Tài liệu hạn chế xem trước, để xem đầy đủ mời bạn chọn Tải xuống
1
/ 27 trang
THÔNG TIN TÀI LIỆU
Nội dung
Table 4.1 Primer sequences of 81B, HRA1, Tia, CNF1 and human beta globin genes Genes 81B (AE000202) Outer primers 81B- 7223 81B- 7794 Inner Primers 81B- 7278 81B- 7754 HRA1(U07174) Outer primers Rara- 32 Rara- 823 Inner primers Rara- 329 Rara- 720 Tia (U20318) Outer primers Inv- 111 Inv- 687 Inner primers Inv- 256 Inv- 646 CNF1 (X70670) Outer primers CNF1- 1091 CNF1- 2258 Inner primers CNF1- 1587 CNF1- 2130 Human beta globin (L26464) Outer primers HB-783 HB-2294 Inner primers HB-783 HB-1292 DNA sequences from 5’ 3’ ggatccagccccatcagaatc ctgcagtgtgaccgatacgc cgtgttgaacgcccattactg gcccacattactggtgtgcc atgagcaaccccatttatcgttcgg gaagttataagtcacaccaagcatg agtattccggttcgtacggaactgg gcatcaagatagcgatagctgagg agccggtgcttcagttgtgatgc cccttctgtatccttgtaagacagggagg aatgttccagtacgcacggaagtgg ccagatagcgatagctgaggtcaagagc actgacactcactcaagc aatattgacatgctgccc gaacttattaaggatagt cattatttataacgctg gcataaaagtcagggcagagc cgagcttagtgatacttgtgg gcataaaagtcagggcagagc cacgtgcagcttgtcacagtg 98 Table 4.2 Primer sequences of b1007/b1008 and ycdG/b1007 genes. Genes b1007/b1008 gene (OH) Outer primers OH- 7419 OH- 7985 Inner Primers OH- 7562 81B- 7794 ycdG/b1007 gene (81B) Outer primers 81B- 7223 81B- 7794 Inner Primers 81B- 7278 81B- 7754 DNA sequences from 5’ 3’ ggatccagccccatcagaatc atagcagcaagctttatgcg acgaaaccagagcctcttccagttgcggg ctgcagtgtgaccgatacgc ggatccagccccatcagaatc ctgcagtgtgaccgatacgc cgtgttgaacgcccattactg gcccacattactggtgtgcc 99 Table 4.3 Source of DNA used in Mimic in vitro simulation of PCR-ISH Bacterial genus Bacteria species Escherichia (E.coli) 078:H11 ATCC 35401 TG2* K12 142/31 gift ATCC 29947 Patient’s isolates 179/36 Patient’s isolates 197/5 Patient’s isolates Escherichia (non-coli) Shigella Source E. hermannii ATCC 33650 E. vulneris E. blattae ATCC 33821 ATCC 29907 S. flexneri (serotype 2A) S. sonnei S. sonnei (219/1) S. boydii (serotype 2) ATCC 29903 ATCC 29930 Patient’s isolates ATCC 8700 Edwardsiella E. tarda (01433:H1) ATCC 15947 Salmonella S. choleraesuis ATCC 43971 Citrobacter C. freundii ATCC 8090 Klebsiella K. pneumoniae (Ozaenae type4) ATCC 11296 Enterobacter E. cloacae ATCC 13047 Hafnia H. alvei ATCC 13337 Proteus P. vulgaris ATCC 13315 Morganella M. morganii ATCC 49948 100 Table 4.3 Source of DNA used in Mimic in vitro simulation of PCR-ISH (Continued) Bacterial genus Bacteria species Source Providencia P. alcalifaciens ATCC 9886 Yersinia Y.enterocolitica ATCC 29913 Cedecea C. lapagei ATCC 33432 Aeromonas A. jandanei ATCC 49568 Enterobacter E. agglomerans Patient’s isolates Pseudomonas P. aeruginosa Patient’s isolates Helicobacter H. pylori Patient’s isolates Human Placental DNA Sigma (UK) Salmon Salmon sperm DNA Sigma (UK) * TG2: Gibson TJ: Studies on the Epstein-Bar-Virus Genome. Ph.D Thesis 1984. Cambridge University, UK. 101 Table 4.4 Results of Mimic in vitro simulation of PCR-ISH