Gene regulation of snake venom prothrombin activators

GENE REGULATION OF SNAKE VENOM PROTHROMBIN ACTIVATORS KWONG SHIYANG B.SC. (HONS.), NUS A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF BIOLOGICAL SCIENCES, NATIONAL UNIVERSITY OF SINGAPORE 2010 ACKNOWLEDGEMENTS The writing of this section is a time which all PhD students look forward to. This time of reflection causes me to recall all the individuals who have guided and encouraged me along the way. Without their support, this journey would be more difficult. Hence, I would like to take this opportunity to express my heartfelt gratitude to these people. I would like to thank my supervisor, Professor R. Manjunatha Kini for his guidance and support. Without his acceptance into the Protein Science Laboratory, this thesis would not have materialized. Prof Kini has always been an open channel of communication which is a luxury for any graduate student. His door is always open and he would be behind the desk ready for discussion. He has not only taught me to high quality research, but more importantly, guided me to think critically and independently as an individual. I am also fortunate to have Associate Professor Ge Ruowen as my co-supervisor. Her guidance and input has been invaluable towards this PhD thesis. I would like to thank the graduate programme run by the National University of Singapore for their financial support. I was privileged to perform part of my research in Adelaide, Australia. I would like to thank Professor Anthony Woods of the University of South Australia for accepting me into his laboratory during that time. I would also like to thank Mr Peter Mirtschin of Venom Supplies Pty Ltd. for providing the snakes i to be sacrificed for their venom glands. The one month period in Australia was definitely a memorable experience for me. The Protein Science Laboratory is like a big extended family. I have made many friends and it has certainly enriched my experience. Firstly, I would like to thank my senior, Reza, who was my mentor when I was doing my honors project. Reza imparted many molecular biology techniques which he had painstakingly learnt by himself. I would like to thank our previous postdoctoral fellow, Robin, and my senior, Cho Yeow, for sharing their experiences with me. Research is stressful and it is great to have friends whom you can joke around with. I would like to give special mention to my lunch and coffee buddies: Amrita, Girish, Angelina and Chun Shin. I also thank Ryan, Shifali, Bhaskar, Angie, Sindhuja and Nazir for their support and making the lab nice to place to work in. Besides my lab members, special mention has to be given to Bee Ling. She has been a great source of support as our lab officer in the lab. I am very blessed to have my family who has been there to support me. My wife, Delphene, and our firstborn, Samuel, has been a constant source of inspiration and motivation. They have been my harbor where I seek refuge when I feel like giving up. I would have definitely not made it without them. I also want to thank my parents who had always supported and encouraged me to a PhD. I thank them for their nurturance, love and for bringing me up to be the man that I am today. Also, I like to thank them for helping to look after Samuel so that I can ii concentrate on writing this thesis. Most importantly, I thank God for always providing and blessing me along this long PhD journey. Kwong Shiyang August, 2010 iii TABLE OF CONTENTS Page Acknowledgements i Table of Contents iv Summary vi List of Figures ix List of Tables xi Abbreviations xii Chapter One Introduction A brief introduction to gene duplication, the recruitment of snake venom toxins from body proteins, and transcription; overview of prothrombin activators from snake venom; Aims and Scope Chapter Two Characterization of trocarin D VERSE promoter The role of VERSE promoter in trocarin D expression; characterization of VERSE for its regulatory cis-elements in primary Pseudonaja textilis snake venom gland cells and mammalian cell lines 50 Chapter Three Identification of silencer cis-element within trocarin D intron insertion/deletion segments Characterization and confirmation of trocarin D intron insertions/deletions using mammalian cell lines 78 Chapter Four Identification of trans-factors that interact with novel VERSE cis-elements Purification and identification of the transcription factors from nuclear extracts which interact with the novel VERSE cis-elements 106 iv Chapter Five Conclusions and future prospects Conclusion, limitations, implications and future prospects 134 Bibliography 148 Appendices List of publications, patents and conferences achieved during the course of this thesis 161 List of primers used for making VERSE constructs v SUMMARY Snake venom prothrombin activators are functional and structural homologues of blood coagulation factors. It is hypothesized that the venom prothrombin activators evolved from blood coagulation factors by gene duplication. The copy gene of the blood coagulation factor is genetically modified which causes changes to its expression pattern. The modified copy gene becomes differentially expressed than its ancestral gene to become a toxin gene, i.e. it expression becomes elevated and exclusive in the venom gland. This whole process is broadly termed as “venom recruitment”. Trocarin D, a group D venom prothrombin activator, resembles activated mammalian blood coagulation factor X (FXa). Both trocarin D and FXa activate prothrombin to thrombin by targeting the same cleavage sites and have identical domain architectures. Despite such similarities, trocarin D and FXa have different expression patterns