Báo cáo khoa học: Identification, structure and differential expression of novel pleurocidins clustered on the genome of the winter flounder, Pseudopleuronectes americanus (Walbaum) ppt

Identification, structure and differential expression of novel pleurocidins clustered on the genome of the winter flounder, Pseudopleuronectes americanus (Walbaum) Susan E. Douglas, Aleksander Patrzykat, Jennifer Pytyck and Jeffrey W. Gallant Institute for Marine Biosciences, Halifax, Nova Scotia, Canada Antimicrobial peptides form one of the first lines of defense against invading pathogens by killing the microorganisms and/or mobilizing the host innate immune system. Although over 800 antimicrobial peptides have been isolated from many different species, especially insects, few have been reported from marine fish. Sequence analysis of two genomic clones (15.6 and 12.5 kb) from the winter flounder, Pseudopleuronectes americanus (Walbaum) resulted in the identification of multiple clustered genes for novel pleuro- cidin-like antimicrobial peptides. Four genes and three pseudogenes (Y) are encoded in these clusters, all of which have similar intron/exon boundaries but specify putative antimicrobial peptides differing in sequence. Pseudogenes are easily detectable but have incorrect initiator codons (ACG) and often contain a frameshift(s). Potential pro- moters and binding sites for transcription factors implicated in regulation of expression of immune-related genes have been identified in upstream regions by comparative genomics. Using reverse transcription-PCR assays, we have shown for the first time that each gene is expressed in a tissue- specific and developmental stage-specific manner. In addi- tion, synthetic peptides based on the sequences of both genes and pseudogenes have been produced and tested for anti- microbial activity. These data can be used as a basis for prediction of antimicrobial peptide candidates for both human and nonhuman therapeutants from genomic sequences and will aid in understanding the evolution and transcriptional regulation of expression of these peptides. Keywords: antimicrobial peptide; development; fish; gene expression; promoter. Antimicrobial peptides have been isolated from a wide variety of plants, animals, fungi and bacteria, and play an important role in defense against microbial infection. Many of these small molecules are amphiphilic a-helices contain- ing clusters of cationic amino acid residues that are well separated in space from hydrophobic residues. These characteristics play a role in how peptides insert into biological membranes. Although the primary mode of action of antimicrobial peptides has been described as destruction of membranes, they may also exert their effects by disrupting intracellular processes. In addition, some have been reported to exert a variety of beneficial effects on host cells such as mediating inflammation and modulating the immune response (for a review, see [1]). Of the over 800 antimicrobial peptide sequences depos- ited in the described Antimicrobial Peptide Database (http://bbcm1.univ.trieste.it/tossi/pag1.htm), sequences have been reported from only 11 fish species. Although relatively understudied, fish are proving to be a rich source of antimicrobial peptides, possibly because of their more pronounced reliance on innate immune functions in their defense against pathogens than mammals [2,3]. Natural antimicrobial peptides have been isolated from only a few teleosts and include pleurocidin from winter flounder [4,5], pardaxin from Red Sea Moses sole [6], misgurin from loach [7], HFA-1 from hagfish [8], piscidins from hybrid striped bass [9], moronecidin from hybrid striped bass [10], hepcidin from bass [11] and winter flounder and Atlantic salmon [12], chrysophsin from red sea bream [13], parasin and hipposin, cleavage products of histone 2A from catfish [14] and Atlantic halibut [15], respectively, two hydrophobic proteins of 27 kDa and 31 kDa from mucous secretions of carp [16] and a highly hydrophobic cationic peptide of undetermined sequence from trout [17]. In addition, a cationic steroidal antibiotic, squalamine, has been isolated from the shark [18]. There is scant information on the structure and regulation of expression of antimicrobial peptide genes, particularly in fish. Most studies report the biochemical purification of specific peptide sequences, and in some cases the subsequent cloning and sequencing of the corresponding gene or cDNA. Only in the case of the human defensins have genes for antimicrobial peptides been conclusively demonstrated to be clustered on the genome in vertebrates [19,20], and in Correspondence to Institute for Marine Biosciences, 1411 Oxford Street, Halifax, Nova Scotia, Canada, B3H 3Z1. Fax: +1 902 426 9413, Tel.: +1 902 426 4991, E-mail: susan.douglas@nrc.ca Abbreviations: AP-1, activator protein 1; ATF, activating transcription factor-1; CAAT, CCAAT binding factor; C/EBP, CAAT/enhancer binding protein; d.p.h., days posthatch; GATA, GATA motif; IFN, interferon; IL, interleukin; NF-IL6, nuclear factor interleukin 6; OCT1, octamer motif; Y, pseudogene; MIC, minimal inhibitory concentration; RT, reverse transcription. Note: Nucleotide sequence data are available in the GenBank database under the accession numbers AY282498 and AY282499. (Received 5 June 2003, revised 9 July 2003, accepted 17 July 2003) Eur. J. Biochem. 270, 3720–3730 (2003) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03758.x no case has the differential expression of different members of a vertebrate antimicrobial peptide gene family been reported. Expression of pleurocidin peptide in skin and intestine has been demonstrated using immunohistochemical tech- niques [21] and we have recently localized expression of one pleurocidin gene (WF2) to circulating eosinophilic granule cells of winter flounder gill [22]. In a previous study, we reported the existence of multiple genes encoding pleuro- cidin-like peptides and demonstrated generalized pleuroci- din transcripts early in the development of winter flounder larvae [5]. However, we could not discriminate between the different pleurocidin genes; expression of the multiple genes encoding pleurocidins or, in fact any antimicrobial peptide in any organism, during different stages of development and in different tissues has never been reported. In order to investigate this and also to determine whether other previously unreported pleurocidin genes may be present on the winter flounder genome, we have sequenced two genomic fragments that gave