One of the two bound C-WHDs of MukF is forced to detach from two ATP-bound, engaged MukB heads, and this detachment reaction depends on the MukF flexible linker preceding the C-WHD.. Here
Trang 1chromosome requires the flexible linker region of MukF Ho-Chul Shin1, Jae-Hong Lim2, Jae-Sung Woo1and Byung-Ha Oh1
1 Center for Biomolecular Recognition and Division of Molecular and Life Science, Pohang University of Science and Technology, Korea
2 Beanline Division, Pohang Accelerator Laboratory, Korea
Introduction
Without a true mitotic spindle apparatus, two copies of
the bacterial chromosome are dynamically and
effi-ciently separated during replication and are faithfully
segregated into two daughter cells [1–3] This essential
process requires chromosome condensation [4–7] which
is mediated by a number of factors including
chromo-some-compacting protein complexes, termed condensins
[8–10] Bacterial condensin complexes are composed of
a homodimeric protein, belonging to the structural
maintenance of chromosomes (SMC) family, and two
non-SMC subunits [11] SMC family proteins serve as the common subunit in the protein complexes involved
in the chromosome maintenance processes, including chromosome condensation, sister chromatid cohesion, DNA double-strand break repair and gene-dosage com-pensation [12–14] In these SMC-based complexes, the non-SMC proteins are heterogeneous and likely to modulate the function of the SMC subunit
The MukB–MukE–MukF complex, referred to as MukBEF, is the bacterial condensin found in
c-prote-Keywords
chromosome condensation; condensing;
kleisin complex; MukBEF complex; SMC
protein
Correspondence
B.-H Oh, Department of Life Sciences,
Center for Biomolecular Recognition and
Division of Molecular and Life Science,
Pohang University of Science and
Technology, Pohang, Kyungbuk 790-784,
Korea
Fax: +82 54 279 2199
Tel: +82 54 279 2289
E-mail: bhoh@postech.ac.kr
(Received 13 April 2009, revised 5 July
2009, accepted 8 July 2009)
doi:10.1111/j.1742-4658.2009.07206.x
Condensin complexes are the key mediators of chromosome condensation The MukB–MukE–MukF complex is a bacterial condensin, in which the MukB subunit forms a V-shaped dimeric structure with two ATPase head domains MukE and MukF together form a tight complex, which binds to the MukB head via the C-terminal winged-helix domain (C-WHD) of MukF One of the two bound C-WHDs of MukF is forced to detach from two ATP-bound, engaged MukB heads, and this detachment reaction depends on the MukF flexible linker preceding the C-WHD Whereas MukB is known to focally localize at particular positions in cells by an unknown mechanism, mukE- or mukF-null mutation causes MukB to become dispersed in cells Here, we report that mutations in MukF causing
a defect in the detachment reaction interfere with the focal localization of MukB, and that the dispersed distribution of MukB in cells correlates directly with defects in cell growth and division The data strongly suggest that the MukB–MukE–MukF condensin forms huge clusters through the ATP-dependent detachment reaction, and this cluster formation is critical for chromosome condensation by this machinery We also show that the MukF flexible linker is involved in the dimerization and ATPase activity of the MukB head
Structured digital abstract
l MINT-7216106 : mukBhd (uniprotkb: P22523 ), mukF (uniprotkb: P60293 ) and mukE (uni-protkb: P22524 ) physically interact ( MI:0915 ) by blue native page ( MI:0276 )
Abbreviations
C-WHD, C-terminal winged-helix domain; GFP, green fluorescence protein; SMC, structural maintenance of chromosomes.