which facilitate their respective functions. While FX functions as a haemostatic factor and has low level of liver-specific expression, trocarin D functions as a toxin and has high level of venom gland-specific expression. A snake FX-like (TrFX) cDNA sequence was determined from the liver of Tropidechis carinatus. Comparison of trocarin D and TrFX gene organizations confirmed that trocarin D was “recruited” from TrFX. Both genes have identical architectures and significant sequence identities, except for insertions/deletions in their promoter and intron regions. Compared to TrFX, the trocarin D promoter has a 264 bp insertion termed as the Venom Recruitment/Switch Element vi (VERSE). Compared to TrFX, the trocarin D intron has three insertions and two deletions. These insertions/deletions in the promoter and intron regions are hypothesized to facilitate the “venom recruitment” process of TrFX into the venom gland transcriptome for elevated and specific expression as a toxin. However, more importantly, these insertions/deletions are hypothesized to regulate the expression of trocarin D. Using trocarin D as a representative, this thesis aims to characterize the promoter and intron insertion/deletion segments to investigate the gene regulation of snake venom prothrombin activators. The trocarin D VERSE promoter segment was characterized using luciferase assays in primary snake venom gland cells and mammalian cell lines. VERSE is capable of driving luciferase expression and its up-regulatory effect is comparable to the full trocarin D promoter. Hence, this indicates that VERSE is the main segment responsible for the trocarin D elevated expression in the venom gland. Subsequent characterization confirms the presence of TATA-, GATA- and Y-box cis-elements. Three other novel cis-elements (Sup, Up1 and Up2) were also identified and characterized. The transcription factor which interacts with the Sup cis-element was purified and identified as a class POU transcription factor. Although expression of trocarin D is venom gland-specific, VERSE is still able to drive luciferase expression in mammalian cell lines. Hence, the trocarin D intron insertion/deletion segments were characterized for their roles in tissue-specific expression. vii The insertion/deletion segments within the trocarin D intron region were characterized using luciferase assays in mammalian cell lines. A scaffold matrix attachment region which was previously predicted using bioinformatics tools was found to be nonfunctional. The characterization of the trocarin D intron insertion segment pinpoints a 26 bp segment as a silencer cis-element which probably functions to “turn off” trocarin D expression in other tissues. The results of this thesis have elucidated how trocarin D is regulated for its elevated and tissue-specific expression. Finally, it has significantly contributed towards our understanding of gene regulation of snake venom prothrombin activators. viii LIST OF FIGURES Chapter One Figure 1.1: Domain architecture of mammalian FXa, trocarin D and pseutarin C catalytic subunit (PCCS). Figure 1.2: Domain architecture of mammalian FV and pseutarin C nonenzymatic subunit (PCNS). Figure 1.3: Phylogenetic tree of snake venom prothrombin activators and blood coagulation factors. Figure 1.4: A. Cis-elements of human, murine, TrFX, trocarin D and PCCS promoter regions B. Comparison of TrFX and trocarin D intron one regions. Chapter Two Figure 2.1: Comparison of TrFX, trocarin D and VERSE promoter activities in mammalian cell lines. Figure 2.2: Characterization of predicted VERSE cis-elements and comparison of VERSE promoter activity between primary P. textilis venom gland cells and mammalian cell lines. Figure 2.3: Influence of TLB3 and TLB2 on transcription start sites. Figure 2.4: Characterization of VERSE promoter by serial deletions and identification of minimal core promoter. Figure 2.5: Characterization of novel cis-elements constructs. Figure 2.6: Comparison of VERSE and CMV promoter activity. Figure 2.7: Complete characterization of the VERSE promoter. ix Chapter - Conclusion and future prospects consists of the functional gene with a suitable promoter. Upon transfection, the functional gene is integrated into the genome of the targeted cell. The promoter then drives the expression of the functional gene; hence, correcting the genetic disorder. Most viral constructs employs the use of a single or chimeric promoter which is usually several kb in length (Balague et al. 2000; Chao et al. 2000). The VERSE promoter and tissue-specific silencer cis-elements are potential regulatory elements that can be incorporated in gene therapy. VERSE provides a shorter but potent promoter. This could increase the efficiency of the gene therapy treatment. Also, if transfection of the viral carrier occurs in neighboring cells which are not targeted, incorporation of the trocarin D tissue-specific silencer cis-element can prevent the unwanted expression of the gene which could lead to further complications. 147 Appendices Bibliography Andersen,B., M.D.Schonemann, R.V.Pearse, K.Jenne, J.Sugarman, and M.G.Rosenfeld. 1993. "Brn-5 is a divergent POU domain factor highly expressed in layer IV of the neocortex." J.Biol.Chem. 268:23390-23398. Assa-Munt,N., R.J.Mortishire-Smith, R.Aurora, W.Herr, and P.E.Wright. 1993. "The solution structure of the Oct-1 POU-specific domain reveals a striking similarity to the bacteriophage lambda repressor DNA-binding domain." Cell. 73:193-205. Bahnak,B.R., R.Howk, J.H.Morrissey, G.A.Ricca, T.S.Edgington, M.C.Jaye, W.W.Drohan, and D.S.Fair. 1987. "Steady state levels of factor X mRNA in liver and Hep G2 cells." Blood. 