The role of b cells in the pathogenesis of atherosclerosis

3.9 Evaluation of humoral responses being associated with hypercholesterolemic setting in the apoE-/- mice In many studies, the deletion/defective of certain genes led to autoimmune disorder. For example, SLE mice models such as in MRL/lpr mice where CD95 is defective due to lpr mutation (Shlomchik et al., 1987) lead to high autoantibodies production and in Roquinsan/san mice where the excessive accumulation of follicular T helper cells in the GCs lead to autoantibodies production (Linterman et al., 2009). Therefore, elevated titer of oxLDL-specific IgM antibodies could be a spontaneous consequence of lack of APOE. Therefore, it is imperative to investigate whether the elevated IgM antibodies response is directly associated with the progression of the disease and not due to the APOE deficiency. In order to investigate this hypothesis, we impeded the progression of the disease by using a blood cholesterol-lowering drug, ezetimibe. The drug targets the molecule Niemann-Pick C1 Like (NPC1L1) and, inhibits the uptake and absorption of dietary cholesterol in the intestine to be excreted out (Garcia-Calvo et al., 2005). Thus, the administration of ezetimibe to apoE-/mice led to amelioration of the disease (Nakagami et al., 2009). Therefore, in our disease regression model, 12 weeks old apoE-/- mice, which already exhibit certain extent of the disease, were administered with ezetimibe via oral gavage daily as therapeutic intervention for 12 weeks before analysis. 142 3.9.1 Evaluation of total IgM and oxLDL-specific IgM autoantibodies in apoE-/- mice after ezetimibe treatment Plasma of the treated mice was examined after ezetimibe treatment. Non-treated apoE-/- and non-treated WT mice were administered with corn oil, the vehicle for ezetimibe. Our ELISA data had shown that with ezetimibe treatment, the amount of total IgM antibodies in the apoE-/- mice had decreased to the level of WT control mice compared to non-treated apoE-/mice (Figure 32A). When oxLDL-specific IgM was examined in the plasma, ezetimibe treated apoE-/- mice had lower titer compared to non-treated apoE-/mice and the titer was similar to that of control groups: non-treated WT and WT mice (Figure 32B). The amount of total IgM and oxLDL-specific IgM autoantibodies in the non-treated WT was similar to that of WT control mice, suggesting the vehicle does not alter the level of total IgM (Figure 32A & 32B). Therefore, the vehicle alone was no longer administered in non-treated mice and only groups of mice were used for our subsequent disease regression experiments; non-treated apoE-/-, treated apoE-/- and WT. Thus, our data on the plasma suggests that the elevated total IgM and oxLDL-specific IgM autoantibodies in apoE-/- mice was associated with hypercholesterolemia. 143 Figure 32. Total IgM and oxLDL-specific IgM autoantibodies were associated with hypercholesterolemia. (A) Quantification of total IgM in plasma determined by ELISA (mean ± SEM; n=8-10). Data were pooled from two independent experiments. (B) Plasma IgM titres against oxLDL determined by ELISA (n=5-7). * P < 0.05; ** P < 0.01; *** P < 0.001 144 3.9.2 Evaluation of splenic extrafollicular responses in apoE-/- mice after ezetimibe treatment Having established that the total IgM and oxLDL-specific IgM autoantibodies in the plasma of apoE-/- mice had decreased after ezetimibe treatment, we next examined if this was due to reduced extent of extrafollicular responses in the spleen of the treated mice. Indeed, our immunofluorescence staining of the spleen to reveal extrafollicular responses showed that there were a reduced number of extrafollicular response sites being identified compared to the non-treated apoE-/- mice (Figure 33A). When quantification of the extent of extrafollicular responses was performed, we observed statistical significant decrease of the extrafollicular responses in the treated apoE-/- mice, similar to that of the WT control mice (Figure 33B). Therefore, robust extrafollicular responses in the spleen was a consequence of hypercholesterolemia to produce elevated amount of total IgM and oxLDL-specific IgM autoantibodies in the plasma of apoE-/- mice. 145 Figure 33. Splenic extrafollicular responses were associated with hypercholesterolemia. (A) Representative images of area analyzed for extrafollicular sites identified (white circles) in which CD138+ plasmablasts (red) colocalized with CD11c+ DCs (blue) at bridging channel of B220+ follicles (green) between