positive hybridization signals with a pleurocidin probe. Furthermore, we have used the power of comparative genomics to identify potential regulatory sequences that may be involved in transcriptional control and to shed light on the role of these peptides in host immunity. In most cases, identification of antimicrobial peptides has involved laborious, time-consuming biochemical puri- fication followed by antimicrobial activity assays. Using a genomics approach, we have successfully identified addi- tional variants of this antimicrobial peptide family, predicted their sequences and determined the activity of synthetic peptides corresponding to these sequences against a variety of pathogens. With the wealth of genomic data now available from a wide variety of organisms, this genomic screening approach should be of value in future studies aimed at uncovering multiple genes encoding families of novel antimicrobial peptides and elucidating their roles in vivo. Materials and methods Fish rearing and sampling All animal procedures were approved by the Dalhousie University Committee for Laboratory Animals and the National Research Council, Halifax Local Animal Care Committee. Winter flounder larvae were reared as described [23]. All fish were killed with an overdose of tricaine methanesulfonate (MS 222, 0.1 gÆL )1 ,ArgentChemical Laboratories, Inc., Redmond, WA, USA) prior to sampling. Tissues were removed into RNALater (Ambion, Austin, TX, USA) and kept at )80 °C until used. Samples of larvae at different stages (hatch, 5, 9, 15, 20, 25, 30 and 36 days posthatch; d.p.h.) and juveniles were rinsed in RNALater (Ambion), transferred into 1.5 mL Eppendorf tubes containing 0.5–1.25 mL RNALater, and kept at )80 °C until used. Sequencing and data analysis A winter flounder genomic k-GEM11 library was screened by standard procedures using a pooled radioactively labeled probe comprised of PCR-amplified bands corresponding to pleurocidins WF1, WF2, WF3 and WF4 [5]. Positively hybridizing clones were picked and replated until 100% purity was achieved and mapped using BamHI, SstI, XhoI and EcoRI. Clones were completely sequenced from both strands using an ABI377 automated sequencer and the AmpliTaqFS Dye Terminator Cycle Sequencing Ready Reaction kit (Perkin Elmer). Sequence data were analyzed using Sequencher (Gene Codes, Inc., Ann Arbor, MI, USA) and DNA Strider (Marck, 1992). Signal peptide cleavage sites were predicted using the SignalP Web Prediction Server (http://www.cbs.dtu.dk/services/SignalP) with the neural networks trained on sequences from eukaryotes. Transcrip- tion factor binding sites were identified using WWW Signal Scan (http://bimas.dcrt.nih.gov/molbio/signal/) with the TRANSFAC [24] and TFD databases. Expression of pleurocidin genes by reverse transcription-PCR (RT-PCR) Total RNAs were isolated from esophagus, pyloric stom- ach, cardiac stomach, pyloric caeca, liver, spleen, intestine, rectum, gill, brain, muscle and skin (20–50 mg tissue) of an adult winter flounder, and from pooled samples of 20 whole larvae (hatch and 9 d.p.h.), 10 whole larvae (15, 20, 25 30 and 36 d.p.h.) and five whole juveniles using the RNA Wiz kit (Ambion, Austin, TX, USA) according to the manu- facturer’s recommendations. The isolated RNA was treated with DNA Free Kit (Ambion) as directed by the manufac- turer, except that a 1-h incubation was performed rather than the specified 30 min. First-strand cDNA was synthesized from 2 lgtotal RNA using the RetroScript kit (Ambion) and aliquots of the reaction products were subjected to PCR using rTaq polymerase (Amersham Biosciences) and gene-specific primers (Table 1). As Y2andY3 showed significant sequence degeneration (see Results), it was assumed that they are no longer functional and they were therefore not assayed. The amplification conditions were: 2 min at 94 °C; 32 cycles of 30 s at 94 °C, 30 s at 52 °C, 90 s at 72 °C; and 2 min at 72 °C. Amplification of b-actin mRNA was performed to confirm the steady-state level of expression of a housekeeping gene. Amplification products were resolved on a 2% PCR Plus agarose gel (EM Sciences, Gibbstown, NJ, USA) with a 100-bp ladder as a marker (Amersham Biosciences). Controls were performed using single primers to eliminate single primer artifacts and without template to eliminate amplification products arising from contami- nating genomic DNA. Synthesis of peptides The sequences of selected peptides used for testing and their physical properties are provided in Table 2. All anti- microbial peptides used in this study were synthesized by N-(9-fluorenyl) methoxy carbonyl (Fmoc) chemistry at the Nucleic Acid Protein Service unit at the University of British Columbia. Peptide purity was confirmed by HPLC and MS analysis in each case. Due to the high cost of peptide synthesis, only a subset of peptides was made. Two peptides, WFY and WFZ, based on alternative splice products were predicted from pseudogene 1 (which con- Ó FEBS 2003 Pleurocidin differential gene expression (Eur. J. Biochem. 270) 3721 tained no frameshifts) but no peptides were synthesized based on pseudogenes 2 or 3 (which exhibited significant sequence degeneration). WF-YT was not synthesized as it did not exhibit the typical GEC signature upstream of the mature peptide and the position of the carboxy-terminal residue was ambiguous. A previously synthesized peptide, NRC-01, which differs from the predicted amino acid sequence of WF1-like peptide by only one residue (a Glu vs. an Asp at position 7 of the mature peptide) was used to estimate the activity of WF1-like pleurocidin. Antimicrobial assays All strains used in this study are listed in Table 3. As inhibition of microbial growth in humans is of interest, nonfish bacterial strains as well as Candida albicans were assayed and grown at 37 °C in Mueller-Hinton Broth (MHB; Difco Laboratories, Detroit, MI, USA), while the bacteria pathogenic to fish were maintained at 16 °Cin tryptic soy broth (Difco, 5 gÆL )1 NaCl). All strains were stored at )70 °C until they were thawed for use and subcultured daily. Two field isolates of the salmonid pathogen Aeromonas salmonicida are from the Institute for Marine Biosciences strain collection. The following strains, P. aeruginosa K799 (parent of Z61), P. aeruginosa Z61 (antibiotic supersusceptible), Salmonella typhimurium 14028s (parent of MS7953s), Salmonella typhimurium MS7953s (defensin supersusceptible), as well as Staphylo- coccus epidermidis (human clinical isolates), methicillin- resistant Staphylococcus aureus (isolated by