69:224-230. Balague,C., J.Zhou, Y.Dai, R.Alemany, S.F.Josephs, G.Andreason, M.Hariharan, E.Sethi, E.Prokopenko, H.Y.Jan, Y.C.Lou, D.Hubert-Leslie, L.Ruiz, and W.W.Zhang. 2000. "Sustained high-level expression of full-length human factor VIII and restoration of clotting activity in hemophilic mice using a minimal adenovirus vector." Blood. 95:820-828. Blissard,G.W., P.H.Kogan, R.Wei, and G.F.Rohrmann. 1992. "A synthetic early promoter from a baculovirus: roles of the TATA box and conserved start site CAGT sequence in basal levels of transcription." Virology. 190:783793. Bode,J., Y.Kohwi, L.Dickinson, T.Joh, D.Klehr, C.Mielke, and T.KohwiShigematsu. 1992. "Biological significance of unwinding capability of nuclear matrix-associating DNAs." Science. 255:195-197. Bode,J., T.Schlake, M.Rios-Ramirez, C.Mielke, M.Stengert, V.Kay, and D.KlehrWirth. 1995. "Scaffold/matrix-attached regions: structural properties creating transcriptionally active loci." Int.Rev.Cytol. 162A:389-454. Boshart,M., F.Weber, G.Jahn, K.Dorsch-Hasler, B.Fleckenstein, and W.Schaffner. 1985. "A very strong enhancer is located upstream of an immediate early gene of human cytomegalovirus." Cell. 41:521-530. Botfield,M.C., A.Jancso, and M.A.Weiss. 1992. "Biochemical characterization of the Oct-2 POU domain with implications for bipartite DNA recognition." Biochemistry. 31:5841-5848. Boulikas,T. 1993. "Nature of DNA sequences at the attachment regions of genes to the nuclear matrix." J.Cell Biochem. 52:14-22. Braud,S., C.Bon, and A.Wisner. 2000. "Snake venom proteins acting on hemostasis." Biochimie. 82:851-859. 148 Appendices Briat,A. and G.Vassaux. 2006. "Preclinical applications of imaging for cancer gene therapy." Expert.Rev.Mol.Med. 8:1-19. Bridges,C.B. 1936. "THE BAR "GENE" A DUPLICATION." Science. 83:210211. Bruce Alberts, Dennis Bray, Julian Lewis, Martin Raff, Keith Roberts, and James D.Watson. 1994. Molecular Biology of the Cell. Garland Publishing. Buratowski,S., S.Hahn, L.Guarente, and P.A.Sharp. 1989. "Five intermediate complexes in transcription initiation by RNA polymerase II." Cell. 56:549-561. Chao,H., L.Mao, A.T.Bruce, and C.E.Walsh. 2000. "Sustained expression of human factor VIII in mice using a parvovirus-based vector." Blood. 95:1594-1599. Chester,A. and G.P.Crawford. 1982. "In vitro coagulant properties of venoms from Australian snakes." Toxicon. 20:501-504. Choudhuri,S. 2004. "Gene regulation and molecular toxicology." Toxicol.Mech.Methods. 15:1-23. Chow,G. and R.M.Kini. 2001. "Exogenous factors from animal sources that induce platelet aggregation." Thromb.Haemost. 85:177-178. Cockerill,P.N. and W.T.Garrard. 1986. "Chromosomal loop anchorage of the kappa immunoglobulin gene occurs next to the enhancer in a region containing topoisomerase II sites." Cell. 44:273-282. Concino,M.F., R.F.Lee, J.P.Merryweather, and R.Weinmann. 1984. "The adenovirus major late promoter TATA box and initiation site are both necessary for transcription in vitro." Nucleic Acids Res. 12:7423-7433. Cox,M., P.J.van Tilborg, W.de Laat, R.Boelens, H.C.van Leeuwen, P.C.van der Vliet, and R.Kaptein. 1995. "Solution structure of the Oct-1 POU homeodomain determined by NMR and restrained molecular dynamics." J.Biomol.NMR. 6:23-32. Davie,E.W. 2003. "A brief historical review of the waterfall/cascade of blood coagulation." J.Biol.Chem. 278:50819-50832. Donahue,B.A., S.Yin, J.S.Taylor, D.Reines, and P.C.Hanawalt. 1994. "Transcript cleavage by RNA polymerase II arrested by a cyclobutane pyrimidine dimer in the DNA template." Proc.Natl.Acad.Sci.U.S.A. 91:8502-8506. 149 Appendices Duret,L. 2000. "tRNA gene number and codon usage in the C. elegans genome are co-adapted for optimal translation of highly expressed genes." Trends Genet. 16:287-289. Dvir,A. 2002. "Promoter escape by RNA polymerase II." Biochim.Biophys.Acta. 1577:208-223. Esmon,C.T. 2001. "Role of coagulation inhibitors in inflammation." Thromb.Haemost. 86:51-56. Filippovich,I., N.Sorokina, L.St Pierre, S.Flight, J.de Jersey, N.Perry, P.P.Masci, and M.F.Lavin. 2005. "Cloning and functional expression of venom prothrombin activator protease from Pseudonaja textilis with whole blood procoagulant activity." Br.J.Haematol. 131:237-246. Fine,J.D. 2010. "Inherited epidermolysis bullosa: recent basic and clinical advances." Curr.Opin.Pediatr. Foecking,M.K. and H.Hofstetter. 1986. "Powerful and versatile enhancerpromoter unit for mammalian expression vectors." Gene. 45:101-105. Foster,W.B., M.E.Nesheim, and K.G.Mann. 1983. "The factor Xa-catalyzed activation of factor V." J.Biol.Chem. 258:13970-13977. Fry,B.G. 2005. "From genome to "venome": molecular origin and evolution of the snake venom proteome inferred from phylogenetic analysis of toxin sequences and related body proteins." Genome Res. 15:403-420. Gao,R., R.M.Kini, and P.Gopalakrishnakone. 2002. "A novel prothrombin activator from the venom of Micropechis ikaheka: isolation and characterization." Arch.Biochem.Biophys. 408:87-92. Gaunitz,F., K.Heise, and R.Gebhardt. 2004. "A silencer element in the first intron of the glutamine synthetase gene represses induction by glucocorticoids." Mol.Endocrinol. 18:63-69. Goldman,S.R., R.H.Ebright, and B.E.Nickels. 2009. "Direct detection of abortive RNA transcripts in vivo." Science. 324:927-928. Gu,Z., D.Nicolae, H.H.Lu, and W.H.Li. 2002. "Rapid divergence in expression between duplicate genes inferred from microarray data." Trends Genet. 18:609-613. Hanover,J.A., C.K.Cohen, M.C.Willingham, and M.K.Park. 1987. "O-linked Nacetylglucosamine is attached to proteins of the nuclear pore. Evidence for cytoplasmic and nucleoplasmic glycoproteins." J.Biol.Chem. 262:98879894. 