non-treated apoE-/- (n=4), treated apoE-/- (n=6) and WT (n=6). Scale bar denotes 500 µm; 100X magnification. (B) Quantification of extrafollicular responses sites in spleen after ezetimibe treatment (n=4-6). Data were pooled from three independent experiments. *** P < 0.001 146 3.9.3 Evaluation of IgM+ antibody secreting cells in the spleen of apoE-/mice after ezetimibe treatment Our earlier studies established that there was an increased frequency of total IgM and oxLDL-specific IgM ASCs present in the spleen of apoE-/- mice (Figure 19A & 19B, left). Together with the observations that in the spleen of apoE-/- mice treated with ezetimibe had decreased extent of extrafollicular responses, prompted us to investigate if the frequency of IgM+ ASCs would be affected. Our ELISpot analysis on the frequency of total IgM ASCs in the spleen of treated apoE-/- mice displayed similar frequency to that of nontreated apoE-/- mice but a non-statistical significant increase in frequency when compared to WT control mice (Figure 34A). In addition, when we examined for oxLDL-specific IgM+ ASCs, the frequency of treated apoE-/was similar to that of non-treated apoE-/- and still maintained its statistical significant increase compared to WT control mice (Figure 34B). While the frequency of total IgM and oxLDL-specific IgM ASCs remained essentially unchanged between non-treated and treated apoE-/- mice, we investigated if the amount of IgM antibodies secreted was affected to account for the decreased in total IgM and oxLDL-specific IgM antibodies in circulation. ELISA analysis of in vitro culture supernatant of splenocytes from treated apoE-/- revealed a non-statistical decrease but almost two-fold lower production of total IgM antibodies compared to non-treated apoE-/- mice (Figure 34C). ELISA analysis on the oxLDL-specific IgM autoantibodies production from the in vitro culture supernatant of treated apoE-/- mice 147 revealed a statistical significant decrease in titer compared non-treated apoE-/mice. Therefore, our data on IgM+ ASCs indicates that while the frequency of total IgM and oxLDL-specific IgM ASCs remained unchanged after ezetimibe treatment, the IgM antibodies production from ASCs from treated apoE-/- mice was decreased. This further suggests that IgM antibodies production per cell basis was lower in the treated apoE-/- mice. However, the spots identified to denote frequency of ASCs in ELISpot analysis not necessarily equate one spot is equivalent to one cell. In other words, cells that are capable of proliferation to form many cells could still form a single spot analogous to a bacteria colony forming assay experiment. Together with earlier findings that splenic extrafollicular responses, where plasmablasts proliferate and differentiate into plasma cells, were lower in treated apoE-/mice compared to non-treated apoE-/- mice, we reasoned that the lower IgM antibodies production from the culture supernatant of splenocytes from treated apoE-/- mice was due to a lack of proliferation of these IgM+ ASCs. Indeed, in our EdU-pulsed chase experiment, we observed a lower percentage and number of B220-CD138+EdU+IgM+ plasma cells in the spleen of treated apoE/- mice, supporting our hypothesis that proliferating IgM+ ASCs provided massive amount of total IgM and oxLDL-specific IgM autoantibodies in apoE/- mice (Figure 34E & 34F). 148 Figure 34. Elevated total IgM and anti-oxLDL IgM autoantibodies were mostly contributed by proliferating IgM+ ASCs. (A-B) Frequency of splenic (A) total IgM and (B) anti-oxLDL specific IgM per million cells in non-treated apoE-/- (n=15), treated apoE-/- (n=17) and WT mice (n=19) determined by ELISpot. Data were pooled from five independent experiments. (C-D) Quantification of (C) total IgM and (D) anti-oxLDL IgM in culture supernatant of splenocytes from non-treated apoE-/- (n=7), treated apoE-/- (n=8) and WT mice (n=10) determined by ELISA. (E-F) Comparative flow cytometry analysis on (E) percentage and (F) number of B220CD138+EdU+IgM+ plasma cells in spleen of non-treated apoE-/- (n=3), treated apoE-/- (n=3) and WT mice (n=3). * P < 0.05 149 3.9.4 Evaluation of GC in the lymph node compartment of apoE-/- mice From our observations, we noted LN hypertrophy in the LN compartment in apoE-/- mice (Figure 14). This was associated with increased GC reactions as the dominant antibody-producing pathway in these LNs (Figure 16C, 16D, 17C & 17D). As we had established that the robust extrafollicular responses to generate proliferating IgM+ plasmablasts