A. Chow, University of British Columbia, Canada) and C. albicans were provided by R. E. W. Hancock, University of British Columbia, Canada. Antibiotic-supersusceptible strains were included with the specific intent of determining if these mutations also result in increased susceptibility to peptides, which may imply a specific mode of action. Escherichia coli strain CGSC 4908 (his-67, thyA43, pyr- 37), auxotrophic for L -histidine, thymidine and uridine [25] was obtained from the E.coliGenetic Stock Centre (Yale University, New Haven, CT, USA). MHB supplemented with 5 mgÆL )1 thymidine, 10 mgÆL )1 uridine and 20 mgÆL )1 L -histidine (Sigma Chemical Co.), was used to grow E.coli CGSC 4908 unless otherwise specified. The activities of the antimicrobial peptides were deter- mined as minimal inhibitory concentrations (MICs) using the microtitre broth dilution method of Amsterdam [26], as modified by Wu and Hancock [27]. Serial dilutions of the peptide were made in water in 96-well polypropylene microtiter plates (Costar, Corning Incorporated, Corning, NY, USA). Bacteria or C. albicans were grown overnight to Table 1. Nucleotide sequences of oligonucleotides used for assay of pleurocidin-like gene expression in different tissues and at different stages of development of winter flounder. Gene sequence Primer Amino acid Nucleotide sequence (5¢fi3¢) WF1-like RTWF1 KGRWLER AAGGGCAGGTGGTTGGAAAGG RTWF1/3¢ YQEGEE a CCCTCCCCCTCCTGGTA WF2 RTWF2 KAAHVG AAGGCTGCTCACGTTGGC PL2 3¢ untranslated CTGAAGGCTCCTTCAAGGCG WFYT RTWFYT GFLFHG GGGATTTCTTTTTCATGG RTWFYT/3¢ SFDDNP a GGGTTGTCATCGAATGAG WFX RTWFX RSTEDI CGTTCTACAGAGGACATC RTWFX/3¢ DDDDSP a GGGGCTGTCATCATCATC WFY (Y1) RTWF5.1/5¢ IVMFEP CATCGTCATGTTTGAACC RTWF5.1/3¢ GYLNAA a GGCCGCATTGAGATAACC WFZ (Y1) RTWF5.1/5¢ IVMFEP CATCGTCATGTTTGAACC RTWF5.1a/3¢ PFIKPR a CCTGGGTTTAATAAATGG Actin ActF(WF) AALVVD TCGCTGCCCTCGTTGTTGAC ActR(WF) VLLTEAP a GGAGCCTCGGTCAGCAGGA a Primer based on complement. Table 2. Properties of predicted peptides. To estimate the net charge K and R were assumed to have a value of + 1, H of + 1/2, D and E of )1, and C-terminal amidation was counted as an additional +1. Label Residues Amino acid sequence M r Charge WF1-like a 24 GKGRWLERIGKAGGIIIGGALDHL-NH 2 2487 +3.5 NRC-01 b 24 GKGRWLDRIGKAGGIIIGGALDHL-NH 2 2473 +3.5 WF2 25 GWGSFFKKAAHVGKHVGKAALTHYL-NH 2 2711 +6.5 WFX 21 RSTEDIIKSISGGGFLNAMNA-NH 2 2180 +2.0 WFY (Y1) 19 FFRLLFHGVHHGGGYLNAA-NH 2 2112 +3.5 WFZ (Y1) 19 FFRLLFHGVHHVGKIKPRA-NH 2 2260 +6.5 a WF1-like contains an N-terminal insertion RRKKKGSKRKGSKGKGSK. b NRC-01, which differs from WF1-like by a single Glu-Asp substitution, was tested instead of WF1-like. 3722 S. E. Douglas et al. (Eur. J. Biochem. 270) Ó FEBS 2003 mid-logarithmic phase as described above, and diluted to give a final inoculum size of 10 6 c.f.u.ÆmL )1 . A suspension of bacteria or yeast was added to each well of a 96-well plate and incubated overnight at the appropriate temperature. Inhibition was defined as growth lesser or equal to one-half of the growth observed in control wells where no peptide was added. However, in all cases except P. aeruginosa, where growth inhibition was indeed gradual, complete inhibition (no growth) was achieved at the lowest inhibitory concentration. Growth was assessed visually. Three repli- cates of each MIC determination were performed. MHB supplemented with 200 m M NaCl was used to test salt resistance. Survival of bacteria and C. albicans upon exposure to selected peptides applied at their MICs and 10 times their MICs was measured using standard methodology. The test organisms were grown in MHB and exposed to the peptides. At specified time intervals, equal aliquots were removed from the cultures, plated on MHB plates, and the resulting colonies were counted. Percentage survival was plotted against time on a logarithmic scale. Two replicates of each experiment were performed. Results Genomic structure Four lambda clones giving positive hybridization signals with the pleurocidin probe were isolated from the winter flounder genomic library. Two clones differing markedly in restriction endonuclease cleavage pattern were selected for sequencing. Complete sequencing of these two clones (k1.1 and k5.1) revealed inserts of 15.6 and 12.5 Kb, respectively. k1.1 contained three genes encoding pleuro- cidin-like antimicrobial peptides (referred to as WFYT, WFX and WF1-like) and one pseudogene (Y3). k5.1 contained one gene encoding pleurocidin (WF2) and two pseudogenes (Y1andY2). Sequence analysis demonstra- ted that all pleurocidin genes contained four exons and three introns. Interestingly, the pseudogenes all had a similar genomic structure but were missing ATG start codons and correct splicing sites, or contained frameshifts (asterisks, Fig. 1). Intron and exon sizes varied quite markedly (Table 4). Pronounced degeneration of the sequences upstream of the pseudogenes made it impossible to predict the locations of the first introns and exons of Y1, Y2andY3. An alignment of the peptides predicted from the pleurocidin genes and pseudogenes is shown in Fig. 1. All of the genes, and even most of the pseudogenes, encode highly conserved signal sequences and anionic propieces. The exception is Y2, which encodes a very long carboxy- terminal extension. The mature peptides, predicted by SignalP to start after the motif GEC, GES or GEG and to terminate at the glycine adjacent to the acidic propiece (by comparison with the published amino acid sequence of pleurocidin [4]), are somewhat variable in sequence, net positive charge and length (Table 2). Computer searches for promoters revealed common promoter motifs with very high scores (0.98–1.00) in the upstream regions of all four genes (Fig. 2A). However, only aberrant motifs with much lower scores (0.88–0.93) could be detected in the upstream regions of the pseudogenes. All of the high-scoring promoters exhibited significant sequence identity with one another (Fig. 2B) but no similarity to the motifs upstream of pseudogenes. Table 3. Strains used to test antimicrobial activity of pleurocidins and the corresponding MICs. MIC in lgÆmL )1 NRC-01 WF2 WFX WFY (Y1) WFZ (Y1) Aeromonas salmonicida A449 field isolate 64 2 >64 >64 >64 97–4 field isolate 64 2 >64 >64 32 Salmonella typhimurium MS7953s supersusceptible 16 2 >64 64 16 14028s parent of MS7953s >64 16 >64 >64 >64 Pseudomonas aeruginosa K799 parent of Z61 >64 8 >64 >64 32 Z61 supersusceptible 32 4 >64 64 8 Escherichia coli CGSC4908 triple auxotroph 32 2 >64 64 32 UB1005 parent of DC2 32 4 >64 >64 32 DC2 outer membrane mutant 32 2 >64 >64 32 Staphylococcus epidermidis Clinical isolate >64 8 >64 >64 32 Staphylococcus aureus Methicillin resistant clinical isolate >64 8 >64 >64 64 Candida albicans Clinical isolate 64 8 >64 >64 >64 Fig. 1. Predicted amino acid sequences of peptide precursors encoded by pleurocidin genes and pseudogenes. Single letter amino acid code is used and deletions are indicated by dashes (–). Insertions in WF1-like and Y2 peptides relative to the other peptides are indicated by arrows. Positions of frameshifts in the ÔMature peptideÕ region of Y2andY3 are indicated by asterisks (*). Ó FEBS 2003 Pleurocidin differential gene expression (Eur. J. Biochem. 