Trang 2obacter family members including Escherichia coli The
SMC subunit MukB (molecular mass 170 kDa)
sists of globular domains at the N- and C-termini
con-nected by a long antiparallel coiled-coil ( 780
residues) folded at a hinge domain in the middle of the
molecule [15] The bipartite N- and C-terminal
domains together form an ATP-binding cassette-like
ATPase domain (also called a head domain) at the
dis-tal end, whereas the hinge domain provides the
dimer-ization interface, resulting in the characteristic
V-shaped, two-armed dimeric structure [16,17] The
two head domains are probably catalytically inactive,
unless they engage each other to provide a critical
cat-alytic residue opposing a ATP-binding site ATP
hydrolysis at the composite active sites separates the
two engaged head domains [18] This molecular
archi-tecture and the ATPase cycle appear to be shared by
all SMC proteins MukE and MukF are two
non-SMC subunits that together form an elongated frame
structure in which the C-terminal winged-helix domain
(C-WHD) of MukF is linked by a preceding flexible
linker segment [19–21]
Null mutations of mukB, mukE or mukF cause
defects in normal cell growth, such as temperature
sen-sitivity, elongated cell formation and anucleate cell
production [22], indicating that MukE and MukF are
as important as MukB for chromosome condensation
Although MukB normally colocalizes with the oriC
region to form distinctive foci at the 1⁄ 4 and 3 ⁄ 4
posi-tions of cells occupied by nucleoids [23,24], it is
dis-persed throughout cells of the mukE- or mukF-null
strain and fails to associate stably on the chromosome
[24,25] Likewise, the SMC subunit of Bacillus subtilis
condensin also forms discrete foci in cells, but
engage-ment-defective SMC mutants fail to do so [26] How
the SMC proteins form discrete foci in cells remains
elusive, and it is also unclear whether their failure to
localize focally is the direct cause of defective cell
growth
Recent structural analyses suggest that the presence
of two C-WHDs of MukF on the dimerized MukB
head is sterically unfavorable, and the MukF flexible
linker can compete with the C-WHD for binding the
MukB head at the same surface [21] Consistently,
although two MukF C-WHDs can bind two
disen-gaged MukB heads, one is forced to detach from two
ATP-sandwiched, engaged MukB heads, and this
detachment reaction depends on the MukF flexible
lin-ker [21]
In order to investigate the functional importance
of the detachment reaction, we generated a series of
MukF variants containing mutations in its flexible
linker and⁄ or the following a helix, and analyzed the
mutational effects using biochemical and cell-based experiments We show that mutations causing a defect in the detachment reaction result in defective localization of MukB, and that a dispersed distribu-tion of MukB directly correlates with defects in cell growth and division In addition, we describe an unexpected finding that this region of MukF is involved in the engagement and ATPase activity of the MukB head
Results
New mutations on the flexible linker region of MukF
In our previous study, six or seven glycine substitu-tions in the flexible linker region of MukF, designated
as LM1, LM2 and LM3 (Fig 1), were shown to cause temperature-sensitive growth of the mukFEB-null
E coli strain supplied with a plasmid containing the muk operon [21] In this study, we designed 11 new substitutions, as shown in Fig 1 Five of them, desig-nated L1–L5, refer to single alanine substitutions of five conserved hydrophobic residues on the MukF flexible linker One, designated HM, contains three consecutive glycine substitutions on the first a helix of the C-WHD following the flexible linker These subs-titutions are expected to relieve the putative steric clash between the two C-WHDs on engaged MukB heads The other five mutations, designated LH1–LH5, refer to alanine substitutions in the linker combined with HM
Fig 1 Names of the mutations introduced into MukF Aligned are the phylogenetically dispersed sequences of the flexible linker and the following a helix (a1) of MukF C-WHD: Hd, Haemophilus duc-reyi; Va, Vibrio angustum; Ah, Aeromonas hydrophila; Ec, Escheri-chia coli The secondary structural elements in this segment are shown based on the reported structure (PDB entry: 3EUK) The black and gray columns indicate conserved residues The positions
of the glycine or alanine substitutions (red letters) introduced into
E coli MukF are shown LM1–LM3 are the same mutations reported earlier [21].
Trang 3Mutations on the flexible linker region of MukF
affect the cell growth and cellular localization of
MukB–GFP
For the cell-based phenotypic assay, we employed the
KAT1 E coli strain which expresses MukB as a fusion
protein with green fluorescence protein (GFP) at the
C-terminus [24] From this strain, designated the
wild-type strain, we generated 14 derivative strains
harbor-ing LM1, LM2, LM3, or one of the 11 new mutations
on the chromosomal mukF gene by use of homologous
recombination (Table S1) We readily noted that the
new mutations were less stringent than LM1, LM2
and LM3 This is because mutant strains carrying any
new mutations grew at 37C, whereas the strain
carry-ing LM1 grew, but very slowly, and those carrycarry-ing
LM2 or LM3 were not able to grow at this
tempera-ture [21] We then compared growth of the 14 mutant
strains by measuring the sizes of single colonies on
agar plates incubated at 37 or 42C In this assay,