150 Appendices Hasson,S.S., R.D.Theakston, and R.A.Harrison. 2003. "Cloning of a prothrombin activator-like metalloproteinase from the West African saw-scaled viper, Echis ocellatus." Toxicon. 42:629-634. Herr,W., R.A.Sturm, R.G.Clerc, L.M.Corcoran, D.Baltimore, P.A.Sharp, H.A.Ingraham, M.G.Rosenfeld, M.Finney, G.Ruvkun, and . 1988. "The POU domain: a large conserved region in the mammalian pit-1, oct-1, oct2, and Caenorhabditis elegans unc-86 gene products." Genes Dev. 2:15131516. Holt,G.D., R.S.Haltiwanger, C.R.Torres, and G.W.Hart. 1987. "Erythrocytes contain cytoplasmic glycoproteins. O-linked GlcNAc on Band 4.1." J.Biol.Chem. 262:14847-14850. Holt,G.D. and G.W.Hart. 1986. "The subcellular distribution of terminal Nacetylglucosamine moieties. Localization of a novel protein-saccharide linkage, O-linked GlcNAc." J.Biol.Chem. 261:8049-8057. Hsu,L.M. 2002. "Promoter clearance and escape in prokaryotes." Biochim.Biophys.Acta. 1577:191-207. Huang,M.N., H.L.Hung, S.A.Stanfield-Oakley, and K.A.High. 1992. "Characterization of the human blood coagulation factor X promoter." J.Biol.Chem. 267:15440-15446. Hughes,A.L. 1994. "The evolution of functionally novel proteins after gene duplication." Proc.Biol.Sci. 256:119-124. Hung,H.L. and K.A.High. 1996. "Liver-enriched transcription factor HNF-4 and ubiquitous factor NF-Y are critical for expression of blood coagulation factor X." J.Biol.Chem. 271:2323-2331. Hung,H.L., E.S.Pollak, R.D.Kudaravalli, V.Arruda, K.Chu, and K.A.High. 2001. "Regulation of human coagulation factor X gene expression by GATA-4 and the Sp family of transcription factors." Blood. 97:946-951. Hutton,R.A. and D.A.Warrell. 1993. "Action of snake venom components on the haemostatic system." Blood Rev. 7:176-189. Iijima,H., Y.Negishi, D.Omata, M.Nomizu, and Y.Aramaki. 2010. "Cancer cell specific gene delivery by laminin-derived peptide AG73-labeled liposomes." Bioorg.Med.Chem.Lett. Ilia,M. 2004. "Oct-6 transcription factor." Int.Rev.Neurobiol. 59:471-489. Ingraham,H.A., S.E.Flynn, J.W.Voss, V.R.Albert, M.S.Kapiloff, L.Wilson, and M.G.Rosenfeld. 1990. "The POU-specific domain of Pit-1 is essential for 151 Appendices sequence-specific, high affinity DNA binding and DNA-dependent Pit-1Pit-1 interactions." Cell. 61:1021-1033. Inoue,K. and T.Morita. 1993. "Identification of O-linked oligosaccharide chains in the activation peptides of blood coagulation factor X. The role of the carbohydrate moieties in the activation of factor X." Eur.J.Biochem. 218:153-163. Jacobson,E.M., P.Li, A.Leon-del-Rio, M.G.Rosenfeld, and A.K.Aggarwal. 1997. "Structure of Pit-1 POU domain bound to DNA as a dimer: unexpected arrangement and flexibility." Genes Dev. 11:198-212. James D.Watson, Amy A.Caudy, Richard M.Myers, and Jan A.Witkowski. 2007. Recombinant DNA: Genes and Genomes - A Short Course. W. H. Freeman. 57-58. Joseph,J.S., M.C.Chung, K.Jeyaseelan, and R.M.Kini. 1999. "Amino acid sequence of trocarin, a prothrombin activator from Tropidechis carinatus venom: its structural similarity to coagulation factor Xa." Blood. 94:621631. Joseph,J.S. and R.M.Kini. 2001. "Snake venom prothrombin activators homologous to blood coagulation factor Xa." Haemostasis. 31:234-240. Joseph,J.S. and R.M.Kini. 2004. "Snake venom prothrombin activators similar to blood coagulation factor Xa." Curr.Drug Targets.Cardiovasc.Haematol.Disord. 4:397-416. Kalafatis,M. 1998. "Identification and partial characterization of factor Va heavy chain kinase from human platelets." J.Biol.Chem. 273:8459-8466. Kalafatis,M., M.D.Rand, and K.G.Mann. 1994. "The mechanism of inactivation of human factor V and human factor Va by activated protein C." J.Biol.Chem. 269:31869-31880. Kini,R.M. 2002. "Molecular moulds with multiple missions: functional sites in three-finger toxins." Clin.Exp.Pharmacol.Physiol. 29:815-822. Kini,R.M. 2004. "Platelet aggregation and exogenous factors from animal sources." Curr.Drug Targets.Cardiovasc.Haematol.Disord. 4:301-325. Kini,R.M. and G.Chow. 2001. "Exogenous inhibitors of platelet aggregation from animal sources." Thromb.Haemost. 85:179-181. Kini,R.M. and H.J.Evans. 1990. "Effects of snake venom proteins on blood platelets." Toxicon. 28:1387-1422. 152 Appendices Kini,R.M., T.Morita, and J.Rosing. 2001. "Classification and nomenclature of prothrombin activators isolated from snake venoms." Thromb.Haemost. 86:710-711. Klemm,J.D., M.A.Rould, R.Aurora, W.Herr, and C.O.Pabo. 1994. "Crystal structure of the Oct-1 POU domain bound to an octamer site: DNA recognition with tethered DNA-binding modules." Cell. 77:21-32. Komissarova,N. and M.Kashlev. 1997. "Transcriptional arrest: Escherichia coli RNA polymerase translocates backward, leaving the 3' end of the RNA intact and extruded." Proc.Natl.Acad.Sci.U.S.A. 94:1755-1760. Kong,J., G.H.Kim, M.Wei, T.Sun, G.Li, S.Q.Liu, X.Li, I.Bhan, Q.Zhao, R.Thadhani, and Y.C.Li. 2010. "Therapeutic Effects of Vitamin D Analogs on Cardiac Hypertrophy in Spontaneously Hypertensive Rats." Am.J.Pathol. Kornalik,F. and B.Blomback. 1975. "Prothrombin activation induced by Ecarin a prothrombin converting enzyme from Echis carinatus venom." Thromb.Res. 6:57-63. Kwong,S., A.E.Woods, P.J.Mirtschin, R.Ge, and R.M.Kini. 2009. "The recruitment of blood coagulation factor X into snake venom gland as a toxin: the role of promoter cis-elements in its expression." Thromb.Haemost. 102:469-478. Lee,T.I. and R.A.Young. 2000. "Transcription of eukaryotic protein-coding genes." Annu.Rev.Genet. 34:77-137. LI Wen-Hsiung. 1997. Molecular evolution. Sinauer Associates. Sunderland. Li,M., C.M.Bullock, D.J.Knauer, F.J.Ehlert, and Q.Y.Zhou. 2001a. "Identification of two prokineticin cDNAs: recombinant proteins potently contract gastrointestinal smooth muscle." Mol.Pharmacol. 