Bacterial genus Bacterial species Escherichia (E.coli) 078:H11 b1007 / b1008 genes Outer Inner primers primers PCR Hybridization results results + + ycdG / b1007 genes Outer Inner primers primers PCR Hybridization results results + + TG2 K12 142/31 + + + + + + + + + + + + 179/36 + + + + 197/5 + + + + Escherichia (non-coli) E. hermannii E. vulneris E. blattae + - - - - Shigella S. flexneri (serotype 2A) S. sonnei S.sonnei: 219/1 S. boydii (serotype 2) + + + + + + - + + - + + - + + - Edwardsiella E. tarda (01433:H1) - - - - Salmonella S. choleraesuis + - - - Citrobacter C. freundii - - - - Klebsiella K. pneumoniae (Ozaenae type4) - - - - Enterobacter E. cloacae - - - - Hafnia H. alvei - - - - 102 Table 4.4 Results of Mimic in vitro simulation of PCR-ISH (continued) Bacterial genus Bacterial species Proteus P. vulgaris Morganella M. morganii - - - - Providencia P. alcalifaciens + - - - Yersinia Y.enterocolitica - - - - Cedecea C. lapagei + - - - Aeromonas A. jandanei - - - - Enterobacter E. agglomerans - - - - Pseudomonas P. aeruginosa - - - - Helicobacter H. pylori - - - - Human Placental DNA - - - - Salmon Salmon sperm DNA - - - - b1007 / b1008 genes Outer Inner primers primers PCR Hybridization results results - ycdG / b1007 genes Outer Inner primers primers PCR Hybridization results results - 103 Table 4.5 Colony hybridization results of samples from normal subjects Fecal (First time point) Rectal 41 41 81B positive 36/41 (87.8%) 38/41 (92.7%) HRA1 positive* 6/36 (16.7%) 3/38 (7.9%) CNF1 positive* 3/36 (8.3%) 1/38 (2.6%) Tia positive* 4/36 (11.1%) 6/38 (15.8%) 0/36 (0%) 0/38(0%) 10/36 (27.8%) 9/38 (23.7%) 3/36 (8.3%) 1/38 (2.6%%) Total No. of samples HRA1 and Tia positive* HRA1 or Tia positive* HRA1 and CNF1 positive* * Percentage calculated based on the number of respective determinants, namely HRA1, CNF1 and Tia, which tested positive with 81B probes. 104 Table 4.6 Colony hybridization results of samples from cancer subjects Fecal Tumour Distal 41 41 41 81B positive 36/41 (87.8%) 26/41(63.4%) 26/41 (63.4%) HRA1 positive* 11/36 (30.6%) 5/26 (19.2%) 9/26 (34.6%) CNF1 positive* 5/36(13.9%) 3/26(11.5%) 3/26 (11.5%) Tia positive* 8/36 (22.2%) 6/26 (23.1%) 8/26 (30.8%) HRA1 and Tia positive* 3/36 (8.3%) 0/26 (0%) 5/26 (19.2%) HRA1 or Tia positive* 15/36 (41.7%) 11/26 (42.3%) 12/26 (46.2%) HRA1 and CNF1 positive* 5/36 (13.9%) 3/26 (11.5%) 3/26 (11.5%) Total No. of samples * Percentage calculated based on the number of respective determinants, namely HRA1, CNF1 and Tia, which also tested positive with 81B probes. 105 Table 4.7 Colony hybridization results of samples from subjects with polyps Total No. of samples Fecal Polyp Rectal 22 25 28 81B positive 22/22 (100%) 24/25 (96.0%) 24/28 (85.7%) HRA1 positive* 9/22 (40.9%) 7/24 (29.2%) 4/24 (16.7%) CNF1 positive* 6/22 (27.3%) 3/24 (12.5%) 4/24 (16.7%) Tia positive* 4/22 (18.2%) 3/24 (12.5) 2/24 (8.3%) HRA1 and Tia positive* 3/22 (13.6%) 2/24 (8.3%) 1/24 (4.2%) HRA1 or Tia positive* 10/22 (45.5%) 8/24(33.3%) 5/24 (20.8%) HRA1 and CNF1 positive* 6/22 (27.3%) 4/24 (16.7%) 3/24 (12.5%) * Percentage calculated based on the number of respective determinants, namely HRA1, CNF1 and Tia, which also tested positive with 81B probes. 