each set of mutations decreased the growth rate to
varying degrees (Fig 2A) At 37 C, cells carrying L2,
L3 and L5 grew almost normally compared with
wild-type cells However, L1, L4, HM and LH5 decreased
the growth rate by 20%, LH2, LH3 and LH4
decreased the growth rate by 40%, 60% and 80%,
respectively, and LH1 decreased the growth rate by
85% The reduction in growth rate by LH1 was similar
to that by LM1 At 42C, the growth defect caused
by the mutations became more apparent HM and
LH5 decreased the growth rate by 85%, and LH1–
LH4 prevented cells from forming a colony at this
temperature (Fig 2A)
In parallel, we prepared cells of each strain by liquid
culture at 30C and observed living cells under
fluo-rescence microscopy (Fig 2B) The wild-type strain
clearly exhibited MukB–GFP foci within the cells
(Fig 2B), as reported previously [24] By contrast,
LM1, LM2 and LM3 each caused dispersion of
MukB–GFP throughout the cells and a high
occur-rence of anucleate or elongated cells (Fig 2B) The
new mutations affected the foci formation of MukB–
GFP to varying degrees In order to assess the
foci-forming ability of each strain, we examined the
microscopic images and counted the number of cells
containing MukB–GFP foci With L2, L3 or L5, foci
were found in 90% of the total cells counted,
com-parable with the wild-type strain With L1, L4, LH2,
HM or LH5, 50% to 80% of the cells had foci
With LH3, 40% of the cells had foci LH1 and LH4
greatly hampered the formation of the foci and most
of the cells did not display any foci (Figs 2B and S1)
In addition, we observed that 6.0% of cells harboring
LH1 and 2.5% of cells harboring LH4 were anucleate The observed defects caused by these two mutations were comparable with that caused by LM1, but were less severe than those caused by LM2 and LM3
Mutations on the flexible linker region of MukF affect the detachment of MukF C-WHD from engaged MukB heads
For a biochemical assay of the detachment of MukF C-WHD from the MukB head, we employed the MukE–MukF(M+C)–MukBhd complex MukF (M+C) denotes a MukF fragment (residue 292–443) spanning the middle region and the C-WHD MukF(M+C) retains high binding affinity for MukE and is monomeric because of the absence of the N-ter-minal dimerization domain in full-length MukF MukBhd denotes the MukB head, which is monomeric because of a lack of the coiled-coil and the hinge domain in full-length MukB Therefore, the MukE– MukF(M+C)–MukBhd triple complex is also mono-meric AMPPNP-mediated engagement of the head domains results in the dissociation of one copy of MukE–MukF(M+C) and thus formation of the asym-metric MukE–MukF(M+C)–(MukBhd:AMPPNP)2 dimer, which can be observed on a native polyacryl-amide gel [21] We have previously shown that the triple complexes carrying LM1, LM2 or LM3 form the symmetric (MukE–MukF(M+C)–MukBhd:AMP-PNP)2 dimer as a minor product in addition to the asymmetric dimer [21] We generated 11 variants of MukE–MukF(M+C)–MukBhd containing one of the
11 new sets of mutations in MukF(M+C) These com-plexes were reacted with AMPPNP and visualized on a native gel With L1–L5, the symmetric dimer was undetectable However, with HM and LH1–LH5, for-mation of the symmetric dimer was observed (Fig 3A; the band labeled as ‘sym’), apparently showing that they affect the detachment of the MukF C-WHD from engaged MukB heads The band intensities of the sym-metric dimer varied, which should reflect its stability According to the band intensity, LH1 is most defec-tive, followed by LH4 and LH3, and then LH2 HM and LH5 are the least defective of the six mutations, because the symmetric dimer band was barely detect-able (Fig 3A)
Mutations in the flexible linker region of MukF affect the ATPase activity of the MukB head While we were probing the mutational effects on the detachment reaction we unexpectedly noted that many
of the mutations decreased the dimerization rate of the
Trang 4Nomarski MukB-GFP DNA Nomarski MukB-GFP DNA
LM1
WT
HM
L2 LH2
L4 LH4
L5 LH5
100
20
40
60
80
Cells with no foci Cells with foci
WT L3 L2 L5 LH5 L1 HM L4 LH2 LH3 LH4 LH1
0
B
37ºC 42ºC 100
120
20
40
60
80
WT LM1 LM2 LM3
0
HM L1 L2 L3 L4 L5 LH1 LH2 LH3 LH4 LH5
A
Fig 2 Mutational effects on cell growth and localization of MukB–GFP (A) Cell growth The wild-type KAT1 strain and its derivative strains harboring each of the indi-cated mutations on the chromosome were spread on the LB agar plate and incubated
at 37 or 42 C for 21 h Four representative plates incubated at 37 C are shown at the top The size of 10 well-isolated single colo-nies was measured and averaged The aver-aged sizes scaled to that of the wild-type strain are shown together with the error bars for standard deviations (B) Localization
of MukB–GFP The cells grown at 30 C were mixed with Hoechst 33342 and observed under fluorescence microscopy Representative images are shown in three different schemes for each strain Abnor-mally elongated cells are observable with LM2 and LM3, whereas noticeably elon-gated cells are observable with LM1 and LH1 The mutations on the linker and a1 (LH1–LH5) caused greater dispersion of MukB–GFP compared with the correspond-ing mutation on the linker only (L1–L5) The observed defect caused by HM is similar to that caused by LH5 The microscopic images of 200 cells of each strain were inspected to count the number of cells with and without MukB–GFP foci (see Fig S1 for details) The result is summarized as a bar graph shown at the bottom.