in the spleen of apoE-/- mice were associated with hypercholesterolemia (Figure 33 & 34), we next examined if hypertrophy and GC reactions in the LN compartments were also associated with hypercholesterolemia. After ezetimibe treatment, the cellularity for treated apoE-/- mice decreased significantly in the axillary and brachial LN compared to nontreated apoE-/- mice (Figure 35A). Similar decrease cellularity, but not statistically significant, was also observed in the iliac LNs of ezetimibe treated apoE-/- mice when compared to non-treated apoE-/- mice (Figure 35B). Therefore, our disease regression model indicated LN hypertrophy was associated with hypercholesterolemia. Next, we investigated if ezetimibe treatment had an effect on the expansion of GC B cells in the LN compartment by flow cytometry. Our results demonstrated that there were no differences in the relative percentage of GC B cells between axillary and brachial, and iliac LNs in treated apoE-/and non-treated apoE-/- (Figure 36A & 36B, left). However, statistical significant decrease in relative number of GC B cells were noted in treated apoE-/- mice, similar to WT mice when compared to non-treated apoE-/- mice (Figure 36A, right). Similar observations of decreased relative number of GC 150 B cells were also observed in the iliac LNs, albeit non-statistically significant (Figure 36B, right). Lastly, we examined the effect of ezetimibe on the GC reactions in the LNs of apoE-/- mice by immunofluorescence staining. Our data showed that GC reactions could still be observed in the LNs of treated apoE-/- mice but they were noticeably smaller (Figure 37, inset) when compared to non-treated apoE-/- mice (Figure 37). 151 Reif, K., Ekland, E.H., Ohl, L., Nakano, H., Lipp, M., Forster, R., and Cyster, J.G. (2002). Balanced responsiveness to chemoattractants from adjacent zones determines B-‐cell position. Nature 416, 94-‐99. Reimold, A.M., Iwakoshi, N.N., Manis, J., Vallabhajosyula, P., Szomolanyi-‐ Tsuda, E., Gravallese, E.M., Friend, D., Grusby, M.J., Alt, F., and Glimcher, L.H. (2001). Plasma cell differentiation requires the transcription factor XBP-‐1. Nature 412, 300-‐307. Reinhardt, R.L., Liang, H.E., and Locksley, R.M. (2009). Cytokine-‐secreting follicular T cells shape the antibody repertoire. Nat Immunol 10, 385-‐393. Rodriguez Gomez, M., Talke, Y., Goebel, N., Hermann, F., Reich, B., and Mack, M. (2010). Basophils support the survival of plasma cells in mice. J Immunol 185, 7180-‐7185. Rozanski, C.H., Arens, R., Carlson, L.M., Nair, J., Boise, L.H., Chanan-‐Khan, A.A., Schoenberger, S.P., and Lee, K.P. (2011). Sustained antibody responses depend on CD28 function in bone marrow-‐resident plasma cells. J Exp Med 208, 1435-‐1446. Russell, D.W. (2003). The enzymes, regulation, and genetics of bile acid synthesis. Annu Rev Biochem 72, 137-‐174. Sage, A.P., Tsiantoulas, D., Baker, L., Harrison, J., Masters, L., Murphy, D., Loinard, C., Binder, C.J., and Mallat, Z. (2012). BAFF receptor deficiency reduces the development of atherosclerosis in mice-‐-‐brief report. Arterioscler Thromb Vasc Biol 32, 1573-‐1576. Sasaki, Y., Casola, S., Kutok, J.L., Rajewsky, K., and Schmidt-‐Supprian, M. (2004). TNF family member B cell-‐activating factor (BAFF) receptor-‐ 215 dependent and -‐independent roles for BAFF in B cell physiology. J Immunol 173, 2245-‐2252. Schaefer, E.J., Gregg, R.E., Ghiselli, G., Forte, T.M., Ordovas, J.M., Zech, L.A., and Brewer, H.B., Jr. (1986). Familial apolipoprotein E deficiency. J Clin Invest 78, 1206-‐1219. Schneider, P., Takatsuka, H., Wilson, A., Mackay, F., Tardivel, A., Lens, S., Cachero, T.G., Finke, D., Beermann, F., and Tschopp, J. (2001). Maturation of marginal zone and follicular B cells requires B cell activating factor of the tumor necrosis factor family and is independent of B cell maturation antigen. J Exp Med 194, 1691-‐1697. Schwab, S.R., and Cyster, J.G. (2007). Finding a way out: lymphocyte egress from lymphoid organs. Nat Immunol 8, 1295-‐1301. Schwab, S.R., Pereira, J.P., Matloubian, M., Xu, Y., Huang, Y., and Cyster, J.G. (2005). Lymphocyte sequestration through S1P lyase inhibition and disruption of S1P gradients. Science 309, 1735-‐1739. Schwickert, T.A., Alabyev, B., Manser, T., and Nussenzweig, M.C. (2009). Germinal center reutilization by newly activated B cells. J Exp Med 206, 2907-‐2914. Schwickert, T.A., Lindquist, R.L., Shakhar, G., Livshits, G., Skokos, D., Kosco-‐ Vilbois, M.H., Dustin, M.L., and Nussenzweig, M.C. (2007). In vivo imaging of germinal centres reveals a dynamic open structure. Nature 446, 83-‐87. Schwickert, T.A., Victora, G.D., Fooksman, D.R., Kamphorst, A.O., Mugnier, M.R., Gitlin, A.D., Dustin, M.L., and Nussenzweig, M.C. (2011). A dynamic T cell-‐limited checkpoint regulates affinity-‐dependent B cell entry into the germinal center. J Exp Med 208, 1243-‐1252. 