primate Toxin/Fimbrial profile CNF 1, K99, F1845, CS31A CNF CNF EAE EAE CNF Sta, EAE EAE CNF 1, K99 EAE, K99 EAE, K99, CS31A EAE, K99, CS31A CNF CNF 1, CS31A CNF EAE EAE EAE EAE LT, CNF LT, CNF CNF Sta, STb, EAE CNF 1, K99, CS31A Sta, CNF CNF 1, EAE STb, EAE, K88 Sta, EAE LT, STb, CNF 2, K88 EAE CNF LT, CNF 1, K99 EAE ATCC43895 55 Table 3.3 Grid A lists the different types of bacteria genomic DNA (500 ng each) loaded in a dot blot format Placenta Helicobacter pylori Aeromonas jandanei Citrobacter Freundii Cedecea Lapagei Enterobacter cloacae Escherichia hermannii Edwardsiella tarda Escherichia vulneris Hafnia alvei Klebsiella pneumoniae Morganella morganii Proteus vulgaris Providencia alcalifaciens Pseudomonas aeruginosa Shigella boydii Salmonella choleraesuis Shigella flexneri Serratia marcescens Shigella sonnei Yersinia enterocolitica Escherichia blattae Enterobacter agglomerans Shigella sonnei 219/1 * E.coli TG2 E.coli K12 E.coli 078:H11 sssDNA * Bacteria isolated from clinical specimen 56 Table 3.4 Grid B lists the different types of bacteria genomic DNA (500 ng each) loaded in a dot blot format Placental Helicobacter pylori Aeromonas Jandanei Citrobacter freundii Cedecea lapagei Enterobacter cloacae Escherichia hermannii Edwardsiella tarda Escherichia vulneris Hafnia alvei Klebsiella pneumoniae Morganella morganii Proteus vulgaris Providencia alcalifaciens Pseudomonas aeruginosa Shigella boydii Salmonella choleraesuis Shigella flexneri E.coli 078:H11 142 / 31* Serratia marcescens Shigella sonnei E.coli K12 E.coli TG2 179 / 36* Yersinia enterocolitica Escherichia blattae Enterobacter agglomerans 219/1 * Shigella sonnei 197 / 5* 117 /3B* sssDNA * Clinical isolates except for 219/1 are E.coli 57 Table 3.5 Grid C lists the range of different amount of Enterobacter cloacae and E.coli K12 DNA loaded in a dot blot format Enterobacter Cloacae (ng) E.coli K12 (ng) E.coli K12 (ng) 1 2 5 10 10 20 20 50 50 100 100 58 Table 3.6 Grid D lists the DNA of E.coli and gram positive bacteria isolated from patient’s specimen in a dot blot format A B C D E F Placental 139/6 158/20 174/TM5 206/13 114/TB 142/31 158/37 179/36 218/40 Helicobacter pylori 114/3G* 117/3B 145/34 159/TM17 193/6 224/1 115/TA* 119/1TM1 145/40 162/20 196/1 231/1 116/TC* 129/20 152/W2-35 164/1 196/28 236/4 116/TD* 135/35 154/1 168/4 197/5 240/28 117/2D* 130/22 154/9* 168/38 205/T18 252/22 O157:H7 136/36 156/TM22 172/33 205/T34 K12 Staphylococcus * Clinical isolates that are tested gram-positive 59 Figure 3.1 Autoradiograph of radiolabeled gene probe hybridized to bacterial DNA as listed in Table 3.3 The gene sequence spans between nucleotide positions 7223 to 7794 of AE000202 81B-7223 and 81B-7794 were the primers used to generate the gene probe by PCR amplification of K12 E.coli genomic DNA Five hundred nanogram DNA was loaded per dot Posthybridization wash condition was 1XSSC, 0.1% w/v SDS, 20mM Na pyrophosphate at 65oC 60 Figure 3.2 Autoradiograph of radiolabeled gene probe hybridized to bacteria DNA as listed in Table 3.4 grid B The gene sequence spans between nucleotide positions 7278 to 7773 of AE000202 81B-7278 and 81B-7754 were the primers used to generate the gene probe by PCR amplification of K12 E.coli genomic DNA Five hundred nanogram DNA was loaded per dot Post-hybridization wash condition was 1XSSC, 0.1% w/v SDS, 20 mM Na pyrophosphate at 65oC 61 Figure 3.3 Autoradiograph of radiolabeled gene probe hybridized to Enterobacter cloacae and K12 E coli genomic DNA as depicted in Table 3.5 grid C The gene sequence spans between nucleotide positions 7223 to 7794 of AE000202 81B-7223 and 81B-7794 were the primers used to generate the gene probe by PCR amplification of K12 E.coli genomic DNA Post-hybridization wash condition was 1XSSC, 0.1% w/v SDS, 20 mM Na pyrophosphate at 65oC 62 Figure 3.4 Autoradiograph of radiolabeled gene probe hybridized to bacteria DNA as listed in Table 3.6 grid D The gene sequence spans between nucleotide positions 7278 to 7773 of AE000202 81B-7278 and 81B-7754 were the primers used to generate the gene probe by PCR amplification of K12 E coli genomic DNA Five hundred nanogram DNA was loaded per dot Post-hybridization wash condition was 1XSSC, 0.1% w/v SDS, 20 mM Na pyrophosphate at 65oC 63 ... AE0002 01 246-266 AE0002 01 850-830 AE0002 01 114 3 -11 63 AE0002 01 1958 -19 38 AE0002 01 512 9- 514 8 AE0002 01 5750-57 31 AE0002 01 7 218 -7242 AE0002 01 77 61- 7737 AE0002 01 8332-8356 AE0002 01 88 91- 8867 AE0002 01 10574 -10 593... host cells 48 Table 3 .1 Primer Code ECM-246 ECM-850 ECM -11 63 ECM -19 58 torT- 512 9 torT-5750 torC-7 218 torC-77 61 torA-8332 torA-88 91 torD -10 574 torD -11 160 CD- 415 CD -13 51 agp- 315 1 agp-4359 Wrb-4807... 77 61- 7737 AE0002 01 8332-8356 AE0002 01 88 91- 8867 AE0002 01 10574 -10 593 AE0002 01 111 60 -11 1 41 AE000202 415 -436 AE000202 13 51- 1329 AE000202 315 1- 317 2 AE000202 4359-4336 AE000202 4807-4836 AE000202 5235-5206