Trang 5triple complex That is, triple complexes at high
con-centrations exhibited different band intensities to the
engaged complexes, unless the dimerzation reaction
was carried out fully (Fig 3A) Because head domain
engagement is a prerequisite for the ATPase activity of
the MukB head, we examined whether the
muta-tions also affect the catalytic activity of MukE–
MukF(M+C)–MukBhd Indeed, the mutant triple
complexes exhibited varying degrees of ATPase activity
(Fig 3B,C) L5 reduced the ATPase activity by 10%
from that of wild-type, whereas HM and LH5 reduced
the activity by 40% However, it decreased > 50%
with other mutations, and > 85% with L1 and L4
ATPase activity was generally proportional to the extent of dimerization of the triple complex at a given time, which was estimated by quantifying the band intensities of the engaged complexes (bands sym and b)
on the native gel (Fig 3C) As a control experiment,
we introduced an alanine substitution for Asp335, a linker residue (Fig 1) which does not interact with the MukB head in the structure of the asymmetric dimer [21] This D335A mutation did not affect the ATPase activity of the triple complex (not shown), indicating that the reduced ATPase activities observed with the other mutations do not arise from nonspecific muta-tional defects
AMPPNP – + – + – + – + – + – + – + – + – + – + – + – +
A
b
sym
MukBhd
a
c
2 X
+
(b) (c)
MukF (M + C) MukE
2 AMPPNP ( )
+
B
% Intensity of the dimer band (s)
% ATPase activity
C
120
6
7 L1
L2 L3
WT
WT L5
40
60
80
100
2
3
4
5
L4 L5 LH1 LH2 LH3 LH4 LH5
HM
L2 LH2
wt HM L1 LH1 L2 LH2 L3 LH3 L4 LH4 L5 LH5
0
20
0 10 20 30 40
0
1
Fig 3 Mutational effects on the dimerization and the ATPase activity of MukE–MukF(M+C)–MukBhd (A) AMPPNP-mediated dimerization The triple complexes (166 l M ; band a) containing the indicated mutations were reacted with 10 m M AMPPNP and visualized on a native gel Three different reaction products were observed: the symmetric (MukE–MukF(M+C)–MukBhd:AMPPNP)2dimer (band sym), the asymmetric MukE–MukF(M+C)–(MukBhd:AMPPNP)2dimer (band b) and detached MukE–MukF(M+C) (band c) The symmetric dimer is observable with
HM and LH1–LH5 (highlighted by red arrows) The procedures for the identification of the protein bands have been reported [21] The sche-matic drawing illustrates the conversion reaction (B) ATPase activity Time-course ATPase assay was performed with the triple complexes containing the indicated mutations The activity is expressed as the number of ATP molecules hydrolyzed per one MukBhd monomer (C) Summary diagram The intensities of band b (plus band sym when observed) on the native gel shown in (A) were quantified and scaled to that of the wild-type complex The initial rates of ATP hydrolysis were deduced from the time-course assay in (B) Average values of tripli-cate measurements were used and scaled to that of the wild-type complex.