216 Shaffer, A.L., Lin, K.I., Kuo, T.C., Yu, X., Hurt, E.M., Rosenwald, A., Giltnane, J.M., Yang, L., Zhao, H., Calame, K., and Staudt, L.M. (2002). Blimp-‐1 orchestrates plasma cell differentiation by extinguishing the mature B cell gene expression program. Immunity 17, 51-‐62. Shaffer, A.L., Shapiro-‐Shelef, M., Iwakoshi, N.N., Lee, A.H., Qian, S.B., Zhao, H., Yu, X., Yang, L., Tan, B.K., Rosenwald, A., et al. (2004). XBP1, downstream of Blimp-‐1, expands the secretory apparatus and other organelles, and increases protein synthesis in plasma cell differentiation. Immunity 21, 81-‐93. Shaffer, A.L., Yu, X., He, Y., Boldrick, J., Chan, E.P., and Staudt, L.M. (2000). BCL-‐6 represses genes that function in lymphocyte differentiation, inflammation, and cell cycle control. Immunity 13, 199-‐212. Shapiro-‐Shelef, M., and Calame, K. (2005). Regulation of plasma-‐cell development. Nat Rev Immunol 5, 230-‐242. Shapiro-‐Shelef, M., Lin, K.I., McHeyzer-‐Williams, L.J., Liao, J., McHeyzer-‐ Williams, M.G., and Calame, K. (2003). Blimp-‐1 is required for the formation of immunoglobulin secreting plasma cells and pre-‐plasma memory B cells. Immunity 19, 607-‐620. Shaw, P.X., Horkko, S., Chang, M.K., Curtiss, L.K., Palinski, W., Silverman, G.J., and Witztum, J.L. (2000). Natural antibodies with the T15 idiotype may act in atherosclerosis, apoptotic clearance, and protective immunity. J Clin Invest 105, 1731-‐1740. Shih, P.T., Elices, M.J., Fang, Z.T., Ugarova, T.P., Strahl, D., Territo, M.C., Frank, J.S., Kovach, N.L., Cabanas, C., Berliner, J.A., and Vora, D.K. (1999). Minimally modified low-‐density lipoprotein induces monocyte adhesion 217 to endothelial connecting segment-‐1 by activating beta1 integrin. J Clin Invest 103, 613-‐625. Shih, T.A., Meffre, E., Roederer, M., and Nussenzweig, M.C. (2002). Role of BCR affinity in T cell dependent antibody responses in vivo. Nat Immunol 3, 570-‐575. Shlomchik, M.J., Marshak-‐Rothstein, A., Wolfowicz, C.B., Rothstein, T.L., and Weigert, M.G. (1987). The role of clonal selection and somatic mutation in autoimmunity. Nature 328, 805-‐811. Shokat, K.M., and Goodnow, C.C. (1995). Antigen-‐induced B-‐cell death and elimination during germinal-‐centre immune responses. Nature 375, 334-‐ 338. Silaste, M.L., Rantala, M., Alfthan, G., Aro, A., Witztum, J.L., Kesaniemi, Y.A., and Horkko, S. (2004). Changes in dietary fat intake alter plasma levels of oxidized low-‐density lipoprotein and lipoprotein(a). Arterioscler Thromb Vasc Biol 24, 498-‐503. Slifka, M.K., Antia, R., Whitmire, J.K., and Ahmed, R. (1998). Humoral immunity due to long-‐lived plasma cells. Immunity 8, 363-‐372. Smith, J.D., Trogan, E., Ginsberg, M., Grigaux, C., Tian, J., and Miyata, M. (1995). Decreased atherosclerosis in mice deficient in both macrophage colony-‐stimulating factor (op) and apolipoprotein E. Proc Natl Acad Sci U S A 92, 8264-‐8268. Smith, K.G., Hewitson, T.D., Nossal, G.J., and Tarlinton, D.M. (1996). The phenotype and fate of the antibody-‐forming cells of the splenic foci. Eur J Immunol 26, 444-‐448. 218 Smith, K.G., Light, A., Nossal, G.J., and Tarlinton, D.M. (1997). The extent of affinity maturation differs between the memory and antibody-‐forming cell compartments in the primary immune response. EMBO J 16, 2996-‐ 3006. Snapper, C.M., Shen, Y., Khan, A.Q., Colino, J., Zelazowski, P., Mond, J.J., Gause, W.C., and Wu, Z.Q. (2001). Distinct types of T-‐cell help for the induction of a humoral immune response to Streptococcus pneumoniae. Trends Immunol 22, 308-‐311. Stewart, C.R., Stuart, L.M., Wilkinson, K., van Gils, J.M., Deng, J., Halle, A., Rayner, K.J., Boyer, L., Zhong, R., Frazier, W.A., et al. (2010). CD36 ligands promote sterile inflammation through assembly of a Toll-‐like receptor and 6 heterodimer. Nat Immunol 11, 155-‐161. Su, J., Georgiades, A., Wu, R., Thulin, T., de Faire, U., and Frostegard, J. (2006). Antibodies of IgM subclass to phosphorylcholine and oxidized LDL are protective factors for atherosclerosis in patients with hypertension. Atherosclerosis 188, 160-‐166. Swanson, C.L., Wilson, T.J., Strauch, P., Colonna, M., Pelanda, R., and Torres, R.M. (2010). Type I IFN enhances follicular B cell contribution to the T cell-‐independent antibody response. J Exp Med 207, 1485-‐1500. Sweet, R.A., Christensen, S.R., Harris, M.L., Shupe, J., Sutherland, J.L., and Shlomchik, M.J. (2010). A new site-‐directed transgenic rheumatoid factor mouse model demonstrates extrafollicular class switch and plasmablast formation. Autoimmunity 43, 607-‐618. 