270) 3723 Apart from a 5-nucleotide deletion that was present in the promoters from WF1 and WFX relative to WF2 and WFYT, the sequences differed at only five locations and four of these were in a stretch of eight positions at the 5¢ end. Classical TATA and CAAT boxes could be found in the upstream regions of all four genes but, of the pseudogenes, only Y3hadaTATAbox. No CAAT boxes could be detected in any of the pseudogenes. Stage-specific gene expression of pleurocidin genes The results of RT-PCR expression assays of each pleuro- cidin gene during development are shown in Fig. 3. Expression of WF1-like pleurocidin could not be detected at any stage of development. Expression of WFX was just discernable at 20 d.p.h. whereas expression of WFYT and WF2 was readily detectable in premetamorphic larvae and juveniles. Tissue-specific gene expression of pleurocidin genes The results of RT-PCR expression assays of each pleuro- cidin gene in different tissues of adult fish are shown in Fig. 4. Expression of WFX appears to be confined to the Table 4. Sizes (in bp) of introns (I) and exons (E) of pleurocidin genes and pseudogenes (Y) encoded on k1.1 and k5.1 clones. ND, Not deter- mined. Name E1 I1 E2 I2 E3 I3 E4 WF1-like 25 120 155 539 31 95 112 WFX 25 119 101 453 19 97 85 WFYT 25 115 101 386 19 97 88 WF2 25 101 101 523 31 109 76 WFY (Y1) ND ND 101 2120 19 113 76 WFZ (Y1) ND ND 101 544 41 1656 87 Y2 ND ND 93 368 8 108 160 Y3 ND ND 102 524 30 97 67 Fig. 2. Locations of transcription factor binding sites of pleurocidin genes and pseudogenes (A) and an alignment of predicted promoters (B). (A) Promoters are indicated by solid boxes with the corresponding score above. The first two exons (hatched boxes) and the first intron (stippled box) of each gene are shown. Asterisks above and below the lines represent GAAA motifs on the coding and noncoding strands, respectively. AP-1, activator protein 1; ATF, activating transcription factor-1; CAAT, CCAAT binding factor; GATA, GATA motif; a-IFN, a-interferon; NF-IL6, nuclear factor-interleukin 6; OCT1, octamer motif. (B) Upper case letters indicate nucleotides present in the pleurocidin transcripts and lower case letters indicate nucleotides present in the 5¢ nontranscribed portions of the genes. The predicted promoter is underlined. 3724 S. E. Douglas et al. (Eur. J. Biochem. 270) Ó FEBS 2003 skin whereas that of the other three genes is more widespread, particularly in the gill, skin and gut tissues. In addition, WFYT transcripts were detected in spleen and WF2 transcripts were found in liver. Pseudogene expression No expression could be detected from Y1 either at different stages of development (Fig. 3) or in different tissues (Fig. 4), Fig. 3. RT-PCR of expression of pleurocidin genes and pseudogenes throughout larval development. Larvae at 0, 5, 9, 15, 20, 25, 30 and 36 d.p.h. and juveniles (J) were analyzed. Controls using single primers (5¢,3¢) and no template (NT) are also shown. Exons and introns are represented as in Fig. 2A. No reading frames could be identified in regions represented by solid lines. Portions of the clones flanking the pleurocidin gene clusters are not represented. Markers (M) are a 100-bp ladder (100–400 bp shown). Fig. 4. RT-PCR assays of expression of pleurocidin genes and pseudogenes in different tissues. Esophagus (E), pyloric stomach (PS), cardiac stomach (CS), pyloric caeca (PC), liver (L), spleen (Sp), intestine (I), rectum (R), gill (G), brain (B), muscle (Mu) and skin (Sk) were analysed. Markers (M) and representations of genes and pseudogenes are the same as in Fig. 3. Ó FEBS 2003 Pleurocidin differential gene expression (Eur. J. Biochem. 270) 3725 consistent with the lack of a strong promoter motif, TATA or CAAT boxes (Fig. 2A). Primers based on alternatively spliced transcripts that would give rise to either WFY or WFZ peptides (Table 1), were both negative for expression. Although expression of Y2andY3 was not tested, it is assumed that their aberrant genomic structure and lack of promoters would preclude transcription. Antimicrobial activity of synthetic peptides Minimal inhibitiory concentrations of the five tested pep- tides against a range of bacteria and C. albicans are shown in Table 3. While WFX and WFY pleurocidins appeared to be inactive in our hands, NRC-01 (similar to WF1-like) and WFZ pleurocidins possessed moderate antimicrobial acti- vity. WF2, an amidated version of the original pleurocidin, showed activity similar to that described in previous studies [4]. All peptides with detectable activity against P. aerugi- nosa Z61 (NRC-01, WF2, WFY and WFZ) retained that activity in the presence of 200 m M NaCl (Table 5). The ability of NRC-01 pleurocidin to kill A. salmonicida A449, Salmonella typhimurium MS7953s and C. albicans at its MIC and 10 times MIC is shown in Fig. 5. NRC-01 pleurocidin added at 10 times MIC showed strong bacte- ricidal and modest fungicidal activity against the pathogens tested. NRC-01 pleurocidin added at its MIC was less active although it still showed bactericidal activity against Salmonella typhimurium and A. salmonicida. Discussion Antimicrobial peptides such as cecropins [28], apidaecins [29], dermaseptins [30] and defensins [31] are known to be encoded by multigene families. Southern blot analysis of apidaecin [29] and more recently, pleurocidin [5] and hepcidin [12], indicate that antimicrobial peptide genes may exist in clusters on the genome. However, with the exception of human defensins [32], definitive proof of a clustered gene arrangement has never been demonstrated. In fact, genomic sequencing of the defensin cluster has recently been used to uncover additional previously unknown members of this antimicrobial peptide family [19]. Our data definitively demonstrate that pleurocidin genes occur at at least two distinct loci on the winter flounder genome. Furthermore, we predict that there must be at least one other locus encoding the previously described WF1, WF1a, WF3 and WF4 pleurocidins [5]. These may be located on the other two lambda clones we isolated that had slightly different restriction patterns from the two that were sequenced. Given the high degree of sequence conservation among the pleurocidin genes and their flanking regions (Figs 1 and 2), it is possible that recombination between these conserved modules has allowed the generation of variants with diverse sequences, and presumably antimicrobial properties. Some of these changes may be very subtle or even vary between winter flounder from different loca- tions; the WF2 pleurocidin we describe differs from the gene sequence determined by Cole et al.