Trang 6Correlation between the detachment reaction,
localization of MukB–GFP and cell growth
We combined the observed phenotypic effects of the
new mutations into a tabular form (Table1) This
shows that the extent of the dimerization of the
MukE–MukF(M+C)–MukBhd complexes correlates
with their ATPase activity, albeit roughly However, it
is unrelated to how well they form the symmetric
dimer Good correlation was found between the
micro-scopic observation of the individual cells and the cell
growth on agar plates Strains carrying L2, L3 or L5
displayed bright MukB–GFP foci and grew as well as
the wild-type strain at 37C In strains carrying L1,
L4, HM, LH2 or LH5, foci formation was
compro-mised and cell growth was retarded noticeably at
37C and significantly at 42 C (Table 1) In strains
carrying the other mutations (LH1, LH3, LH4), the
foci were undetectable in the majority of cells (Fig 2B)
and cell growth was severely retarded at 37C and
completely prevented at 42C The band intensity of
the symmetric dimer on the native gel (Fig 3A)
corre-lates with the defect in the foci formation of MukB–
GFP, because LH1, LH3 and LH4 affected the
forma-tion of MukB–GFP foci more severely than did LH2
(Table 1) Moreover, LM1, LM2 and LM3, for which
the symmetric dimer was clearly observed [21], did not
display any MukB–GFP foci and accompanied severe
defects in cell growth and division (Fig 2) These
observations indicate that the detachment reaction is
required for the formation of MukB foci, and that this
focal localization of MukB on the chromosome is a requisite for normal cell growth and division
Because the mutations on the linker region of MukF also affect the ATPase activity of MukE– MukF(M+C)–MukBhd, the observed physiological defects may simply have arisen from the decreased AT-Pase activity of MukB in cells Comparison of the observed phenotypes reveals that this was not the case L1 and L4 decreased the ATPase activity more signifi-cantly than LH1–LH4 did (Table 1) However, L1 and L4 only mildly affected cell growth⁄ division and the foci formation of MukB–GFP, whereas LH1, LH3 and LH4 caused clearly notable defects in the cell-based tests Furthermore, the negative effect of HM, LH2 and LH5 on the ATPase activity was much less than that of L1 and L4, but their effects on cell growth and the foci formation of MukB–GFP were similar (Table 1) Moreover, LM1 decreased ATPase activity
by only 22% (not shown), but the other phenotypic defects caused by this mutation were more serious than those caused by any other of the 11 new mutations These observations suggest that the defective detach-ment reaction, rather than the reduced ATPase activ-ity, is responsible for the phenotypic defects caused by the mutations The observed symmetric dimer is only a fractional portion compared with the asymmetric dimer in the in vitro reaction (Fig 3A), and thus the effect of the mutations on the detachment reaction appears insignificant We suggest that the effect is significant in vivo, because a mutated linker may frequently fail to displace MukF C-WHD from MukB
Table 1 Summary of the phenotypic observations WT, wild-type.
Mutation
ATPase activity a Dimer formation b Symmetric dimer c MukB foci d Anucleate cells 37 C 42 C
a The activities were divided into five levels Each ‘+’ sign corresponds to 20% of the ATPase activity of the wild-type complex b The extent
of dimer formation: ‘++++’, 100–120% of the band intensity of the asymmetric dimer of the wild-type complex; ‘+++’, 80–100%; ‘++’, 60– 80%; ‘+’, 40–60%.c‘ )’: Symmetric dimer was undetectable The number of + signs is in accordance with the band intensity of the sym-metric dimer on the native gel shown in Fig 3A Parentheses indicate that the bands were observable but only faintly d Percentage of cells exhibiting MukB–GFP foci: ‘++’, 90% of the total cells counted; ‘+’, 40–80%; ‘ )’, < 40%.
Trang 7heads transiently dimerized by ATP [21] This provides
an explanation as to why L1–L5 resulted in
physiologi-cal defects, even though the symmetric dimer was not
observed with these mutations in vitro
Discussion
Because MukB is a part of the MukBEF condensin, the
distinctive foci of MukB–GFP in wild-type cells indicate
that this condensin tends to form huge clusters on
chro-mosome at the 1⁄ 4 and 3 ⁄ 4 positions of cells Cluster
formation is driven by ATP binding and hydrolysis,
because a single amino acid substitution at the
ATP-binding site on the MukB head (K40I, S1366R,
E1407Q) resulted in dispersion of the GFP signal
(Fig 4), as observed for the engagement-defective
B subtilisSMC [26] We showed that mutations on the
MukF flexible linker may result in the failure of MukB–
GFP to form discrete foci, demonstrating that the intact
linker is required for the focal localization of MukB
Importantly, mutations that caused a higher dispersion