219 Sze, D.M., Toellner, K.M., Garcia de Vinuesa, C., Taylor, D.R., and MacLennan, I.C. (2000). Intrinsic constraint on plasmablast growth and extrinsic limits of plasma cell survival. J Exp Med 192, 813-‐821. Tabas, I. (2010). Macrophage death and defective inflammation resolution in atherosclerosis. Nat Rev Immunol 10, 36-‐46. Tabas, I., Williams, K.J., and Boren, J. (2007). Subendothelial lipoprotein retention as the initiating process in atherosclerosis: update and therapeutic implications. Circulation 116, 1832-‐1844. Tangye, S.G. (2011). Staying alive: regulation of plasma cell survival. Trends Immunol 32, 595-‐602. Thompson, J.S., Schneider, P., Kalled, S.L., Wang, L., Lefevre, E.A., Cachero, T.G., MacKay, F., Bixler, S.A., Zafari, M., Liu, Z.Y., et al. (2000). BAFF binds to the tumor necrosis factor receptor-‐like molecule B cell maturation antigen and is important for maintaining the peripheral B cell population. J Exp Med 192, 129-‐135. Toellner, K.M., Gulbranson-‐Judge, A., Taylor, D.R., Sze, D.M., and MacLennan, I.C. (1996). Immunoglobulin switch transcript production in vivo related to the site and time of antigen-‐specific B cell activation. J Exp Med 183, 2303-‐2312. Tokoyoda, K., Egawa, T., Sugiyama, T., Choi, B.I., and Nagasawa, T. (2004). Cellular niches controlling B lymphocyte behavior within bone marrow during development. Immunity 20, 707-‐718. Toyama, H., Okada, S., Hatano, M., Takahashi, Y., Takeda, N., Ichii, H., Takemori, T., Kuroda, Y., and Tokuhisa, T. (2002). Memory B cells without 220 somatic hypermutation are generated from Bcl6-‐deficient B cells. Immunity 17, 329-‐339. Tsimikas, S., Aikawa, M., Miller, F.J., Jr., Miller, E.R., Torzewski, M., Lentz, S.R., Bergmark, C., Heistad, D.D., Libby, P., and Witztum, J.L. (2007a). Increased plasma oxidized phospholipid:apolipoprotein B-‐100 ratio with concomitant depletion of oxidized phospholipids from atherosclerotic lesions after dietary lipid-‐lowering: a potential biomarker of early atherosclerosis regression. Arterioscler Thromb Vasc Biol 27, 175-‐181. Tsimikas, S., Brilakis, E.S., Lennon, R.J., Miller, E.R., Witztum, J.L., McConnell, J.P., Kornman, K.S., and Berger, P.B. (2007b). Relationship of IgG and IgM autoantibodies to oxidized low density lipoprotein with coronary artery disease and cardiovascular events. J Lipid Res 48, 425-‐ 433. Tsimikas, S., Witztum, J.L., Miller, E.R., Sasiela, W.J., Szarek, M., Olsson, A.G., and Schwartz, G.G. (2004). High-‐dose atorvastatin reduces total plasma levels of oxidized phospholipids and immune complexes present on apolipoprotein B-‐100 in patients with acute coronary syndromes in the MIRACL trial. Circulation 110, 1406-‐1412. Tung, J.W., Mrazek, M.D., Yang, Y., and Herzenberg, L.A. (2006). Phenotypically distinct B cell development pathways map to the three B cell lineages in the mouse. Proc Natl Acad Sci U S A 103, 6293-‐6298. Tunyaplin, C., Shaffer, A.L., Angelin-‐Duclos, C.D., Yu, X., Staudt, L.M., and Calame, K.L. (2004). Direct repression of prdm1 by Bcl-‐6 inhibits plasmacytic differentiation. J Immunol 173, 1158-‐1165. 221 Turner, C.A., Jr., Mack, D.H., and Davis, M.M. (1994). Blimp-‐1, a novel zinc finger-‐containing protein that can drive the maturation of B lymphocytes into immunoglobulin-‐secreting cells. Cell 77, 297-‐306. Vallerskog, T., Gunnarsson, I., Widhe, M., Risselada, A., Klareskog, L., van Vollenhoven, R., Malmstrom, V., and Trollmo, C. (2007). Treatment with rituximab affects both the cellular and the humoral arm of the immune system in patients with SLE. Clin Immunol 122, 62-‐74. van der Kolk, L.E., Baars, J.W., Prins, M.H., and van Oers, M.H. (2002). Rituximab treatment results in impaired secondary humoral immune responsiveness. Blood 100, 2257-‐2259. van Leeuwen, M., Damoiseaux, J., Duijvestijn, A., and Tervaert, J.W. (2009). The therapeutic potential of targeting B cells and anti-‐oxLDL antibodies in atherosclerosis. Autoimmun Rev 9, 53-‐57. Veniant, M.M., Zlot, C.H., Walzem, R.L., Pierotti, V., Driscoll, R., Dichek, D., Herz, J., and Young, S.G. (1998). Lipoprotein clearance mechanisms in LDL receptor-‐deficient "Apo-‐B48-‐only" and "Apo-‐B100-‐only" mice. J Clin Invest 102, 1559-‐1568. Victora, G.D., Schwickert, T.A., Fooksman, D.R., Kamphorst, A.O., Meyer-‐ Hermann, M., Dustin, M.L., and Nussenzweig, M.C. (2010). Germinal center dynamics revealed by multiphoton microscopy with a photoactivatable fluorescent reporter. Cell 143, 592-‐605. Vieira, P., and Rajewsky, K. (1988). The half-‐lives of serum immunoglobulins in adult mice. Eur J Immunol 18, 313-‐316. Vinuesa, C.G., and Chang, P.P. (2013). Innate B cell helpers reveal novel types of antibody responses. Nat Immunol 14, 119-‐126. 222 Vinuesa, C.G., Sanz, I., and Cook, M.C. (2009). Dysregulation of germinal centres in autoimmune disease. Nat Rev Immunol 9, 845-‐857. Walton, L.J., Powell, J.T., and Parums, D.V. (1997). Unrestricted usage of immunoglobulin heavy chain genes in B cells infiltrating the wall of atherosclerotic abdominal aortic aneurysms. Atherosclerosis 135, 65-‐71. Wardemann, H., Boehm, T., Dear, N., and Carsetti, R. (2002). B-‐1a B cells that link the innate and adaptive immune responses are lacking in the absence of the spleen. J Exp Med 195, 771-‐780. Watanabe, M., Sangawa, A., Sasaki, Y., Yamashita, M., Tanaka-‐Shintani, M., Shintaku, M., and Ishikawa, Y. (2007). Distribution of inflammatory cells in adventitia changed with advancing atherosclerosis of human coronary artery. J Atheroscler Thromb 14, 325-‐331. Weber, C., Zernecke, A., and Libby, P. (2008). The multifaceted contributions of leukocyte subsets to atherosclerosis: lessons from mouse models. Nat Rev Immunol 8, 802-‐815. Wehrli, N., Legler, D.F., Finke, D., Toellner, K.M., Loetscher, P., Baggiolini, M., MacLennan, I.C., and Acha-‐Orbea, H. (2001). Changing responsiveness to chemokines allows medullary plasmablasts to leave lymph nodes. Eur J Immunol 31, 609-‐616. Wiklund, O., Witztum, J.L., Carew, T.E., Pittman, R.C., Elam, R.L., and Steinberg, D. (1987). Turnover and tissue sites of degradation of glucosylated low density lipoprotein in normal and immunized rabbits. J Lipid Res 28, 1098-‐1109. 223 William, J., Euler, C., Christensen, S., and Shlomchik, M.J. (2002). Evolution of autoantibody responses via somatic hypermutation outside of germinal centers. Science 297, 2066-‐2070. Willnow, T.E., Nykjaer, A., and Herz, J. (1999). Lipoprotein receptors: new roles for ancient proteins. Nat Cell Biol 1, E157-‐162. Winter, O., Moser, K., Mohr, E., Zotos, D., Kaminski, H., Szyska, M., Roth, K., Wong, D.M., Dame, C., Tarlinton, D.M., et al. (2010). Megakaryocytes constitute a functional component of a plasma cell niche in the bone marrow. Blood 116, 1867-‐1875. Won, W.J., Bachmann, M.F., and Kearney, J.F. (2008). CD36 is differentially expressed on B cell subsets during development and in responses to antigen. J Immunol 180, 230-‐237. Xiang, Z., Cutler, A.J., Brownlie, R.J., Fairfax, K., Lawlor, K.E., Severinson, E., Walker, E.U., Manz, R.A., Tarlinton, D.M., and Smith, K.G. (2007). FcgammaRIIb controls bone marrow plasma cell persistence and apoptosis. Nat Immunol 8, 419-‐429. Yang, Y., Tung, J.W., Ghosn, E.E., and Herzenberg, L.A. (2007). Division and differentiation of natural antibody-‐producing cells in mouse spleen. Proc Natl Acad Sci U S A 104, 4542-‐4546. Ye, B.H., Cattoretti, G., Shen, Q., Zhang, J., Hawe, N., de Waard, R., Leung, C., Nouri-‐Shirazi, M., Orazi, A., Chaganti, R.S., et al. (1997). The BCL-‐6 proto-‐ oncogene controls germinal-‐centre formation and Th2-‐type inflammation. Nat Genet 16, 161-‐170. Yi, T., Wang, X., Kelly, L.M., An, J., Xu, Y., Sailer, A.W., Gustafsson, J.A., Russell, D.W., and Cyster, J.G. (2012). Oxysterol gradient generation by 224 lymphoid stromal cells guides activated B cell movement during humoral responses. Immunity 37, 535-‐548. Yoshida, T., Mei, H., Dorner, T., Hiepe, F., Radbruch, A., Fillatreau, S., and Hoyer, B.F. (2010). Memory B and memory plasma cells. Immunol Rev 237, 117-‐139. Yu, D., Rao, S., Tsai, L.M., Lee, S.K., He, Y., Sutcliffe, E.L., Srivastava, M., Linterman, M., Zheng, L., Simpson, N., et al. (2009). The transcriptional repressor Bcl-‐6 directs T follicular helper cell lineage commitment. Immunity 31, 457-‐468. Yuan, Z., Kishimoto, C., Sano, H., Shioji, K., Xu, Y., and Yokode, M. (2003). Immunoglobulin treatment suppresses atherosclerosis in apolipoprotein E-‐deficient mice via the Fc portion. Am J Physiol Heart Circ Physiol 285, H899-‐906. Zammit, D.J., Cauley, L.S., Pham, Q.M., and Lefrancois, L. (2005). Dendritic cells maximize the memory CD8 T cell response to infection. Immunity 22, 561-‐570. Zhang, S.H., Reddick, R.L., Piedrahita, J.A., and Maeda, N. (1992). Spontaneous hypercholesterolemia and arterial lesions in mice lacking apolipoprotein E. Science 258, 468-‐471. Zhang, Y., Meyer-‐Hermann, M., George, L.A., Figge, M.T., Khan, M., Goodall, M., Young, S.P., Reynolds, A., Falciani, F., Waisman, A., et al. (2013). Germinal center B cells govern their own fate via antibody feedback. J Exp Med 210, 457-‐464. Zhou, X., Caligiuri, G., Hamsten, A., Lefvert, A.K., and Hansson, G.K. (2001). LDL immunization induces T-‐cell-‐dependent antibody formation and 225 protection against atherosclerosis. Arterioscler Thromb Vasc Biol 21, 108-‐ 114. Zhou, X., and Hansson, G.K. (1999). Detection of B cells and proinflammatory cytokines in atherosclerotic plaques of hypercholesterolaemic apolipoprotein E knockout mice. Scand J Immunol 50, 25-‐30. Zikherman, J., Parameswaran, R., and Weiss, A. (2012). Endogenous antigen tunes the responsiveness of naive B cells but not T cells. Nature 489, 160-‐164. Zotos, D., Coquet, J.M., Zhang, Y., Light, A., D'Costa, K., Kallies, A., Corcoran, L.M., Godfrey, D.I., Toellner, K.M., Smyth, M.J., et al. (2010). IL-‐21 regulates germinal center B cell differentiation and proliferation through a B cell-‐ intrinsic mechanism. J Exp Med 207, 365-‐378. Zotos, D., and Tarlinton, D.M. (2012). Determining germinal centre B cell fate. Trends Immunol 33, 281-‐288. 226 Appendix 1. Buffers and Media FACS Buffer 0.5% BSA, 2mM EDTA in PBS, pH 7.4 0.1M citric acid 9.62g in 500ml (H2O) 10X TBS 500mM Tris-HCL (78.82g), 1500mM NaCl (87.66g) in 1L (H2O), pH 7.4 PBS-tween/ TBS-tween 0.05% Tween 20 in PBS/TBS 0.9% Ammonium chloride 9g in 1L (H2O) Complete RPMI media RPMI (450ml), 10% FBS (50ml), 200mM L-glutamine (5ml), 100 units penicillin/ streptomycin (5ml) 227 Appendix 2. List of antibodies used in flow cytometry Antibodies Company Clone Purified anti-mouse CD16/32 eBioscience 93 Rat anti-mouse B220-PerCP Cy5.5 BD Pharmingen RA3-6B2 Mouse anti-mouse CD95-PE eBioscience 15A7 GL-7-biotin eBioscience GL7 Rat anti-mouse IgM-FITC eBioscience II/41 Rat anti-mouse IgG1-APC BD Pharmingen X56 Goat anti-mouse IgG2b-APC Jackson ImmunoResearch NA Goat anti-mouse IgG2c-APC Jackson ImmunoResearch NA Goat anti-mouse IgG3-APC Jackson ImmunoResearch NA Rat anti-mouse CD138-PE BD Pharmingen 281-2 Streptavidin APC Invitrogen NA Rat anti-mouse CD5-APC eBioscience 53-7.3 Rat anti-mouse CD19-PerCP Cy5.5 eBioscience 1D3 Armenia Hamster anti-mouse CD11c-biotin BD Pharmingen HL3 Mouse anti-mouse MHCII-PE eBioscience AF6-120.1 Anti-mouse BrdU BD Pharmingen NA Mouse IgG1-PE eBioscience NA Rat Ig2a-PerCP Cy5.5 eBioscience NA Rat anti-mouse IgG2a-biotin eBioscience NA Rat IgG2a-FITC AbD Serotec YTH71.3 Rat IgG2a-APC eBioscience NA eBioscience NA Rat IgG2a-PE NA – Not Applicable 228 Appendix 3. List of antibodies used in immunofluorescence Antibodies Company Clone Goat anti-PNA-biotin Vector Laboratories NA Steptavidin Cy2 Jackson ImmunoResearch NA Rat anti-mouse B220 eBioscience RA3-6B2 Donkey anti-rat Cy3 Jackson ImmunoResearch NA Rat ant-mouse IgM-FITC Southern Biotech 1B4B1 Rat anti-mouse B220-FITC eBioscience RA3-6B2 Armenian Hamster anti-mouse CD3e eBioscience 145-2C11 Goat Anti-Armenia Hamster Cy5 Jackson ImmunoResearch NA Purified Armernia Hamster anti-mouse CD11c BD Pharmingen HL3 Goat anti-Armenia Hamster Dylight 649 Jackson ImmunoResearch NA Rat anti-mouse CD138-biotin BD Pharmingen 281-2 Streptavidin Cy3 Jackson ImmunoResearch NA Rabbit anti-LYVE-1 Abcam NA Goat Anti-Armenian Hamster Dylight 549 Jackson ImmunoResearch NA Mouse anti-alpha actin-FITC SIGMA 1A4 Donkey anti-rabbit Cy2 Jackson ImmunoResearch NA Rat IgG2a-biotin BD Pharmingen G155-178 Armenia Hamster IgG Biolegend HTK888 Rat IgG2a-FITC AbD Serotec YTH71.3 Purified rat IgG2a eBioscience NA R&D Systems NA Goat IgG-biotin NA – Not Applicable 229 Appendix 4. List of primers used Target gene Primer sequence ebi2 Forward 5’ACTGCCACAACGGAGGTC 3’ ebi2 Reverse 5’CCAAGGCCAGCAGGTTTC 3’ Ch25h Forward 5’ GCCCTGGCTGTACCGCACCTTC 3’ Ch25h Reverse 5’ TCCTCCACCGACAGCCAGATG 3’ Cyp7b1 Forward 5’ TGCGTGACGAAATTGACAGTT 3’ Cyp7b1 Reverse 5’ ATGAGTGGAGGAAAGAGGGCTACA 3’ Hsd3b7 Forward 5’ TGCGCTTTGGAGGTCGTCTATTTC 3’ Hsd3b7 Reverse 5’ GCAGTGGGTGGGCGCCTATCAGTC 3’ Hprt1 Forward 5’ GCAGTCCCAGCGTCGTG 3’ Hprt1 Reverse 5’ TAATCCAGCAGGTCAGCAAAGAAC 3’ 230 [...]