[21]atseven Table 5. Minimum inhibitory concentrations of peptides active against P. aeruginosa Z61 in the presence or absence of 200 m M NaCl. MIC in lgÆmL )1 against P. aeruginosa Z61 No salt 200 m M NaCl WF1-like 32 32 WF2 4 8 WFY (Y1) 64 64 WFZ (Y1) 8 16 Fig. 5. Ability of NRC-01 to kill A. salmonicida (A), Salmonella typhimurium (B) and C. albicans (C). Peptide was added at its MIC (h), 10 times MIC (n) and a no-peptide control was included in each group (r). 3726 S. E. Douglas et al. (Eur. J. Biochem. 270) Ó FEBS 2003 positions in the upstream region and four positions in the first intron, including a large deletion of 17 nucleotides. This amount of sequence divergence between different individuals of the same species indicates that the pleuro- cidin genes, like defensin genes, are evolving very rapidly. In addition, the identification of pseudogenes with a relatively low amount of degeneration indicates a fairly recent evolutionary event; the sequences were highly similar to those found in active genes and easily detect- able. The ability to generate multiple genes encoding diverse antimicrobial peptides may be one way that fish are able to capitalize on this component of innate immunity, both in killing microbes and in modulating host immunity. Three pseudogenes were present in the cluster containing the four functional pleurocidin genes. In mammalian genomes, pseudogenes are nearly as abundant as genes [33], possibly as a result of the genomic processes involved in generating multigene families, such as those concerned with immunity. The general assumption that pseudogenes rep- resent dysfunctional relics has recently been contradicted by the discovery of a pseudogene that regulates expression of the functional gene from which it arose via an RNA- mediated mechanism [34]. It will be of interest to probe whether a similar process may be involved in the regulation of expression of pleurocidin (and possibly other antimicro- bial peptide) genes. Little is known about the promoter or regulatory sequences involved in pleurocidin gene expression. In a recent study comparing human and mouse genomes, it was apparent that conserved noncoding genomic sequence (5¢ upstream and intron sequence) is often enriched in signals involved in transcriptional regulation compared to coding sequence [35]. Furthermore, co-occurring pairs of transcrip- tion factors could be identified using this approach. By using a similar comparative genomics approach, we have been able to identify putative biologically active regulatory elements upstream of pleurocidin genes and within the first intron, including one with a high prediction score for a eukaryotic promoter, and also to predict which transcrip- tion factors are likely to interact. Transcription factors usually work in complexes to regulate transcription [36] and their binding sites are often clustered into modular units known as cis-regulatory modules. Recent analysis of clusters of transcription factor binding sites in the Drosophila genome indicated that multiple transcription factors are required to modulate eukaryotic gene expression [37]. While the consensus sequences of some transcription factor binding sites are known, their short length and low sequence complexity often results in a high number of false positives in computer searches due to random occurrences. Binding sites for various transcription factors known to be involved in host defense [activator protein 1 (AP-1), a-interferon (a-IFN), nuclear factor interleukin 6 (NF-IL6), octamermotif(OCT1)]aswellasGAAAmotifs(commonly found upstream of interferon-induced genes) were identified in the upstream regions of both genes and pseudogenes or within the first intron. Those present in functional genes conformed better to the consensus sequences than those upstream of pseudogenes, as the latter appear to have undergone substantial sequence drift. As seen from Fig. 2A, many of these consensus binding sites are at similar positions. GAAA motifs were abundant upstream of genes (6–10 motifs) but rare upstream of pseudogenes (1–4 motifs). Binding sites for activator protein-1 (AP-1), a family of transcription factors consisting of homodimers and hetero- dimers of Jun, Fos or activating transcription factor 1 (ATF) were also located upstream of three of the four pleurocidin genes (for review of AP-1 function and regula- tion see [38]). Cis-regulatory elements containing AP-1 sites are regulated by multiple sets of bZIP transcription factor dimers with different binding and transactivation properties [39]. ATF motifs were found upstream of only one gene (WF2) but in the identical position upstream of all three pseudogenes. AP-1 factors are involved in cell differenti- ation and survival and are also produced after viral transformation of cells. The presence of GAAA and AP-1 motifs indicates that pleurocidins may be induced by viral infection and play a role in clearing these pathogens although at this time we do not have antiviral activity data to support this hypothesis. GATA motifs (WGATAR), which together with nuclear factor (NF)-jB motifs are necessary for tissue-specific expression of immunity genes in larval fat body (the insect equivalent of the liver) and hemocytes of Drosophila [40] and in erythroid-specific gene expression in mammals [41], were found within and/or upstream of WF2 and WFYT. They may be responsible for the transcripts in liver (WF2) and spleen (WFYT). The more widespread pleurocidin expression in gill, skin and gut tissues is not surprising, given their proximity to the external environment (gill and skin) or bacteria in the gut (intestine, pyloric caecae, stomach and rectum). Specific cDNAs for WF1a, WF2 and WF3 have been cloned and sequenced from intestine [5] and immuno- gold electron microscopy revealed WF2-like pleurocidin