of MukB–GFP resulted in greater retardation of cell growth accompanied by a more frequent occurrence
of abnormal cells, indicating that clustering of the MukBEF condensin is functionally significant Because the phenotypic defects observed at the cellular level cor-relate well with the defect in the detachment of MukF C-WHD from dimerized MukB heads, formation of MukBEF clusters is likely to require the detachment reaction, which is coupled to ATP binding by the MukB head What is the nature of the huge cluster of MukBEF? MukB and MukEF form various heteroge-neous closed ring-like structures, and these condensin rings may be opened and closed as a result of ATP binding and hydrolysis by MukB heads [21] It is tempt-ing to speculate that the MukBEF clusters, observed as the distinctive MukB foci, may involve concatenation of MukBEF condensin rings Very recent studies have shown that ParB⁄ SpoOJ recruits the SMC–ScpA–ScpB condensin to the origin regions in B subtilis [27,28] Although a cross-linking experiment indicated a direct interaction between SMC and ParB⁄ SpoOJ [28], this is unlikely to be the sole driving force, considering that the point mutations on the ATP-binding site of MukB, which would not affect such interaction in E coli, resulted in the dispersion of MukB–GFP (Fig 4)
In the AMPPNP-mediated dimerization reaction, the asymmetric dimer is energetically more stable than the symmetric dimer, because the latter was unobservable
or only slightly observed If a mutation destabilizes the asymmetric dimer, it should increase the rate of the reverse conversion of the asymmetric dimer into the symmetric dimer and then into the starting monomeric MukE–MukF(M+C)–MukBhd complex This thermo-dynamic consideration provides an explanation for why the mutations on the MukF flexible linker affect the dimerization rate of the triple complex These mutations also affected the ATPase activity of the triple complex
We previously suggested that the ATPase cycle of MukBEF involves: (a) formation of a symmetric dimer
of MukB heads to which two MukF C-WHDs are attached, (b) the subsequent formation of an asym-metric dimer to which the MukF flexible linker is bound
by replacing MukF C-WHD on the opposing MukB head, and (c) ATP hydrolysis accompanying the dissoci-ation of the two MukB heads [21] Although the linker
is involved in formation of the asymmetric dimer in this reaction path, it would not be able to affect symmetric dimer formation, which is a physical association step between two MukB heads Therefore, the reduction in the ATPase activity by the mutations on the linker further supports that ATP is not hydrolyzed as soon as the two head domains engage each other However, the observation seems to suggest that the ATPase activity
Nomarski MukB-GFP DNA
WT
K40I
S1366R
E1407Q
Fig 4 Point mutations at the active site of MukB head cause
dis-persion of MukB–GFP and the elongation of cells Mutant KAT1
cells harboring each of the indicated mutations on the
chromo-somal MukB gene were grown at 30 C, stained with Hoechst
33342 and observed under fluorescence microscopy The K40I,
S1366R and E1407Q mutations are expected to abolish ATP
bind-ing, head domain engagement and disengagement of dimerized
MukB heads, respectively, according to the defects caused by the
corresponding mutations in B subtilis SMC [26] All the three
mutant strains exhibit dispersion of MukB–GFP throughout the cells
that are abnormally elongated.
Trang 8of the symmetrically engaged MukB dimer with two
bound ATP molecules is catalytically less active than
the asymmetrically engaged dimer Although further
investigation is needed to explain our observation, the
suggested lower ATPase activity of the symmetrically
engaged dimer may ensure that the MukF flexible linker
has time to competitively displace MukF C-WHD from
the opposing MukB head before the hydrolysis of
bound ATP takes place during the course of the
cata-lytic cycle of MukBEF
In conclusion, this study shows a strong correlation
between normal cell growth and the focal localization
of MukB on the chromosome, both of which are
affected by mutations in the MukF linker region which
result in a defect in the detachment of MukF C-WHD
from engaged MukB heads The commonly observed
dispersion of MukB in mutant cells containing
detach-ment-defective MukF or ATPase-defective MukB
sug-gests that formation of huge clusters of the MukBEF
condensin requires the ATP-dependent detachment
reaction as an important part of its functional
mecha-nism It will be of great interest to elucidate the nature
of the driving forces for the concentration of the
con-densin complexes at the particular cell positions
Materials and methods
Construction of mutant KAT1 strains
The E coli KAT1 strain which produces a MukB–GFPuv4
fusion protein [24] was a kind gift of S Adachi (University