59:692-698. Li,W.H., Z.Gu, H.Wang, and A.Nekrutenko. 2001b. "Evolutionary analyses of the human genome." Nature. 409:847-849. Liebich,I., J.Bode, I.Reuter, and E.Wingender. 2002. "Evaluation of sequence motifs found in scaffold/matrix-attached regions (S/MARs)." Nucleic Acids Res. 30:3433-3442. Lo,S.H. 2004. "Tensin." Int.J.Biochem.Cell Biol. 36:31-34. Long,M. 2001. "Evolution of novel genes." Curr.Opin.Genet.Dev. 11:673-680. 153 Appendices Ma,D., A.Armugam, and K.Jeyaseelan. 2001. "Expression of cardiotoxin-2 gene. Cloning, characterization and deletion analysis of the promoter." Eur.J.Biochem. 268:1844-1850. Ma,D., A.Armugam, and K.Jeyaseelan. 2002. "Alpha-neurotoxin gene expression in Naja sputatrix: identification of a silencer element in the promoter region." Arch.Biochem.Biophys. 404:98-105. Mann,K.G., M.F.Hockin, K.J.Begin, and M.Kalafatis. 1997. "Activated protein C cleavage of factor Va leads to dissociation of the A2 domain." J.Biol.Chem. 272:20678-20683. Markland,F.S. 1997. "Snake venoms." Drugs. 54 Suppl 3:1-10. Markland,F.S. 1998. "Snake venoms and the hemostatic system." Toxicon. 36:1749-1800. Marsh,N.A., T.L.Fyffe, and E.A.Bennett. 1997. "Isolation and partial characterization of a prothrombin-activating enzyme from the venom of the Australian rough-scaled snake (Tropidechis carinatus)." Toxicon. 35:563-571. Masci,P.P., A.N.Whitaker, and J.de Jersey. 1988. "Purification and characterization of a prothrombin activator from the venom of the Australian brown snake, Pseudonaja textilis textilis." Biochem.Int. 17:825835. McMullen,B.A., K.Fujikawa, W.Kisiel, T.Sasagawa, W.N.Howald, E.Y.Kwa, and B.Weinstein. 1983. "Complete amino acid sequence of the light chain of human blood coagulation factor X: evidence for identification of residue 63 as beta-hydroxyaspartic acid." Biochemistry. 22:2875-2884. Miao,C.H., S.P.Leytus, D.W.Chung, and E.W.Davie. 1992. "Liver-specific expression of the gene coding for human factor X, a blood coagulation factor." J.Biol.Chem. 267:7395-7401. Mieda,M. 1997. "[Neuron-restrictive silencer element/repressor element 1]." Seikagaku. 69:1021-1025. Minh,L.T., M.A.Reza, S.Swarup, and R.M.Kini. 2005. "Gene duplication of coagulation factor V and origin of venom prothrombin activator in Pseudonaja textilis snake." Thromb.Haemost. 93:420-429. Molinari,S., F.Relaix, M.Lemonnier, B.Kirschbaum, B.Schafer, and M.Buckingham. 2004. "A novel complex regulates cardiac actin gene expression through interaction of Emb, a class VI POU domain protein, MEF2D, and the histone transacetylase p300." Mol.Cell Biol. 24:29442957. 154 Appendices Mollay,C., C.Wechselberger, G.Mignogna, L.Negri, P.Melchiorri, D.Barra, and G.Kreil. 1999. "Bv8, a small protein from frog skin and its homologue from snake venom induce hyperalgesia in rats." Eur.J.Pharmacol. 374:189-196. Morita,T. 2004. "C-type lectin-related proteins from snake venoms." Curr.Drug Targets.Cardiovasc.Haematol.Disord. 4:357-373. Morita,T. and S.Iwanaga. 1978. "Purification and properties of prothrombin activator from the venom of Echis carinatus." J.Biochem.(Tokyo). 83:559570. Nei,M., X.Gu, and T.Sitnikova. 1997. "Evolution by the birth-and-death process in multigene families of the vertebrate immune system." Proc.Natl.Acad.Sci.U.S.A. 94:7799-7806. Nei,M., I.B.Rogozin, and H.Piontkivska. 2000. "Purifying selection and birthand-death evolution in the ubiquitin gene family." Proc.Natl.Acad.Sci.U.S.A. 97:10866-10871. Nesheim,M.E., W.M.Canfield, W.Kisiel, and K.G.Mann. 1982. "Studies of the capacity of factor Xa to protect factor Va from inactivation by activated protein C." J.Biol.Chem. 257:1443-1447. Nesheim,M.E., J.B.Taswell, and K.G.Mann. 1979. "The contribution of bovine Factor V and Factor Va to the activity of prothrombinase." J.Biol.Chem. 254:10952-10962. Niimura,Y. and M.Nei. 2003. "Evolution of olfactory receptor genes in the human genome." Proc.Natl.Acad.Sci.U.S.A. 100:12235-12240. Nishida,S., T.Fujita, N.Kohno, H.Atoda, T.Morita, H.Takeya, I.Kido, M.J.Paine, S.Kawabata, and S.Iwanaga. 1995. "cDNA cloning and deduced amino acid sequence of prothrombin activator (ecarin) from Kenyan Echis carinatus venom." Biochemistry. 34:1771-1778. Nowak,M.A., M.C.Boerlijst, J.Cooke, and J.M.Smith. 1997. "Evolution of genetic redundancy." Nature. 388:167-171. Ogbourne,S. and T.M.Antalis. 1998. "Transcriptional control and the role of silencers in transcriptional regulation in eukaryotes." Biochem.J. 331 ( Pt 1):1-14. Orphanides,G., T.Lagrange, and D.Reinberg. 1996. "The general transcription factors of RNA polymerase II." Genes Dev. 10:2657-2683. Owen,W.G. and C.M.Jackson. 1973. "Activation of prothrombin with Oxyranus scutellatus scutellatus (Taipain snake) venom." Thromb.Res. 3:705-714. 155 Appendices Paine,M.J., H.P.Desmond, R.D.Theakston, and J.M.Crampton. 1992. "Gene expression in Echis carinatus (carpet viper) venom glands following milking." Toxicon. 30:379-386. Patthy,L. 2003. "Modular assembly of genes and the evolution of new functions." Genetica. 118:217-231. Pittman,D.D., K.N.Tomkinson, D.Michnick, U.Selighsohn, and R.J.Kaufman. 1994. "Posttranslational sulfation of factor V is required for efficient thrombin cleavage and activation and for full procoagulant activity." Biochemistry. 33:6952-6959. Rao,A. 2001. "New functions for DNA binding domains." Sci.STKE. 2001:e1. Rao,V.S., J.S.Joseph, and R.M.Kini. 2003a. "Group D prothrombin activators from snake venom are structural homologues of mammalian blood coagulation factor Xa." Biochem.J. 369:635-642. Rao,V.S. and R.M.Kini. 2002. "Pseutarin C, a prothrombin activator from Pseudonaja textilis venom: its structural and functional similarity to mammalian coagulation factor Xa-Va complex." Thromb.Haemost. 88:611-619. Rao,V.S., S.Swarup, and R.M.Kini. 2003b. "The nonenzymatic subunit of pseutarin C, a prothrombin activator from eastern brown snake (Pseudonaja textilis) venom, shows structural similarity to mammalian coagulation factor V." Blood. 102:1347-1354. Rao,V.S., S.Swarup, and R.M.Kini. 2004. "The catalytic subunit of pseutarin C, a group C prothrombin activator from the venom of Pseudonaja textilis, is structurally similar to mammalian blood coagulation factor Xa." Thromb.Haemost. 92:509-521. Reza,A., S.Swarup, and R.M.Kini. 2005a. "Two parallel prothrombin activator systems in Australian rough-scaled snake, Tropidechis carinatus. Structural comparison of venom prothrombin activator with blood coagulation factor X." Thromb.Haemost. 93:40-47. Reza,M.A., L.T.Minh, S.Swarup, and R.M.Kini. 2006. "Molecular evolution caught in action: gene duplication and evolution of molecular isoforms of prothrombin activators in Pseudonaja textilis (brown snake)." J.Thromb.Haemost. 4:1346-1353. Reza,M.A., S.Swarup, and R.M.Kini. 2005b. "Gene structures of trocarin D and coagulation factor X, two functionally diverse prothrombin activators from Australian rough scaled snake." Pathophysiol.Haemost.Thromb. 34:205-208. 156 Appendices Reza,M.A., S.Swarup, and R.M.Kini. 2007. "Structure of two genes encoding parallel prothrombin activators in Tropidechis carinatus snake: gene duplication and recruitment of factor X gene to the venom gland." J.Thromb.Haemost. 5:117-126. Rosing,J. and G.Tans. 1991. "Inventory of exogenous prothrombin activators. For the Subcommittee on Nomenclature of Exogenous Hemostatic Factors of the Scientific and Standardization Committee of the International Society on Thrombosis and Haemostasis." Thromb.Haemost. 65:627-630. Rosing,J. and G.Tans. 1992. "Structural and functional properties of snake venom prothrombin activators." Toxicon. 30:1515-1527. Rotenberg,D., E.S.Bamberger, and E.Kochva. 1971. "Studies on ribonucleic acid synthesis in the venom glands of Vipera palaestinae (Ophidia, Reptilia)." Biochem.J. 121:609-612. Rouquier,S., A.Blancher, and D.Giorgi. 2000. "The olfactory receptor gene repertoire in primates and mouse: evidence for reduction of the functional fraction in primates." Proc.Natl.Acad.Sci.U.S.A. 97:2870-2874. Ryan,A.K. and M.G.Rosenfeld. 1997. "POU domain family values: flexibility, partnerships, and developmental codes." Genes Dev. 11:1207-1225. Sato,S. and N.Tamiya. 1971. "The amino acid sequences of erabutoxins, neurotoxic proteins of sea-snake (Laticauda semifasciata) venom." Biochem.J. 122:453-461. Schieck,A., E.Habermann, and F.Kornalik. 1972. "The prothrombin-activating principle from Echis carinatus venom. II. Coagulation studies in vitro and in vivo." Naunyn Schmiedebergs Arch.Pharmacol. 274:7-17. Scholer,H.R. 1991. "Octamania: the POU factors in murine development." Trends Genet. 7:323-329. Schubeler,D., C.Mielke, K.Maass, and J.Bode. 1996. "Scaffold/matrix-attached regions act upon transcription in a context-dependent manner." Biochemistry. 35:11160-11169. Schweitz,H., P.Pacaud, S.Diochot, D.Moinier, and M.Lazdunski. 1999. "MIT(1), a black mamba toxin with a new and highly potent activity on intestinal contraction." FEBS Lett. 461:183-188. Shimojo,M. and L.B.Hersh. 2004. "Regulation of the cholinergic gene locus by the repressor element-1 silencing transcription factor/neuron restrictive silencer factor (REST/NRSF)." Life Sci. 74:2213-2225. 157 Appendices Silva,M.B., M.Schattner, C.R.Ramos, I.L.Junqueira-de-Azevedo, M.C.Guarnieri, M.A.Lazzari, C.A.Sampaio, R.G.Pozner, J.S.Ventura, P.L.Ho, and A.M.Chudzinski-Tavassi. 2003. "A prothrombin activator from Bothrops erythromelas (jararaca-da-seca) snake venom: characterization and molecular cloning." Biochem.J. 369:129-139. Snow,C.M., A.Senior, and L.Gerace. 1987. "Monoclonal antibodies identify a group of nuclear pore complex glycoproteins." J.Cell Biol. 104:1143-1156. Speijer,H., J.W.Govers-Riemslag, R.F.Zwaal, and J.Rosing. 1986. "Prothrombin activation by an activator from the venom of Oxyuranus scutellatus (Taipan snake)." J.Biol.Chem. 261:13258-13267. Spencer,C.A. and M.Groudine. 1990. "Transcription elongation and eukaryotic gene regulation." Oncogene. 5:777-785. Spilianakis,C.G., M.D.Lalioti, T.Town, G.R.Lee, and R.A.Flavell. 2005. "Interchromosomal associations between alternatively expressed loci." Nature. 435:637-645. St Pierre,L., P.P.Masci, I.Filippovich, N.Sorokina, N.Marsh, D.J.Miller, and M.F.Lavin. 2005. "Comparative analysis of prothrombin activators from the venom of Australian elapids." Mol.Biol.Evol. 22:1853-1864. Stenflo,J., A.Lundwall, and B.Dahlback. 1987. "beta-Hydroxyasparagine in domains homologous to the epidermal growth factor precursor in vitamin K-dependent protein S." Proc.Natl.Acad.Sci.U.S.A. 84:368-372. Stevenson,B.S. and T.M.Schmidt. 2004. "Life history implications of rRNA gene copy number in Escherichia coli." Appl.Environ.Microbiol. 70:6670-6677. Stocker,K., H.Hauer, C.Muller, and D.A.Triplett. 1994. "Isolation and characterization of Textarin, a prothrombin activator from eastern brown snake (Pseudonaja textilis) venom." Toxicon. 32:1227-1236. Strydom,D.J. 1973. "Snake venom toxins. Structure-function relationships and phylogenetics." Comp Biochem.Physiol B. 44:269-281. Sturm,R.A. and W.Herr. 1988. "The POU domain is a bipartite DNA-binding structure." Nature. 336:601-604. Suzuki,K., B.Dahlback, and J.Stenflo. 1982. "Thrombin-catalyzed activation of human coagulation factor V." J Biol Chem. 257:6556-6564. Tafuri,S.R. and A.P.Wolffe. 