transcripts in mucus-producing cells of skin and goblet cells of small intestine in winter flounder [21]. In addition, Paneth cells within the human intestine have been shown to express human defensin-5 [42]. It is possible that pleurocidin transcripts also originate from immune cells circulating through these tissues. In support of this, we have recently localized WF2 pleurocidin (both transcripts and peptide) to circulating eosinophilic granule cells in the gill of winter flounder [22]. Human neutrophils contain defensins [31] and bovine neutrophils have been shown to store the anti- microbial peptide bactenecin in granules [43]. In situ hybridi- zation experiments designed to elucidate which cell types are responsible for production of the various pleurocidins are underway in our lab. A cluster of NF-IL6 and/or a-IFN transcription factor binding sites within 150 nucleotides of the promoter co- occur in three out of the four pleurocidin genes (WFX, WF2 and WFYT). NF-IL6 is a member of the CCAAT/ Enhancer Binding Protein (C/EBP) class of leucine-zipper transcription factors that binds to an IL-1-responsive element in the IL-6 gene. It is induced by IL-1, IL-6, and lipopolysaccharide during the acute phase response; it has been termed the Ômaster regulator of the immune responseÕ [44] and is involved in activating transcription of the inflammatory cytokines IL-6 and IL-8 [45]. As antimicrobial peptides can be induced in response to infection [46], the detection of NF-IL6 sites is not surprising. One of the AP-1 Ó FEBS 2003 Pleurocidin differential gene expression (Eur. J. Biochem. 270) 3727 sites was also found clustered with an NF-IL6 site upstream of WF2. Similar association of these two sites has been reported in the enhancer region of one of the winter flounder antifreeze protein genes, where a sequence element containing an AP-1 site binds two transcription factors, one of which is a C/EBP family member, C/EBPa [47]. Both transcription factors are proposed to interact to direct liver- specific gene expression in winter flounder. Possibly the expression of WF2 in the liver is regulated in a similar manner. NFjB-like motifs have been found upstream of antimi- crobial peptide genes in mammals, amphibia and Drosophila [48], often adjacent to binding sites for NF-IL6 with which it interacts to effect transcription of immune-relevant genes [49]. The lack of NF-jB motifs upstream of the pleurocidin genes described in this study may mean that inducible expression of pleurocidin occurs via some other transcrip- tional pathway involving NF-IL6 either alone or with another unidentified factor, or that additional pleurocidin genes possessing NFjB binding sites in their upstream sequences may exist elsewhere in the genome. Octamer motifs (ATGCAAAT) are present in the noncoding sequences of all of the pleurocidins. These motifs are often found in enhancers, where they promote tran- scription of immune-relevant genes. In fish, such sequences have been found in the salmon transferrin promoter [50], trout MX genes [51] and catfish [52]. The catfish IgH enhancer contains 11 octamer motifs, of which nine are functional [53]. OCT1 sites have been detected in the human IL-2 promoter [54]. The occurrence of between one and four OCT1 sites in pleurocidin genes indicates that they may be involved in promoting transcription of antimicrobial pep- tide genes as well as other immune-relevant genes in fish. Expression of WFX, WFYT and WF2 was detectable in premetamorphic larvae and juveniles, but no expression of WF1-like pleurocidin or any of the pseudogenes could be detected at any stage of development. Interestingly, the cluster of NF-IL6 and a-IFN transcription factor binding sites found upstream of WFX, WF2 and WFYT are absent from WF1-like pleurocidin and the pseudogenes, indicating that these motifs may be necessary for expression in the larval stages. Both WFYT and WF2 genes contain GATA motifs, which have been shown to be essential for larval expression of insect genes including those for two anti- microbial peptides, cecropin and drosocin [40]. Our earlier studies showed the expression of pleurocidin at 5 d.p.h. [5], but the primers used could not discriminate between the different variants described here. It is likely that another, as yet undescribed member of the pleurocidin gene family, is expressed earlier in development. Although the focus of our study was not to identify peptides with highly active antimicrobial properties, but rather to demonstrate the power of genomics in identifying novel peptide-encoding sequences, the modest activities we detected against the microbes in our panel are encouraging. The peptides may be active against other species of bacteria more commonly encountered in fish. In addition, as many antimicrobial peptides are known to synergize with each other and with other components of the innate immune system such as lysozyme [55], the in vivo effects may be more powerful than shown in the in vitro assays performed in our study. The ability of antimicrobial peptides to exert positive modulatory effects on the innate immune system [56] may result in further beneficial effects to the host. The peptides are both inhibitory and cidal, although both activities vary from pathogen to pathogen, with C. albicans counts being reduced only by one log order, even at 10 times the MIC. Also, the peptides are able to exert their effects in the presence of 200 m M NaCl, a characteristic that is promising for application to cystic fibrosis treatment. These results encourage us to scout the genome of winter flounder for more peptides with unique characteristics that could be of value in combating bacterial infections. Interestingly, the WFZ peptide exhibited some activity even though the gene is no longer functional. There is no detectable promoter, few transcriptional control sequences, no initiator methionine, and frameshift mutations are present. Nonetheless, the predicted peptide encoded by this pseudogene is highly positively charged (Table 2). This underscores the advantage of scanning genomic informa- tion for possible antimicrobial peptide sequences: even if the genes are no longer functional, the peptides they once encoded may be of interest. In conclusion, we have identified two clusters containing several pleurocidin-like antimicrobial peptide genes and pseudogenes and determined the antimicrobial activities of synthetic peptides predicted from these sequences. We have performed a comprehensive survey of the differential expression of these genes and pseudogenes and shown for the first time that the different antimicrobial peptide genes are expressed in different tissues and at different times during development. Using comparative genomics, we have been able to identify sequence motifs that potentially bind transcription factors involved in the regulation of expression of immunity-related genes. This has provided us with a window into the complex regulatory processes that appear to govern the transcription of different members of this multigene family. Future studies aimed at dissecting the promoter and critical cis-regulatory sequences will further enhance our understanding of the regulation of this important component of innate immunity. Acknowledgements We thank Dr Vanya Ewart for critically reviewing this manuscript prior to submission. This is NRCC publication 42402. References 1. Hancock, R.E. & Lehrer, R. (1998) Cationic peptides: a new source of antibiotics. Trends Biotechnol. 