... speculate that the robust extrafollicular responses observed in the spleen of apoE-/- mice may be due to the inability of B cells to fall into the state of anergy However, it remains to be determined if APOE protein is crucial in maintaining the anergy state of B cells 4.7 Role of B cell subpopulations However, it remains unclear which B cell subpopulations differentiated into IgM+ plasma cells via extrafollicular... plasmablasts in the PEC but noted an increased population of B1 a cells differentiating into IgM+ plasmablasts in the spleen of apoE-/- mice However, when we examined for B1 a differentiation into IgM+ plasma cells, there was a significant decreased population suggesting either that these newly differentiated IgM+ plasmablasts are either short-lived or they migrate out from the spleen into the bone marrow... argues against the hypothesis 176 that these cells were generated in the bone marrow Therefore, if humoral response against oxLDL does take place in the bone marrow of ezetimibe treated apoE-/- mice, frequency of oxLDL-specific IgM+ ASCs should have also increased compared to WT controls because of survival factors to maintain plasma cells in the bone marrow 4.12 Trafficking to bone marrow The increased... Differences in the kinetics on the formation of antigen specific ASCs in secondary lymphoid organs and bone marrow after immunization implied the migration of these ASCs into the bone marrow compartment Such study of the kinetics of ASC in secondary lymphoid organs and bone marrow is unfortunately challenging in a chronic inflammatory setting such as atherosclerosis Therefore, to investigate the migration of. .. 2010) Although these studies demonstrated that B2 cells are atherogenic, B2 cells comprised of marginal zone B cells and follicular B cells It remains to be demonstrated if lipid-specific antibodies, particularly PC-specific IgM antibodies, produced by marginal zone B cells could also have an overall protective effect in atherosclerosis (van Leeuwen et al., 2009) Indeed, our findings in apoE-/mice showed... which are implicated in the production of oxLDLspecific antibodies, differentiated into IgM+ plasmablasts in the spleen Our findings also demonstrated the migration of IgM+ ASCs from the spleen to the bone marrow for long-term maintenance These IgM+ ASCs in the bone 159 marrow could also be another source of contribution to total and oxLDLspecific IgM autoantibodies in circulation of apoE-/- mice Lymph... BCR affinity for the antigen and thus, it is possible that the nature of lipid antigens interaction with BCR led to the elicitation of extrafollicular responses in the spleen of apoE-/- mice The decision for B cells to undergo GC or extrafollicular responses is also dictated by the migration of activated B cells to different sites of the B cell follicles, which is mediated by chemokine receptor profiles... plasma cells to confer the protective effect against atherosclerosis 4.4 Molecular cues in extrafollicular responses Our findings beget the question why activated B cells differentiate into antibody producing cells via extrafollicular response pathway in atherosclerosis Using hen egg lysozyme (HEL) antigen of different affinities to the HEL-specific SWHEL B cells, it was demonstrated that low antigen-BCR... autoantibodies Interestingly, the frequency of total IgM and oxLDL-specific IgM ASCs did not decrease with ezetimibe treatment in the spleen of apoE-/- mice However, ezetimibe treatment in apoE-/- mice led to the decreased frequency of oxLDL-specific IgM ASCs in the bone marrow 157 Chapter 4 Discussions 158 Chapter 4 Discussion 4.1 Summary of findings Our investigations on the role of B cells in. .. exceed the HSD 3B7 -mediated degradation present in CD11chiMHCIIhi DCs under activated conditions (Yi et al., 2012) Therefore, the bioavailability of 7α, 25-OHC could be important for governing the migration of activated B cells to participate in the extrafollicular responses in apoE-/- mice 4.5 Presence of oxLDL in plasma Besides addressing the issue on why is the extrafollicular responses in the spleen of . investigations on the role of B cells in the pathogenesis of atherosclerosis have led us to a better understanding of the humoral responses taking place in apoE -/- mice in various secondary. number of GC ! 151! B cells were also observed in the iliac LNs, albeit non-statistically significant (Figure 3 6B, right). Lastly, we examined the effect of ezetimibe on the GC reactions in. 2009). Therefore, the prevailing view is that IgM antibodies are associated with protective functions in atherosclerosis. But what may be the underlying mechanisms confer by B cells? Studies in

Định dạng
Số trang	89
Dung lượng	5,89 MB