1990. "Xenopus Y-box transcription factors: molecular cloning, functional analysis and developmental regulation." Proc.Natl.Acad.Sci.U.S.A. 87:9028-9032. 158 Appendices Tans,G., J.W.Govers-Riemslag, J.L.van Rijn, and J.Rosing. 1985. "Purification and properties of a prothrombin activator from the venom of Notechis scutatus scutatus." J.Biol.Chem. 260:9366-9372. Thomm,M. 1996. "Archaeal transcription factors and their role in transcription initiation." FEMS Microbiol.Rev. 18:159-171. Thorelli,E., R.J.Kaufman, and B.Dahlback. 1998. "Cleavage requirements of factor V in tissue-factor induced thrombin generation." Thromb.Haemost. 80:92-98. TODD A.CASTOE, ALEXANDER W.POOLE, WANJUN GU, A.P.JASON de KONING, JUAN M.DAZA, ERIC N.SMITH, and DAVID D.POLLOCK. 2010. "Rapid identification of thousands of copperhead snake (Agkistrodon contortrix) microsatellite loci from modest amounts of 454 shotgun genome sequence." Molecular Ecology Resources. 10:341-347. Toulme,F., M.Guerin, N.Robichon, M.Leng, and A.R.Rahmouni. 1999. "In vivo evidence for back and forth oscillations of the transcription elongation complex." EMBO J. 18:5052-5060. Tsunemoto,K. and Y.Matsuo. 2001. "Molecular evolutionary analysis of a histone gene repeating unit from Drosophila simulans." Genes Genet.Syst. 76:355361. van der Neut,K.M., R.J.Dirven, H.L.Vos, G.Tans, J.Rosing, and R.M.Bertina. 2004. "Factor Va is inactivated by activated protein C in the absence of cleavage sites at Arg-306, Arg-506, and Arg-679." J Biol Chem. 279:6567-6575. van Drunen,C.M., R.W.Oosterling, G.M.Keultjes, P.J.Weisbeek, R.van Driel, and S.C.Smeekens. 1997. "Analysis of the chromatin domain organisation around the plastocyanin gene reveals an MAR-specific sequence element in Arabidopsis thaliana." Nucleic Acids Res. 25:3904-3911. Walker,F.J., W.G.Owen, and C.T.Esmon. 1980. "Characterization of the prothrombin activator from the venom of Oxyuranus scutellatus scutellatus (taipan venom)." Biochemistry. 19:1020-1023. Wang,C., M.Eufemi, C.Turano, and A.Giartosio. 1996. "Influence of the carbohydrate moiety on the stability of glycoproteins." Biochemistry. 35:7299-7307. Wang,D., D.A.Bushnell, X.Huang, K.D.Westover, M.Levitt, and R.D.Kornberg. 2009. "Structural basis of transcription: backtracked RNA polymerase II at 3.4 angstrom resolution." Science. 324:1203-1206. 159 Appendices Wegner,M., D.W.Drolet, and M.G.Rosenfeld. 1993. "POU-domain proteins: structure and function of developmental regulators." Curr.Opin.Cell Biol. 5:488-498. Welton,R.E. and J.N.Burnell. 2005. "Full length nucleotide sequence of a factor V-like subunit of oscutarin from Oxyuranus scutellatus scutellatus (coastal Taipan)." Toxicon. 46:328-336. Wey,E., G.E.Lyons, and B.W.Schafer. 1994. "A human POU domain gene, mPOU, is expressed in developing brain and specific adult tissues." Eur.J.Biochem. 220:753-762. Wey,E. and B.W.Schafer. 1996. "Identification of novel DNA binding sites recognized by the transcription factor mPOU (POU6F1)." Biochem.Biophys.Res.Commun. 220:274-279. Wilberding,J.A. and F.J.Castellino. 2000. "Characterization of the murine coagulation factor X promoter." Thromb.Haemost. 84:1031-1038. Will,K., G.Warnecke, N.Albrechtsen, T.Boulikas, and W.Deppert. 1998. "High affinity MAR-DNA binding is a common property of murine and human mutant p53." J.Cell Biochem. 69:260-270. Wray,G.A. 2007. "The evolutionary significance of cis-regulatory mutations." Nat.Rev.Genet. 8:206-216. Xu,X., X.S.Wang, X.T.Xi, J.Liu, J.T.Huang, and Z.X.Lu. 1982. "Purification and partial characterization of hyaluronidase from five pace snake (Agkistrodon acutus) venom." Toxicon. 20:973-981. Yamada,D. and T.Morita. 1997. "Purification and characterization of a Ca2+ dependent prothrombin activator, multactivase, from the venom of Echis multisquamatus." J.Biochem.(Tokyo). 122:991-997. Yu,L., X.Y.Wang, W.Jin, P.T.Luan, N.Ting, and Y.P.Zhang. 2010. "Adaptive evolution of digestive RNASE1 genes in leaf-eating monkeys revisited: new insights from ten additional colobines." Mol.Biol.Evol. 27:121-131. Zhang,Z. and M.Gerstein. 2004. "Large-scale analysis of pseudogenes in the human genome." Curr.Opin.Genet.Dev. 14:328-335. Zhou,C.Z. and B.Liu. 2001. "Identification and characterization of a silkglandrelated matrix association region in Bombyx mori." Gene. 277:139-144. Pang Shu Yi 2007. “Analysis of the Gene in the Parallel Prothrombin Activator Systems in Pseudonaja textilis” Honors Thesis. 160 Appendices LIST OF PUBLICATIONS Research Papers Shiyang Kwong, Woods AE, Mirtschin PJ, Ge R, Kini RM. (2009). The recruitment of blood coagulation factor X into snake venom gland as a toxin: the role of promoter cis-elements in its expression. Thrombosis and Haemostasis, 102(3):469-78 Shiyang Kwong, M. Abu Reza, R. Manjunatha Kini (2007). Book title: “ANIMAL TOXINS: STATE OF THE ART. Perspectives in Health and Biotechnology” Major Editor Maria Elena Lima. .EDITORAufmg. Chapter Title: “Origin and Evolution of Group C and D Prothrombin Activators from Snake Venom” Editora UFMG. page 559-73 Patents Ref: 09151N-US/PRV; US Provisional Application No. 61/176,504; Title: Novel Promoter Sequence for Elevated Expression in Mammalian System. R. Manjunatha Kini, M. Abu Reza, Sanjay Swarup, Shiyang Kwong. (2009) Conference Posters Shiyang Kwong and Prof. R.M. Kini. (2007) Gene Regulation of Trocarin D, a Venom Prothrombin Activator from the Snake Tropidechis carinatus. Poster presentation at the 12th Biological Sciences Graduate Congress, Malaysia, Kuala Lumpur. Achievement: Best Poster Award Shiyang Kwong and Prof. R.M. Kini. (2007) Gene Regulation of Trocarin D, a Venom Prothrombin Activator from the Snake Tropidechis carinatus. Poster presentation at the 8th Sino-Singapore Conference in Biotechnology, Singapore. 