of Nottingham, UK) All derivative strains of KAT1 were
constructed using Counter-Selection BAC Modification Kit
(Gene Bridges, Heidelberg, Germany) In brief, we first
modified the wild-type rpsL allele of KAT1 into rpsL150 to
confer resistance to streptomycin; a synthetic single strand
GTTTTCTAGGAGTGGTAGTATATACACGAGTACAT
ACGCCA-3¢ was introduced into the
recombination-com-petent KAT1 cells via electroporation and the successful
transformants were obtained on streptomycin-containing
agar plates Next, we replaced a gene fragment spanning
400 bp around the site of mutation on bacterial
chromo-some with the rpsL-neo counter-selection⁄ selection cassette
This selectable marker gene fragment was designed to have
50 bp homology arms at both ends which delimiting the
region of homologous recombination, and was
electroporat-ed into streptomycin-resistant KAT1 cells
Neomycin-resis-tant, streptomycin-sensitive transformants were selected at
20C Finally, we cleared the selectable marker gene
inte-grated on chromosome by substitution with the original
DNA fragment but this time containing appropriate
muta-tion on it Colonies that survived streptomycin selecmuta-tion on
agar plates were further examined and the mutations were confirmed by DNA sequencing
Fluorescence microscopy
chloramphenicol When D600reached between 0.7 and 1.2, cell aliquots were supplemented with the Hoechst 33342 (Invitrogen, Carlsbad, CA, USA) dye (5 lm) and the incuba-tion was continued for 15 min A 150 lL aliquot of cell suspension was dropped on a poly-(l-lysine)-coated cover slip After 5 min incubation, the cover slip was rinsed six times in NaCl⁄ Pi, placed on a 50 lL NaCl⁄ Pi-spotted microscope slide, and observed using an Axiovert 200M fluorescence microscope (Carl Zeiss)
Size measurement of colonies on agar plate
Wild-type and mutant KAT1 cells were grown twice at
chloram-phenicol from D600= 0.05 to D600= 0.42–0.47, first in
3 mL and then in 20 mL of culture medium Subsequently, these cells were mixed with glycerol (10%) and were frozen
in liquid nitrogen and stored at )80 C Each cell stock was spread on a LB agar plate using glass beads and
were digitized using LAS-3000 (Fuji Film, Tokyo, Japan), and 10 colonies on each plate were chosen and their areas were measured using the multi gauge v3.0 program supplied with the instrument
Production of MukE–MukF(M+C)–MukBhd
Construction, production and purification of the complex was as previously described [21] In brief, the relevant DNA fragments were amplified by PCR from the E coli K12 gen-ome MukBhd was designed to contain the N- and C-termi-nal parts (residues 1–242, and 1235–1486) connected by an artificial SGGSGGS sequence The three proteins were coex-pressed from a two-promoter expression vector in the E coli BL21 (DE3) RIL strain (Novagen, Merck Chemical Ltd.,
purified by metal affinity, ion exchange and size-exclusion chromatography Mutations on MukF(M+C) were intro-duced using a standard PCR-based site-directed mutagenesis method, and confirmed by DNA sequencing The mutant complexes were purified in the same way
Reaction of MukE–MukF(M+C)–MukBhd with AMPPNP
with 10 mm AMPPNP (Sigma, St Louis, MO, USA) in a
Trang 9buffer containing 10 mm NaCl, 1 mm MgCl2 and 20 mm
Tris⁄ HCl (pH 7.5) at 37 C for 1 h in a final volume of
5 lL The reaction mixtures were separated on a native gel
and visualized by Coomassie Brilliant Blue staining The
intensity of protein bands was analyzed using the multi
ATPase assay
Protein samples (each at 10 lm) were mixed with 500 lm
MgCl2at 22C ATPase activity was measured by
Phosphate Assay Kit (Invitrogen) based on the
2-amino-6-mercapto-7-methylpurine riboside⁄ purine nucleoside
phos-phorylase system
Acknowledgements
We greatly appreciate Dr Shun Adachi for providing
the KAT1 strain We also thank Dr Joung-Hun Kim
for the use of the fluorescence microscope This study
was supported by Creative Research Initiatives (Center
for Biomolecular Interaction) of MOST⁄ KOSEF
H-CS, J-HL were supported by the Brain Korea 21
Project
References
1 Strunnikov AV (2006) SMC complexes in bacterial
chromosome condensation and segregation Plasmid 55,
135–144
2 Swedlow JR & Hirano T (2003) The making of the
mitotic chromosome: modern insights into classical
questions Mol Cell 11, 557–569
3 Webb CD, Teleman A, Gordon S, Straight A, Belmont
A, Lin DC, Grossman AD, Wright A & Losick R
(1997) Bipolar localization of the replication origin
regions of chromosomes in vegetative and sporulating
cells of B subtilis Cell 88, 667–674
4 Ben-Yehuda S, Fujita M, Liu XS, Gorbatyuk B, Skoko
D, Yan J, Marko JF, Liu JS, Eichenberger P, Rudner DZ
et al.(2005) Defining a centromere-like element in
Bacil-lus subtilisby identifying the binding sites for the
chro-mosome-anchoring protein RacA Mol Cell 17, 773–782
5 Long SW & Faguy DM (2004) Anucleate and titan cell
phenotypes caused by insertional inactivation of the
structural maintenance of chromosomes (smc) gene in
the archaeon Methanococcus voltae Mol Microbiol 52,
1567–1577
6 Strunnikov AV (2003) Condensin and biological role
of chromosome condensation Prog Cell Cycle Res 5,
361–367
7 Volkov A, Mascarenhas J, Andrei-Selmer C, Ulrich HD
& Graumann PL (2003) A prokaryotic condensin⁄ cohe-sin-like complex can actively compact chromosomes from a single position on the nucleoid and binds to DNA as a ring-like structure Mol Cell Biol 23, 5638– 5650
8 Hirano T (2005) Condensins: organizing and segregat-ing the genome Curr Biol 15, R265–R275
9 Britton RA, Lin DC & Grossman AD (1998) Charac-terization of a prokaryotic SMC protein involved in chromosome partitioning Genes Dev 12, 1254–1259
10 Strunnikov AV, Hogan E & Koshland D (1995) SMC2,
a Saccharomyces cerevisiae gene essential for chromo-some segregation and condensation, defines a subgroup within the SMC family Genes Dev 9, 587–599
11 Losada A & Hirano T (2005) Dynamic molecular link-ers of the genome: the first decade of SMC proteins Genes Dev 19, 1269–1287
12 Hirano T (1999) SMC-mediated chromosome mechan-ics: a conserved scheme from bacteria to vertebrates? Genes Dev 13, 11–19, doi: 10.1101/gad.13.1.11
13 Strom L & Sjogren C (2007) Chromosome segregation and double-strand break repair – a complex connection Curr Opin Cell Biol 19, 344–349
14 Strunnikov AV & Jessberger R (1999) Structural main-tenance of chromosomes (SMC) proteins: conserved molecular properties for multiple biological functions Eur J Biochem 263, 6–13
15 Niki H, Jaffe A, Imamura R, Ogura T & Hiraga S (1991) The new gene mukB codes for a 177 kd protein with coiled-coil domains involved in chromosome parti-tioning of E coli EMBO J 10, 183–193
16 Niki H, Imamura R, Kitaoka M, Yamanaka K, Ogura
T & Hiraga S (1992) E coli MukB protein involved in chromosome partition forms a homodimer with a rod-and-hinge structure having DNA binding and ATP⁄ GTP binding activities EMBO J 11, 5101–5109
17 Melby TE, Ciampaglio CN, Briscoe G & Erickson HP (1998) The symmetrical structure of structural mainte-nance of chromosomes (SMC) and MukB proteins: long, antiparallel coiled coils, folded at a flexible hinge
J Cell Biol 142, 1595–1604
18 Hirano T (2006) At the heart of the chromosome: SMC proteins in action Nat Rev Mol Cell Biol 7, 311–322
19 Fennell-Fezzie R, Gradia SD, Akey D & Berger JM (2005) The MukF subunit of Escherichia coli condensin: architecture and functional relationship to kleisins EMBO J 24, 1921–1930
20 Yamazoe M, Onogi T, Sunako Y, Niki H, Yamanaka
K, Ichimura T & Hiraga S (1999) Complex formation
of MukB, MukE and MukF proteins involved in chro-mosome partitioning in Escherichia coli EMBO
J 18, 5873–5884
21 Woo JS, Lim JH, Shin HC, Suh MK, Ku B, Lee KH, Joo K, Robinson H, Lee J, Park SY et al (2009)
Trang 10Struc-tural studies of a bacterial condensin complex reveal
ATP-dependent disruption of intersubunit interactions
Cell 136, 85–96
22 Yamanaka K, Ogura T, Niki H & Hiraga S (1996)
Identification of two new genes, mukE and mukF,
involved in chromosome partitioning in Escherichia coli
Mol Gen Genet 250, 241–251
23 Danilova O, Reyes-Lamothe R, Pinskaya M, Sherratt
D & Possoz C (2007) MukB colocalizes with the oriC
region and is required for organization of the two
Escherichia colichromosome arms into separate cell
halves Mol Microbiol 65, 1485–1492
24 Ohsumi K, Yamazoe M & Hiraga S (2001) Different
localization of SeqA-bound nascent DNA clusters and
MukF–MukE–MukB complex in Escherichia coli cells
Mol Microbiol 40, 835–845
25 She W, Wang Q, Mordukhova EA & Rybenkov VV
(2007) MukEF is required for stable association of
MukB with the chromosome J Bacteriol 189, 7062–
7068
26 Mascarenhas J, Volkov AV, Rinn C, Schiener J,
Guckenberger R & Graumann PL (2005) Dynamic
assembly, localization and proteolysis of the
Bacil-lus subtilisSMC complex BMC Cell Biol 6, 28
27 Sullivan NL, Marquis KA & Rudner DZ (2009) Recruitment of SMC by ParB–parS organizes the origin region and promotes efficient chromosome segregation Cell 137, 697–707
28 Gruber S & Errington J (2009) Recruitment of condensin
to replication origin regions by ParB⁄ SpoOJ promotes chromosome segregation in B subtilis Cell 137, 685–696
Supporting information The following supplementary material is available: Fig S1 Counting the number of cells exhibiting MukB–GFP foci
Table S1 Strains used in this study
This supplementary material can be found in the online article
Please note: As a service to our authors and readers, this journal provides supporting information supplied
by the authors Such materials are peer-reviewed and may be re-organized for online delivery, but are not copy-edited or typeset Technical support issues arising from supporting information (other than missing files) should be addressed to the authors