106 Table 4.7a Colony hybridization results of samples from subjects with hyperplasia Fecal Polyp Rectal 10 10 13 81B positive 10/10 (100%) 9/10 (90.0%) 11/13 (84.6%) HRA1 positive* 2/10 (20.0%) 2/9 (22.2%) 1/11 (9.1%) CNF1 positive* 1/10 (10.0%) 1/9 (11.1%) 1/11 (9.1%) Tia positive* 2/10 (20.0%) 1/9 (11.1%) 0/11(0%) HRA1 and Tia positive* 1/10 (10.0%) 0/9(0%) 0/11(0%) HRA1 or Tia positive* 3/10 (30.0%) 3/9 (33.3%) 1/11 (9.1%) HRA1 and CNF1 positive* 1/10 (10.0%) 1/9 (11.1%) 1/11(9.1%) Total No. of samples * Percentage calculated based on the number of respective determinants, namely HRA1, CNF1 and Tia, which also tested positive with 81B probes. 107 Table 4.8 The frequency of finding HRA1-positive E.coli in fecal samples collected at four time points over a months period. Frequency * 4/4 3/4 2/4 1/4 Normal subjects 0/41 1/41 5/41 23/41 (0%) (2.4%) (12.2%) (56.1%) 2/18 4/18 9/18 13/18 (11.1%) (22.2%) (50%) (72.2%) 0/9 1/9 4/9 7/9 (0%) (11.1%) (44.4%) (77.7%) 2/9 3/9 5/9 6/9 (22.2%) (33.3%) (55.5%) (66.6%) Subjects with polyps Subjects with hyperplasia Subjects with adenomas * Frequency: 4/4 denotes finding HRA1-positive E.coli in fecal specimens collected from all time points. 109 Table 4.9 The frequency of finding Tia-positive E.coli in fecal samples collected at four time points over a months period. Frequency * 4/4 3/4 2/4 1/4 Normal subjects 2/41 3/41 5/41 18/41 (4.9%) (7.3%) (12.2%) (43.9%) 0/18 2/18 2/18 5/18 (0%) (11.1%) (11.1%) (27.8%) 0/9 1/9 1/9 2/9 (0%) (11.1%) (11.1%) (22.2%) 0/9 1/9 1/9 3/9 (0%) (11.1%) (11.1%) (33.3%) Subjects with polyps Subjects with hyperplasia Subjects with adenomas * Frequency: 4/4 denotes finding Tia-positive E.coli in fecal specimens collected from all time points. 110 Table 4.10 The frequency of finding CNF1-positive E.coli in fecal samples collected at four time points over a months period. Frequency * 4/4 3/4 2/4 1/4 Normal subjects 0/41 1/41 2/41 12/41 (0%) (2.4%) (4.9%) (29.3%) 0/18 0/18 2/18 6/18 (0%) (0%) (11.1%) (33.3%) 0/9 0/9 1/9 2/9 (0%) (0%) (11.1%) (22.2%) 0/9 0/9 1/9 4/9 (0%) (0%) (11.1%) (44.4%) Subjects with polyps Subjects with hyperplasia Subjects with adenomas * Frequency: 4/4 denotes finding CNF1-positive E.coli in fecal specimens collected from all time points. 111 Table 4.11 PCR-ISH results on the prevalence of 81B marker sequence in different tissue specimens 81B Metastasis tissues Tumor tissues Distal tissues Adenomas tissues Hyperplastic tissues Normal tissues Positive 9/9 (100%) 20/20 (100%) 12/12 (100%) 12/12 (100%) 1/7 (14.3%) 0/20 (0%) Negative 0/9 (0%) 0/20 (0%) 0/12 (0%) 0/12 (0%) 6/7 (85.7%) 20/20 (100%) 112 Table 4.12 PCR-ISH results on the prevalence of HRA1 marker sequence in different tissue specimens Metastasis tissues Tumor tissues Distal tissues Adenomas tissues Normal tissues HRA1 Positive 1/1 (100%) 11/11 (100%) 3/3 (100%) 3/3 (100%) 2/20 (10%) Negative 0/1 (0%) 0/11 (0%) 0/3 (0%) 0/3 (0%) 18/20 (90%) 113 Table 4.13 PCR-ISH results on the prevalence of CNF1 marker sequence in different tissue specimens CNF1 Metastasis tissues Tumor tissues Distal tissues Adenomas tissues Normal tissues Positive 1/1 (100%) 13/13 (100%) 4/4 (100%) 3/3 (100%) 2/18 (22.2%) Negative 0/1 (0%) 0/13 (0%) 0/4 (0%) 0/3 (0%) 16/18 (77.8%) 114 Plate 1. PCR-ISH detection of 81B DNA sequence in tissue sections collected from tumor sites of colorectal cancer subjects and counter stained with nuclear fast red, showing great abundant amounts of positive signals (dark spots as indicated by arrows) inside the nucleus (pink area) of colonic mucosal cells at 400X magnification. 115 Plate 2. PCR-ISH detection of 81B DNA sequence in metastatic liver tissue sections with primary in the colon and counter stained with nuclear fast red, showing great abundant amounts of positive signals (dark spots as indicated by arrows) inside the nucleus (pink area) of cells at 600X magnification. 116 Plate 3. PCR-ISH detection of 81B DNA sequence in the distal tissue sections away from tumor site of the colon resected from colorectal cancer subjects and counter stained with nuclear fast red, showing moderate abundant amounts of positive signals (dark spots as indicated by arrows) inside the nucleus (pink area) of mucosal cells at 200X magnification. 117 Plate 4. PCR-ISH detection of 81B DNA sequence in the adenomatous polyp (tubulovillous type) tissue sections from subjects with adenomas and counter stained with nuclear fast red, showing abundant amounts of positive signals (dark spots as indicated by arrows) inside the nucleus (pink area) of mucosal cells at 400X magnification. 118 Plate 5. PCR-ISH detection of 81B DNA sequence in the normal mucosal tissue sections from normal subjects and counter stained with nuclear fast red, showing no positive signals (dark spots) in the cytoplasmic area nor the nucleus (pink area) of the mucosal cells at 400X magnification. 119 Plate 6. PCR-ISH detection of 81B DNA sequence in the normal mucosal tissue sections from normal subjects and counter stained with nuclear fast red, showing small amounts of positive signals (dark spots as indicated by arrows) in some areas of the mucosa that appeared to be lodged between cells rather than in the cells and not in the nucleus (pink area) of mucosal cells at 400X magnification. 120 Plate 7. PCR-ISH detection of HRA1 DNA sequence in the normal mucosal tissue sections from normal subjects and counter stained with nuclear fast red, showing a moderate amounts of positive signals (dark spots as indicated by arrows) concentrating in some areas of the mucosal cells that appeared to be patchy and in some instances found in the nucleus (pink area) of mucosal cells at 600X magnification after a longer period of substrate incubation. 121 Plate 8. PCR-ISH detection of HRA1 DNA sequence in tissue sections collected from tumor sites of colorectal cancer subjects and counter stained with nuclear fast red, showing great abundant amounts of positive signals (dark spots as indicated by arrows) inside the nucleus (pink area) of colonic mucosal cells at 200X magnification. 122 Plate PCR-ISH detection of CNF1 DNA sequence in the colonic tissue sections of subjects with moderate differentiated adenocarcinoma and counter stained with nuclear fast red, showing an abundant amounts of positive signals (dark spots as indicated by arrows) inside the nucleus (pink area) of mucosal cells at 600X magnification. 123 Plate 10 PCR-ISH detection of CNF1 DNA sequence in the metastatic liver tissue sections, moderately differentiated adenocarcinoma with primary in the colon and counter stained with nuclear fast red, showing great abundant amounts of positive signals (dark spots as indicated by arrows) inside the nucleus (pink area) of cells at 400X magnification. 124 [...]... subjects with adenomas Fecal Total No of samples Polyp Rectal 12 15 15 81B positive 12/12 (100%) 15/15 (100%) 13/ 15 (86.7%) HRA1 positive* 7/12 (58 .3% ) 5/15 (33 .3% ) 3/ 13 ( 23. 1%) CNF1 positive* 5/12 (41.7%) 2/15 ( 13. 3%) 3/ 13 ( 23. 1%) Tia positive* 1/12 (8 .3% ) 3/ 15 (20.0%) 2/ 13 (15.4%) HRA1 and Tia positive* 2/12 (16.6%) 2/15 ( 13. 3%) 1/ 13 (7.7%) HRA1 or Tia positive* 7/12 (58 .3% ) 5/15 (33 .3% ) 4/ 13 (30 .8%)... ( 13. 3%) 3/ 13 ( 23. 1%) * Percentage calculated based on the number of respective determinants, namely HRA1, CNF1 and Tia, which also tested positive with 81B probes 108 Table 4.8 The frequency of finding HRA1-positive E.coli in fecal samples collected at four time points over a 6 months period Frequency * 4/4 3/ 4 2/4 1/4 Normal subjects 0/41 1/41 5/41 23/ 41 (0%) (2.4%) (12.2%) (56.1%) 2/18 4/18 9/18 13/ 18... 2/9 3/ 9 5/9 6/9 (22.2%) (33 .3% ) (55.5%) (66.6%) Subjects with polyps Subjects with hyperplasia Subjects with adenomas * Frequency: 4/4 denotes finding HRA1-positive E.coli in fecal specimens collected from all 4 time points 109 Table 4.9 The frequency of finding Tia-positive E.coli in fecal samples collected at four time points over a 6 months period Frequency * 4/4 3/ 4 2/4 1/4 Normal subjects 2/41 3/ 41... a 6 months period Frequency * 4/4 3/ 4 2/4 1/4 Normal subjects 2/41 3/ 41 5/41 18/41 (4.9%) (7 .3% ) (12.2%) ( 43. 9%) 0/18 2/18 2/18 5/18 (0%) (11.1%) (11.1%) (27.8%) 0/9 1/9 1/9 2/9 (0%) (11.1%) (11.1%) (22.2%) 0/9 1/9 1/9 3/ 9 (0%) (11.1%) (11.1%) (33 .3% ) Subjects with polyps Subjects with hyperplasia Subjects with adenomas * Frequency: 4/4 denotes finding Tia-positive E.coli in fecal specimens collected... collected at four time points over a 6 months period Frequency * 4/4 3/ 4 2/4 1/4 Normal subjects 0/41 1/41 2/41 12/41 (0%) (2.4%) (4.9%) (29 .3% ) 0/18 0/18 2/18 6/18 (0%) (0%) (11.1%) (33 .3% ) 0/9 0/9 1/9 2/9 (0%) (0%) (11.1%) (22.2%) 0/9 0/9 1/9 4/9 (0%) (0%) (11.1%) (44.4%) Subjects with polyps Subjects with hyperplasia Subjects with adenomas * Frequency: 4/4 denotes finding CNF1-positive E.coli in... Negative 0/1 (0%) 0/11 (0%) 0 /3 (0%) 0 /3 (0%) 18/20 (90%) 1 13 Table 4. 13 PCR-ISH results on the prevalence of CNF1 marker sequence in different tissue specimens CNF1 Metastasis tissues Tumor tissues Distal tissues Adenomas tissues Normal tissues Positive 1/1 (100%) 13/ 13 (100%) 4/4 (100%) 3/ 3 (100%) 2/18 (22.2%) Negative 0/1 (0%) 0/ 13 (0%) 0/4 (0%) 0 /3 (0%) 16/18 (77.8%) 114 Plate 1 PCR-ISH detection of... (100%) 1/7 (14 .3% ) 0/20 (0%) Negative 0/9 (0%) 0/20 (0%) 0/12 (0%) 0/12 (0%) 6/7 (85.7%) 20/20 (100%) 112 Table 4.12 PCR-ISH results on the prevalence of HRA1 marker sequence in different tissue specimens Metastasis tissues Tumor tissues Distal tissues Adenomas tissues Normal tissues HRA1 Positive 1/1 (100%) 11/11 (100%) 3/ 3 (100%) 3/ 3 (100%) 2/20 (10%) Negative 0/1 (0%) 0/11 (0%) 0 /3 (0%) 0 /3 (0%) 18/20... from tumor sites of colorectal cancer subjects and counter stained with nuclear fast red, showing great abundant amounts of positive signals (dark spots as indicated by arrows) inside the nucleus (pink area) of colonic mucosal cells at 400X magnification 115 Plate 2 PCR-ISH detection of 81B DNA sequence in metastatic liver tissue sections with primary in the colon and counter stained with nuclear fast... sites of colorectal cancer subjects and counter stained with nuclear fast red, showing great abundant amounts of positive signals (dark spots as indicated by arrows) inside the nucleus (pink area) of colonic mucosal cells at 200X magnification 122 Plate 9 PCR-ISH detection of CNF1 DNA sequence in the colonic tissue sections of subjects with moderate differentiated adenocarcinoma and counter stained with. .. positive signals (dark spots as indicated by arrows) inside the nucleus (pink area) of cells at 600X magnification 116 Plate 3 PCR-ISH detection of 81B DNA sequence in the distal tissue sections away from tumor site of the colon resected from colorectal cancer subjects and counter stained with nuclear fast red, showing moderate abundant amounts of positive signals (dark spots as indicated by arrows) inside . (100%) 13/ 15 (86.7%) HRA1 positive* 7/12 (58 .3% ) 5/15 (33 .3% ) 3/ 13 ( 23. 1%) CNF1 positive* 5/12 (41.7%) 2/15 ( 13. 3%) 3/ 13 ( 23. 1%) Tia positive* 1/12 (8 .3% ) 3/ 15 (20.0%) 2/ 13 (15.4%). positive* 2/12 (16.6%) 2/15 ( 13. 3%) 1/ 13 (7.7%) HRA1 or Tia positive* 7/12 (58 .3% ) 5/15 (33 .3% ) 4/ 13 (30 .8%) HRA1 and CNF1 positive* 5/12(41.7%) 2/15 ( 13. 3%) 3/ 13 ( 23. 1%) * Percentage calculated. positive 36 /41 (87.8%) 38 /41 (92.7%) HRA1 positive* 6 /36 (16.7%) 3/ 38 (7.9%) CNF1 positive* 3/ 36 (8 .3% ) 1 /38 (2.6%) Tia positive* 4 /36 (11.1%) 6 /38 (15.8%) HRA1 and Tia positive* 0 /36 (0%)