16, 82–88. 2. Tatner, M.F. & Horne, M.T. (1983) Susceptibility and immunity to Vibrio anguillarum in post-hatching rainbow trout fry, Salmo gairdneri Richardson 1836. Dev. Comp. Immunol. 7, 465–472. 3. Bly, J.E. & Clem, L.W. (1991) Temperature-mediated processes in teleost immunity: in vitro immunosuppression induced by in vivo low temperature in channel catfish. Vet. Immunol. Immunopathol. 28, 365–377. 4. Cole, A.M., Weis, P. & Diamond, G. (1997) Isolation and char- acterization of pleurocidin, an antimicrobial peptide in the skin secretions of winter flounder. J. Biol. Chem. 272, 12008–12013. 5. Douglas, S.E., Gallant, J.W., Gong, Z. & Hew, C. (2001) Cloning and developmental expression of a family of pleurocidin-like antimicrobial peptides from winter flounder, Pleuronectes amer- icanus (Walbaum). Dev. Comp. Immunol. 25, 137–147. 3728 S. E. Douglas et al. (Eur. J. Biochem. 270) Ó FEBS 2003 6. Oren, Z. & Shai, Y. (1996) A class of highly potent antibacterial peptides derived from pardaxin, a pore-forming peptide isolated from Moses sole fish Pardachirus marmoratus. Eur. J. Biochem. 237, 303–310. 7. Park,C.B.,Lee,J.H.,Park,I.Y.,Kim,M.S.&Kim,S.C.(1997)A novel antimicrobial peptide from the loach, Misgurnus anguilli- candatus. FEBS Lett. 411, 173–178. 8. Hwang, E Y., Seo, J K., Kim, C H., Go, H J., Kim, E J., Chung, J K., Ryu, H S. & Park, N G. (1999) Purification and characterization of a novel antimicrobial peptide from the skin of the hagfish, Eptatretus burgeri. J. Food Sci. Nutr. 4, 28–32. 9. Silphaduang, U. & Noga, E.J. (2001) Peptide antibiotics in mast cells of fish. Nature 414, 268–269. 10. Lauth, X., Shike, H., Burns, J.C., Westerman, M.E., Ostland, V.E., Carlberg, J.M., Van Olst, J.C., Nizet, V., Taylor, S.W., Shimizu, C. & Bulet, P. (2002) Discovery and characterization of two isoforms of moronecidin, a novel antimicrobial peptide from hybrid striped bass. J. Biol. Chem. 277, 5030–5039. 11. Shike, H., Lauth, X., Westerman, M.E., Ostland, V.E., Carlberg, J.M.,VanOlst,J.C.,Shimizu,C.&Burns,J.C.(2002)Basshep- cidin is a novel antimicrobial peptide induced by bacterial chal- lenge. Eur. J. Biochem. 269, 2232–2237. 12. Douglas, S.E., Gallant, J.W., Liebscher, R.S., Dacanay, A. & Tsoi, S.C.M. (2003) Identification and expression analysis of hepcidin–like antimicrobial peptides in bony fish. Dev. Comp. Immunol. 27, 589–601. 13. Iijima,N.,Tanimoto,N.,Emoto,Y.,Morita,Y.,Uematsu,K., Murakami, T. & Nakai, T. (2003) Purification and characteriza- tion of three isoforms of chrysophsin, a novel antimicrobial pep- tide in the gills of the red sea bream, Chrysophrys major. Eur. J. Biochem. 270, 675–686. 14. Park, I.Y., Park, C.B., Kim, M.S. & Kim, S.C. (1998) Parasin I, an antimicrobial peptide derived from histone H2A in the catfish, Parasilurus asotus. FEBS Lett. 437, 258–262. 15. Birkemo, A.G., Luders, T., Andersen, O., Nes, I.F. & Nissen- Meyer, J. (2003) Hipposin, a histone-derived antimicrobial peptide in Atlantic halibut (Hippoglossus hippoglossus L.). Biochim. Bio- phys. Acta. 1646, 207–215. 16. LeMaitre, C., Orange, N., Saglioi, P., Saint, N., Gagnon, J. & Molle, G. (1996) Characterization and ion channel activities of novel antibacterial proteins from the skin mucosa of carp (Cyprinus carpio). Eur.J.Biochem.240, 143–149. 17. Smith, V.J., Fernandes, J.M.O., Jones, S.J., Kemp, G.D. & Tatner, M.F. (2000) Antibacterial proteins in rainbow trout, Oncorhynchus mykiss. Fish Shellfish Immunol. 10, 243–260. 18. Moore, K.S., Wehrli, S., Roder, H., Rogers, M., Forrest, J.N.J., McCrimmon, D. & Zasloff, M. (1993) Squalamine: an amino- sterol antibiotic from the shark. Proc. Natl Acad. Sci. USA 90, 1354–1358. 19. Jia, H.P.C.S.B., Schudy, A., Linzmeier, R., Guthmiller, J.M., Johnson, G.K., Tack, B.F., Mitros, J.P., Rosenthal, A., Ganz, T. & McCray, P.B. (2001) Discovery of human b-defensins using a genomics-based approach. Gene 263, 211–218. 20. Schutte, B.C., Mitros, J.P., Bartlett, J.A., Walters, J.D., Jia, H.P., Welsh, M.J., Casavant, T.L. & McCray, P.B. Jr (2002) Discovery of five conserved beta -defensin gene clusters using a computational search strategy. Proc. Natl Acad. Sci. USA 99, 2129–2133. 21. Cole, A.M., Darouiche, R.O., Legarda, D., Connell, N. & Diamond, G. (2000) Characterization of a fish antimicrobial peptide: gene expression, subcellular localization, and spectrum of activity. Antimicrob. Agents Chemother. 44, 2039–2045. 22. Murray, H.M., Gallant, J.W. & Douglas, S.E. (2003) Cellular localization of pleurocidin expression in winter flounder gill using immunohistochemistry and in situ hybridization. Cell Tiss. Res. 312, 197–202. 23. Douglas, S.E., Gawlicka, A., Mandla, S. & Gallant, J.W. (1999) Ontogeny of the stomach in winter flounder: characterisation and expression of the pepsinogen and proton pump genes and determination of pepsin activity. J. Fish Biol. 55, 897–915. 24. Wingender, E., Chen, X., Fricke, E., Geffers, R., Hehl, R., Liebich,I.,Krull,M.,Matys,V.,Michael,H.,Ohnhauser,R., Pruss, M., Schacherer, F., Thiele, S. & Urbach, S. (2001) The TRANSFAC system on gene expression regulation. Nucleic Acids Res. 29, 281–283. 25. Cohen, S., Sekiguchi, M., Stern, J. & Barner, H. (1963) The synthesis of messenger RNA without protein synthesis in normal and phage-infected thymineless strains of Escherichia coli. Proc. NatlAcad.Sci.USA49, 699–703. 26. Amsterdam, D. (1996) Susceptibility Testing of Antimicrobials in Liquid Media. In Antibiotics in Laboratory Medicine EI (Lorian, V., ed.), pp. 52–111. Williams & Wilkins, Baltimore. 27. Wu, M. & Hancock, R.E. (1999) Improved derivatives of bacte- necin, a cyclic dodecameric antimicrobial cationic peptide. Anti- microb. Agents Chemother. 