161 Appendices List of Primers Used for Making VERSE Constructs Primers VERSE Forward VERSE Reverse mGATA mYbox Nucleotide sequences 5' TCG GGTACC TGTACTTGTTTGCATACTCG 3' 5’ AGC GCTAGC GGTGCCTATCGATG 3’ 5' GCTTAACGATTGGTACATTACAACAGTTC 3' 5’ GTTTTAAATAAATGCCATCTGTTGCGA GCCGCGAGC 3’ 5’ CCGCTATCCAAGGGGCTGCCGC 3’ mTLB2 5' GGAGTTTTATTTACATGCCATTGGTTGC 3' mTLB3 5’ CCTATTAGACGGACACCATCGC 3’ mSup 5’ CAGGTCTGATTAGCCGC 3’ mUp1 5’ TAACACTGAATCCCTATTGG 3’ mUp2 Universal Primer 5’ CTAATACGACTCACTATAGGGC 3’ Nested Universal Primer 5’ AAGCAGTGGTATCAACGCAGAGT 3’ 5'GSP1 5' CACAAGCGGTGCGGTGCGGTAGGGCTACG 3' 5'GSP2 5’ GTCGGTCTTGCTATCCATGATGATGATC 3’ Constructs VERSE mGATA mYbox mTLB2 mTLB3 mSup mUp1 mUp2 Primers used in PCR reactions VERSE Forward and VERSE Reverse VERSE Forward, mGATA and VERSE Reverse VERSE Forward, mYbox and VERSE Reverse VERSE Forward, mTLB1and VERSE Reverse VERSE Forward, mTLB2 and VERSE Reverse VERSE Forward, mSup and VERSE Reverse VERSE Forward, mUp1 and VERSE Reverse VERSE Forward, mUp2 and VERSE Reverse 162 [...]... spectrum of the PMF Figure 4.5: A Peptide mass fingerprinting (PMF) of the 35 kDa protein from the Sup DNA-affinity chromatography profile A Sequence coverage of the polypeptides against POU class 6 homeobox 1 (gi|223890225) C The spectrum of the PMF x LIST OF TABLES Chapter One Table 1.1: Classification of snake venom prothrombin activators Table 1.2: Comparison of the venom and plasma prothrombin activators. .. expression in the venom gland This whole process is broadly termed as venom recruitment” These genetic differences highlighted between trocarin D and TrFX give us an opportunity to characterize them for their regulatory properties, and therefore, understand the gene regulation of snake venom prothrombin activators This recruitment of trocarin D from TrFX is one of the many instances which snake venom toxins... their cofactor requirements and products produced to endogenous prothrombin activators such as factor Xa (FXa) (Table 1.1) The structures of group C and D procoagulant proteins were determined to get a detailed understanding of the structure-function relationships of not only snake venom prothrombin activators, but also that of mammalian blood coagulation factors The size of group D prothrombin activators. .. outcome of gene duplication is the creation of new novel gene functions During neofunctionalization, the duplicated gene which is free from selection pressure gains mutations which alter its gene function The duplicated gene evolves either a new function, or in most cases, one which is related to that of its parent An example of neofunctionalization can be seen in the three-finger toxin (3FTX) multigene... that venom proteins originate from body proteins whose genes have been “recruited” into the venom gland transcriptome by gene duplication One of the first observations of venom recruitment” by gene duplication was that 3FTX venom proteins had evolved and diversified from a single ribonuclease ancestor (Strydom 1973) This “recruitment” process has not only been observed in snakes but also in venoms of. .. contribution of gene duplication is the production of new genetic material for evolution to modify and generate new genes with new functions This allows an organism to constantly adapt and survive when changes occur in its environment The human genome has about 40 000 genes, out of which approximately 38% of them are duplicated genes (Li et al 2001b) For example, one of the largest multigene families... group C prothrombin activators, trocarin D from Tropidechis carinatus venom was characterized as a representative of group D prothrombin activators (Joseph et al 1999; Joseph and Kini 2004; Rao et al 2003a) Subsequently, pseutarin C from Pseudonaja textilis venom was characterized as an example of group C prothrombin activators (Rao et al 2003b; Rao et al 2004; Rao and Kini 2002) Group D Prothrombin Activators. .. structure Pseudogenes can be found in approximately half of all mammalian protein families with the greatest representation found in housekeeping and ribosomal families of genes (Zhang and Gerstein 2004) A good example of this process can be observed in the human olfactory receptor gene family which more than 60% of the genes are pseudogenes (Rouquier et al 2000) This could be an outcome of a relaxation... expression of the venom toxins has to be inducible as the toxins need to be expressed only when the glands are empty and stopped when the glands are full Also, as the venom is usually an important component of the snake s defense and offense, the venom toxins need to be replenished quickly when the venom gland is emptied (Paine et al 1992; Rotenberg et al 1971) The venom toxins have elevated levels of expression... first member of this group, notecarin, was isolated and characterized by Rosing and his coworkers from Notechis scutatus scutatus venom (Tans et al 1985) Since then, similar prothrombin activators have been characterized from several other snake venoms Group D prothrombin activators are glycoproteins with a molecular weight of ~50 kDa (Table 1.1) They are found exclusively in Australian elapid snakes (Rosing . therefore, understand the gene regulation of snake venom prothrombin activators. This recruitment of trocarin D from TrFX is one of the many instances which snake venom toxins have evolved. Classification of snake venom prothrombin activators. Table 1.2: Comparison of the venom and plasma prothrombin activators. Chapter Three Table 3.1: BLASTN analysis of Ins2.2.4 against. GENE REGULATION OF SNAKE VENOM PROTHROMBIN ACTIVATORS KWONG SHIYANG B.SC. (HONS.), NUS A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF