1. Trang chủ
  2. » Giáo Dục - Đào Tạo

Primer design for the PCR amplification of the coad gene

2 481 0

Đang tải... (xem toàn văn)

THÔNG TIN TÀI LIỆU

Thông tin cơ bản

Định dạng
Số trang 2
Dung lượng 17,16 KB

Nội dung

Primer design for the PCR amplification of the coaD gene Back to Primer Design page The coaD gene from E. coli encodes for phosphopantetheine adenylyltransferase (PPAT), an enzyme involved in the biosynthesis of coenzyme A. Reference: Geerlof, A., Lewendon, A. & Shaw, W.V. (1999) J. Biol. Chem. 274, 27105-27111. The coaD gene: ATGCAAAAACGGGCGATTTATCCGGGTACTTTCGATCCCATTACCAATGGTC ATAT CGATATCGTGACGCGCGCCACGCAGATGTTCGATCACGTTATTCTGGCGATT GCCG CCAGCCCCAGTAAAAAACCGATGTTTACCCTGGAAGAGCGTGTGGCACTGG CACAG CAGGCAACCGCGCATCTGGGGAACGTGGAAGTGGTCGGGTTTAGTGATTTA ATGGC GAACTTCGCCCGTAATCAACACGCTACGGTGCTGATTCGTGGCCTGCGTGCG GTGG CAGATTTTGAATATGAAATGCAGCTGGCGCATATGAATCGCCACTTAATGCC GGAA CTGGAAAGTGTGTTTCTGATGCCGTCGAAAGAGTGGTCGTTTATCTCTTCAT CGTT GGTGAAAGAGGTGGCGCGCCATCAGGGCGATGTCACCCATTTCCTGCCGGA GAATG TCCATCAGGCGCTGATGGCGAAGTTAGCG We decided to clone the gene into an expression vector using the restriction enzymes Nco I (5'-end) andBamH I (3'- end). Here we show the design of both primers: 5'-end primer The Nco I site in the vector is in frame with the N-terminal His 6 tag and can be used directly providing the ATG in the site is used to create the N-terminal methionine residue of PPAT. CATG CCATGGAAAAACGGGCGATTTATCC 1. 5' extension(CATG) 2. Nco I restriction site (CCATGG) 3. Start codon (ATG) 4. Overlap with the 5'-end of the coaD gene starting with the ATGstart codon Estimated T m is 62°C [13 * (A+T) + 9 * (C+G)] GC content is 48% However, PCR using this 5'-end primer will not result in the amplification of the original coaD gene. The use of the Nco I restriction site dictates what the first nucleotide of the next triplet codon must be (G). In the coaD gene, however, the second triplet begins with a C and PCR amplification will change this codon from CAA to GAA (and the second residue in the recombinant protein will be glutamate instead of glutamine). An alternative strategy which will result in the amplification of the original gene is described in Utilisation of the Nco I site. 3'-end primer No C-terminal tag is being used, so we have to add a stop codon (TAG is the natural stop codon for PPAT). CG GGATCCCTA CGCTAACTTCGCCATCAGC 1. 5' extension (CG) 2. BamH I restriction site (GGATCC) 3. Complement of stop codon (CTA) 4. Overlap with the strand complement to the 3'-end of the coaD gene 5. Estimated T m of 60°C [8 * (A+T) + 11 * (C+G)] GC content is 60%. . Primer design for the PCR amplification of the coaD gene Back to Primer Design page The coaD gene from E. coli encodes for phosphopantetheine adenylyltransferase (PPAT),. in the amplification of the original coaD gene. The use of the Nco I restriction site dictates what the first nucleotide of the next triplet codon must be (G). In the coaD gene, however, the. clone the gene into an expression vector using the restriction enzymes Nco I (5'-end) andBamH I (3'- end). Here we show the design of both primers: 5'-end primer The Nco I site in the

Ngày đăng: 14/07/2015, 23:53

TỪ KHÓA LIÊN QUAN

w