43, 1274–1276. 28. Gudmundsson, G.H., Lidholm, D.A., Asling, B., Gan, R. & Boman, H.G. (1991) The cecropin locus. Cloning and expression of a gene cluster encoding three antibacterial peptides in Hyalo- phora cecropia. J. Biol. Chem. 166, 11510–11517. 29. Casteels-Jossen, K., Capaci, T., Casteels, P. & Tempst, P. (1993) Apidaecin multipeptide precursor structure: a putative mechanism for amplification of the insect antibacterial response. EMBO J. 12, 1569–1578. 30. Amiche, M., Seon, A.A., Pierre, T.N. & Nicolas, P. (1999) The dermaseptin precursors: a protein family with a common pre- proregion and a variable C-terminal antimicrobial domain. FEBS Lett. 456, 352–356. 31. Ganz, T., Selsted, M.E., Szklarek, D., Harwig, S.S., Daher, K., Bainton, D.F. & Lehrer, R.I. (1985) Defensins. Natural peptide antibiotics of human neutrophils. J. Clin. Invest. 76, 1427–1435. 32. Harder, J., Siebert, R., Zhang, Y., Matthiesen, P., Christophers, E., Schlegelberger, B. & Schroder, J.M. (1997) Mapping of the gene encoding human beta-defensin-2 (DEFB2) to chromosome region 8p22-p23.1. Genomics 46, 472–475. 33. Harrison, P.M., Hegyi, H., Balasubramanian, S., Luscombe, N.M., Bertone, P., Echols, N., Johnson, T. & Gerstein, M. (2002) Molecular fossils in the human genome: identification and analysis of the pseudogenes in chromosomes 21 and 22. Genome Res. 12, 272–280. 34. Hirotsune, S., Yoshida, N., Chen, A., Garrett, L., Sugiyama, F., Takahashi, S., Yagami, K., Wynshaw-Boris, A. & Yoshiki, A. (2003) An expressed pseudogene regulates the messenger-RNA stability of its homologous coding gene. Nature 423, 91–96. 35. Levy, S., Hannenhalli, S. & Workman, C. (2001) Enrichment of regulatory signals in conserved non-coding genomic sequence. Bioinformatics 17, 871–877. 36. Wagner, A. (1999) Genes regulated cooperatively by one or more transcriptionfactorsandtheiridentificationinwholeeukaryotic genomes. Bioinformatics 10, 776–784. 37. Berman,B.P.,Nibu,Y.,Pfeiffer,B.D.,Tomancak,P.,Celniker, S.E., Levine, M., Rubin, G.M. & Eisen, M.B. (2002) Exploiting transcription factor binding site clustering to identify cis-reg- ulatory modules involved in pattern formation in the Drosophila genome. Proc. Natl Acad. Sci. USA 99, 757–762. 38. Karin, M., Liu, Z. & Zandi, E. (1997) AP-1 function and reg- ulation. Curr. Opin. Cell Biol. 9, 240–246. 39. Kataoka, K., Noda, M. & Nishizawa, M. (1996) Transactivation activity of Maf nuclear oncoprotein is modulated by Jun, Fos and small Maf proteins. Oncogene 12, 53–62. 40. Petersen, U.M., Kadalayil, L., Rehorn, K.P., Hoshizaki, D.K., Reuter,R.&Engstrom,Y.(1999)SerpentregulatesDrosophila Ó FEBS 2003 Pleurocidin differential gene expression (Eur. J. Biochem. 270) 3729 [...]... CCAAT/enhancer-binding protein a and a protein that binds to the activator-protein-1 site in the regulation of liverspecific expression of the winter flounder antifreeze protein gene Eur J Biochem 247, 44–51 Miele, R., Ponti, D., Boman, H.G., Barra, D & Simmaco, M (1998) Molecular cloning of a bombonin gene from Bombina 49 50 51 52 53 54 55 56 orientalis: detection of NF-jB and NF-IL6 binding sites in its promoter FEBS... K.P., Blanar, M.A & Sharp, P.A (1992) The p50 subunit of NF-jB associates with the NF-IL6 transcription factor Proc Natl Acad Sci USA 89, 8145–8149 Kvingedal, A.M (1994) Characterization of the 5¢ region of the Atlantic salmon (Salmo salar) transferrin-encoding gene Gene 150, 335–339 Leong, J.C., Trobridge, G.D., Kim, C.H., Johnson, M & Simon, B (1998) Interferon-inducible MX proteins in fish Immunol... J.H & Baltimore, D (1990) The promoter of the human interleukin-2 gene contains two octamer-binding sites and is partially activated by the expression of Oct – 2 Mol Cell Biol 10, 5464–5472 Patrzykat, A., Zhang, L., Mendoza, V., Iwama, G & Hancock, R.E.W (2001) Synergy of histone-derived peptides of Coho salmon with lysozyme and flounder pleurocidin Antimicrob Agents Chemother 45, 1337–1342 Scott, M.G... Ross, D.A., Lyles, M., Ledford, B.E., Magor, G., Wilson, M.R., Miller, N.W., Clem, L.W., Middleton, D.A & Warr, G.W (1999) Catfish Oct2 binding affinity and functional preference for octamer motifs, and interaction with OBF-1 Dev Comp Immunol 23, 199–211 Magor, B.G., Ross, D.A., Middleton, D.A & Warr, G.W (1997) Functional motifs in the IgH enhancer of channel catfish Immunogenetics 46, 192–198 Kamps, M.P.,... Transcriptional factors NF-IL6 and NF-kappaB synergistically activate transcription of the inflammatory cytokines interleukin 6 and interleukin 8 Proc Natl Acad Sci USA 90, 10193–10197 Barra, D., Simmaco, M & Boman, H.G (1998) Gene-encoded peptide antibiotics and innate immunity FEBS Lett 430, 130– 134 Chan, S.-L., Miao, M., Fletcher, G.L & Hew, C.L (1997) The role of CCAAT/enhancer-binding protein a and a... FEBS 2003 3730 S E Douglas et al (Eur J Biochem 270) 41 42 43 44 45 46 47 48 immunity genes in the larval fat body through an essential GATA motif EMBO J 18, 4013–4022 Orkin, S.H (1995) Transcription factors and hematopoietic development J Biol Chem 270, 4955–4958 Jones, D.E & Bevins, C.L (1992) Paneth cells of the human small intestine express an antimicrobial peptide gene J Biol Chem 267, 23216–23225... (2001) Synergy of histone-derived peptides of Coho salmon with lysozyme and flounder pleurocidin Antimicrob Agents Chemother 45, 1337–1342 Scott, M.G & Hancock, R.E (2000) Cationic antimicrobial peptides and their multifunctional role in the immune system Crit Rev Immunol 20, 407–431 ... H & Romeo, D (1990) Bactenecins, defense polypeptides of bovine neutrophils, are generated from precursor molecules stored in large granules J Cell Biol 111, 1363–1371 Akira, S., Isshiki, H., Sugita, T., Tanabe, O., Kinoshita, S., Nishio, Y., Nakajima, T., Hirano, T & Kishimoto, T (1990) A nuclear factor for IL-6 expression (NF-IL6) is a member of a C/EBP family EMBO J 9, 1897–1906 Nakajima, T., Fujikawa, . Identification, structure and differential expression of novel pleurocidins clustered on the genome of the winter flounder, Pseudopleuronectes americanus (Walbaum) Susan E. Douglas, Aleksander. degeneration of the sequences upstream of the pseudogenes made it impossible to predict the locations of the first introns and exons of Y1, Y2andY3. An alignment of the peptides predicted from the pleurocidin. antimicrobial peptide candidates for both human and nonhuman therapeutants from genomic sequences and will aid in understanding the evolution and transcriptional regulation of expression of these peptides. Keywords: