Báo cáo khoa học: Subcellular localization of yeast Sec14 homologues and their involvement in regulation of phospholipid turnover pptx

Subcellular localization of yeast Sec14 homologues and their involvement in regulation of phospholipid turnover Martina Schnabl 1 , Olga V. Oskolkova 1 , Roman Holic ˇ 2 , Barbara Brez ˇ na ´ 2 , Harald Pichler 3 , Milos ˇ Za ´ gors ˇ ek 2 , Sepp D. Kohlwein 4 , Fritz Paltauf 1 ,Gu¨ nther Daum 1 and Peter Griac ˇ 2 1 Department of Biochemistry, University of Technology, Graz, Austria; 2 Institute of Animal Biochemistry and Genetics, Slovak Academy of Sciences, Ivanka pri Dunaji, Slovak Republic; 3 Department of Biochemistry, Faculty of Sciences, Sciences II, University of Geneva, Switzerland; 4 Department of Molecular Biology, Biochemistry and Microbiology, SFB Biomembrane Research Center, University of Graz, Austria Sec14p of the yeast Saccharomyces cerevisiae is involved in protein secretion and regulation of lipid synthesis and turnover in vivo, but acts as a phosphatidylinositol–phos- phatidylcholine transfer protein in vitro. In this work, the five homologues of Sec14p, Sfh1p–Sfh5p, were subjected to biochemical and cell biological analysis to get a better view of their physiological role. We show that overexpression of SFH2 and SFH4 suppressed the sec14 growth defect in a more and SFH1 in a less efficient way, whereas overexpres- sion of SFH3 and SFH5 did not complement sec14.Using C-terminal yEGFP fusions, Sfh2p, Sfh4p and Sfh5p are mainly localized to the cytosol and microsomes similar to Sec14p. Sfh1p was detected in the nucleus and Sfh3p in lipid particles and in microsomes. In contrast to Sec14p, which inhibits phospholipase D1 (Pld1p), overproduction of Sfh2p and Sfh4p resulted in the activation of Pld1p-mediated phosphatidylcholine turnover. Interestingly, Sec14p and the two homologues Sfh2p and Sfh4p downregulate phospho- lipase B1 (Plb1p)-mediated turnover of phosphatidylcholine in vivo. In summary, Sfh2p and Sfh4p are the Sec14p homologues with the most pronounced functional similarity to Sec14p, whereas the other Sfh proteins appear to be functionally less related to Sec14p. Keywords: SEC14; Sec14 homologues; subcellular localiza- tion; phosphatidylcholine; phospholipase. The product of the Saccharomyces cerevisiae SEC14 gene was originally identified as a phosphatidylinositol transfer protein (PITP) which catalyzes in vitro transport of phos- phatidylinositol (PtdIns) and phosphatidylcholine (PtdCho) between artificial and biological membranes [1]. Moreover, Sec14p is essential for protein transport from the Golgi complex to the cell periphery in vivo [2]. Systematic screenings led to the discovery that mutations in the CDP- choline pathway of PtdCho biosynthesis suppressed the sec14 defect [3], suggesting a link between Sec14p function and lipid metabolism. This view was supported by the finding that phospholipase D1 (Pld1p) mediated PtdCho turnover is necessary for suppression of the sec14 growth and secretory defects [4,5]. In addition to its regulatory role on the enzyme level, Sec14p was shown to contribute to the regulation of phospholipid biosynthesis at the transcrip- tional level [6]. Nevertheless, despite the accumulating evidence [7,8] and even the elucidation of the crystal structure of Sec14p [9], the function of Sec14p at the molecular level in processes related to lipid metabolism remained obscure. The yeast genome contains five genes named SFH1-5 (SEC fourteen homologues) whose products exhibit signi- ficant sequence homology to Sec14p (Table 1). Initial characterization of these Sec14 homologues [10] revealed that four of them are novel PITPs exhibiting PtdIns but not PtdCho transfer activity. High expression levels of Sfh2p, Sfh4p, and Sfh5p through a strong constitutive yeast promoter led to suppression of sec14-related growth and secretion defects. Deletion of two Sec14 homologues, namely Sfh3p and Sfh4p (previously named Pdr16p and Pdr17p, respectively), resulted in sensitivity against several drugs [11]. This effect was most obvious in a sfh3D sfh4D double mutant. Both mutations caused significant changes of the lipid composition of the plasma membrane: deletion of SFH3 had a pronounced effect on the sterol composition, and deletion of SFH4 resulted in alterations of the phospholipid pattern [11]. Recently, the SFH4 gene product was identified as a component involved in the intracellular transport of phosphatidylserine to its site of decarboxyla- tion by Psd2p [12]. In addition, Sfh2p (also named Csr1p) was identified as a multicopy suppressor of a mutant defective in chitin synthesis and cell morphogenesis [13]. To obtain more insight into the physiological role of the Sec14 homologues, we performed extended studies testing the ability of these homologues to complement sec14 growth and secretion defects, investigated the phenotype of sfh deletion mutants with respect to growth on various carbon Correspondence to Peter Griac ˇ , Institute of Animal Biochemistry and Genetics, Slovak Academy of Sciences, 900 28 Ivanka pri Dunaji, Slovak Republic. Fax: + 421 2 45943032, Tel.: + 421 2 45943151, E-mail: Peter.Griac@savba.sk Abbreviations: Cho, choline; GroPCho, glycerophosphocholine; Ins, inositol; Pld1p, phospholipase D1; PITP, phosphatidylinositol trans- fer protein; PtdCho, phosphatidylcholine; PtdIns, phosphatidyl- inositol; PtdSer, phosphatidylserine; SFH, Sec14 homologue; yEGFP, yeast enhanced green fluorescent protein; YPD, yeast extract/peptone/ dextrose. (Received 19 March 2003, revised 9 May 2003, accepted 27 May 2003) Eur. J. Biochem. 270, 3133–3145 (2003) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03688.x sources and sensitivity to drugs, and determined the lipid composition of the respective deletion strains. To correlate not only the function of Sec14 homologues to that of Sec14p, but also to compare the sites of action of these polypeptides, C-terminal fusions of Sfh-proteins with yEGFP were constructed and the localization of the proteins in the yeast cell was determined. The enzyme catalyzing deacylation of PtdCho in S. cere- visiae is a phospholipase B encoded by the PLB1 gene [14]. In a previous study [15] we observed increased glycero- phosphocholine (GroPCho) release in a sec14 ts mutant at the nonpermissive temperature. This observation is in line with the involvement of Sec14p in regulation of phospho- lipid metabolism. Here we demonstrate that overexpression of Sec14p, Sfh2p or Sfh4p resulted in reduced release of GroPCho. We also show that Sfh2p and Sfh4p stimulate phospholipase D1 (Pld1p) activity in contrast to Sec14p, which had been shown previously to inhibit the activity of this enzyme [10]. Thus, Sec14p and its homologues appear to form a network of proteins involved in the regulation of phospholipid metabolism. Materials and methods Strains and culture conditions Yeast strains used in this study are listed in Table 2. Cells were grown on yeast extract/peptone/dextrose (YPD; 2% glucose) media unless otherwise stated. Growth tests on fermentable and nonfermentable carbon sources were performed on solid media containing 1% yeast extract, 2% peptone, and 2% agar supplemented with 2% glucose, lactate or ethanol, respectively. For drug resistance assays on solid media, drugs were added to the media immediately prior to pouring plates as described by van den Hazel et al. [11]. Chemically defined synthetic media lacking inositol and choline (Ins–/Cho–) or supplemented with 75 l M inositol and 1 m M choline (Ins+/Cho+) were prepared as described previously [16]. Plasmid and strain construction Standard genetic methods were used throughout the work [17]. Yeast transformation was performed by the lithium acetate method [18]. Plasmids. Episomal plasmids containing SEC14 and its homologues under their own promoters were constructed on the basis of a 2 lm plasmid YEplac181 [19] as follows: SEC14 gene was subcloned from an ATCC 3723 genomic library plasmid (identified in an unrelated experiment) using XbaIandNsiI restriction sites into XbaI/PstIrestric- tion sites of YEplac181, creating plasmid YEplac181- SEC14. The subcloned SEC14 gene region contains 638 bp of upstream promoter region of the SEC14 gene and 879 bp downstream of SEC14.TheSFH1 ORF region was generated by PCR using FY1679 chromo- somal DNA as a template. PCR primers were 5¢-GGCAT GTGGGTGAATTACAA-3¢ and 5¢-TTTGGGCCGGTT CATTGTT-3¢. The generated DNA fragment was cut by SacIandPstI restriction enzymes and subcloned into SacI/ PstI sites of YEplac181, creating plasmid YEplac181- SFH1. Subcloned SFH1 fragment contains 694 bp of upstream promoter region of SFH1 and 266 bp down- stream of SFH1. SFH2 was subcloned from an ATCC 37323 genomic library plasmid (identified in an unrelated experiment) using NsiI restriction sites to PstIrestriction site of YEplac181, creating plasmid YEplac181-SFH2. Subcloned SFH2 region contains 527 bp of upstream promoter region of SFH2 and 745 bp downstream of SFH2. SFH3 was subcloned from plasmid pBVH1355 [11] using SacI, SalI restriction sites into respective sites of YEplac181, creating plasmid YEplac181-SFH3. SFH4 was subcloned from plasmid pBVH1410 [11] using SacI, KpnI restriction sites into the same restriction sites of YEplac181, creating plasmid YEplac181-SFH4. Subcloned SFH4 gene region contains 598 bp of upstream promoter region of SFH4. SFH5 was subcloned from plasmid pYCG-YJL145W (kindly provided by D. Alexandraki, University of Crete, Heraklion, Greece) using XbaI restriction sites into the same site of YEplac181, creating plasmid YEplac181-SFH5. Subcloned SFH5 region con- tains 949 bp of upstream promoter region of SFH5 and 167 bp downstream of SFH5. To create multicopy plasmids with the URA3 gene as a yeast selective marker, SEC14, SFH2,andSFH4 were subcloned into plasmid YEplac195 [19]. Gene disruptions. All Sec14 homologues gene disruptions were made in the FY1679–28c genetic background. The mutants sfh3D and sfh4D were kindly provided by A. Goffeau (Catholic University Louvain, Louvain la Neuve, Belgium) [11], and sfh5D was obtained from D. Alexandraki (University of Crete, Heraklion, Greece). The strains sfh1D and sfh2D were constructed using a kanMX4 module in a two step PCR synthesis to produce marker DNA flanked by long homology regions [20]. Primers used for the construction of the respective deletions andtoverifycorrectdeletionsarelistedinTable3. Sfh-yEGFP hybrids. All GFP constructs were generated in diploid FY1679 and in haploid FY1679–28c strains using homologous recombination. The transforming DNA was a linear PCR fragment (primers P1 and P2, Table 4) using plasmid pMK199 (C-fus-GA5-yEGFP-kanMX6, kindly provided by P. Philippsen, Biocenter University Basel, Switzerland) as a template [21]. This PCR created yEGFP- kanMX6 DNA sequences flanked by the last 65–70 Table 1. SEC14 and SFH genes. Accession number Gene Name Alternative gene names % Identity to SEC14 YMR079W SEC14 YKL091C SFH1* 62.5 YLR380W SFH2 CSR1 20.7 YNL231C SFH3 PDR16 21.7 YNL264C SFH4 PDR17, ISS1, PSTB2 19.4 YJL145W SFH5 16.1 * In databases another SFH1 gene (ORF YLR321c) is referred. This gene product, which is homologous to Snf5p and involved in chromatin modeling and cell cycle progression, is not related to SFH1 (ORF YKL091) described in this study. 3134 M. Schnabl et al. (Eur. J. Biochem. 270) Ó FEBS 2003 Table 2. Yeast strains. Name Genotype Source PGY57 MATa ura3, his3, leu2, trp1, pld1::URA3, cki1::HIS3, sec14–1 ts S. Henry [5] PGY84 MATa leu2, trp1, lys2, ura3, his3, sec14–1 ts This work CTY1–1 A MATa ura3, lys2, his3, sec14–1 ts V. Bankaitis [3] CTY393 MATa ura3, lys2, his3, cki1::HIS3 V. Bankaitis [3] CTY392 MATa ura3, lys2, his3, sec14–1 ts , cki1::HIS3 V. Bankaitis [3] PGY188 MATa ura3, lys2, his3, sec14–1 ts , cki1::HIS3, [YEp195-SFH2] This work PGY206 MATa ura3, lys2, his3, sec14–1 ts , cki1::HIS3, [YEp195-SFH4] This work PGY207 MATa ura3, lys2, his3, sec14–1 ts , cki1::HIS3, pld1::kanMX4, [YEp195-SFH4] This work JAGwt MATa his3, leu2, trp1, ura3 S. Henry [5] S3 MATa leu2, his3, ura3, pct1::URA3, sec14::kanMX This work S7 MATa ade, trp1, his3, ura3, leu2, cki1::HIS3, sec14::kanMX This work PGY160 MATa leu2, his3, ura3, pct1::URA3, sec14::kanMX, [YEp181-SFH1-yEGFP] This work PGY159 MATa leu2, his3, ura3, pct1::URA3, sec14::kanMX, [YEp181-SFH2-yEGFP] This work PGY126 MATa ura3, his3, cki1::HIS3, sec14::kanMX S. Henry [5] PGY145 MATa leu2, his3, trp1, ura3, cki1::HIS3, sec14::kanMX This work PGY143 MATa leu2, trp1, lys2, ura3, his3, sec14–1 ts , [YEp181] This work PGY137 MATa leu2, trp1, lys2, ura3, his3, sec14–1 ts , [YEp181-SEC14] This work PGY138 MATa leu2, trp1, lys2, ura3, his3, sec14–1 ts , [YEp181-SFH1] This work PGY140 MATa leu2, trp1, lys2, ura3, his3, sec14–1 ts , [YEp181-SFH2] This work PGY139 MATa leu2, trp1, lys2, ura3, his3, sec14–1 ts , [YEp181-SFH3] This work PGY141 MATa leu2, trp1, lys2, ura3, his3, sec14–1 ts , [YEp181-SFH4] This work PGY142 MATa leu2, trp1, lys2, ura3, his3, sec14–1 ts , [YEp181-SFH5] This work FY 1679–28c MATa ura3, leu2, his3, trp1 A. Goffeau [11] PGY151 MATa ura3, leu2, his3, trp1, sec14::SEC14-yEGFP This work PGY152 MATa ura3, leu2, his3, trp1, sfh1::SFH1-yEGFP This work PGY123 MATa ura3, leu2, his3, trp1, sfh2::SFH2-yEGFP This work PGY154 MATa ura3, leu2, his3, trp1, sfh3::SFH3-yEGFP This work PGY125 MATa ura3, leu2, his3, trp1, sfh4::SFH4-yEGFP This work PGY156 MATa ura3, leu2, his3, trp1, sfh5::SFH5-yEGFP This work PGY128 MATa ura3, leu2, his3, trp1, sfh3::hisG A. Goffeau [11] PGY129 MATa ura3, leu2, his3, trp1, sfh4:: HIS3 A. Goffeau [11] PGY130 MATa ura3, leu2, his3, trp1, sfh3::hisG sfh4::HIS3 A. Goffeau [11] PGY95 MATa ura3, leu2, his3, trp1, sfh1::kanMX4 This work PGY91 MATa ura3, leu2, his3, lys2, sfh5::kanMX4 EUROFAN collection, Frankfurt, Germany PGY90 MATa ura3, trp1, leu2, sfh5::kanMX4 EUROFAN collection, Frankfurt, Germany PGY102 MATa ura3, leu2, his3, trp1, sfh2::kanMX4 This work Table 3. Primers for construction of sfh1D and sfh2D. Sequences homologous to kanMX module are underlined. Location Name Primer 5¢ upstream of SFH1 SFH1/1D 5¢-ATGAAAAGAGGTCGGCATAG-3¢ SFH1/1R 5¢- AGCTAAACAGATCTGGCGCGCCTTAAGTATGCTGGTTGTCATTCTTCC-3¢ Downstream of SFH1 SFH1/2D 5¢- GTCGAAAACGAGCTCGAATTCATCGAGATACATCGGACCAGAAGGTG-3¢ SFH1/2R 5¢-CAGTCTGACCGAGTAGTTATTCC-3¢ Control primer 5¢ upstream of SFH1 SFH1/3D 5¢-CAAACCTGCTATTGGGACCC-3¢ Control primer inside SFH1 SFH1/3R 5¢-GTGTTGGCACCGTATTCTTCC-3¢ 5¢ upstream of SFH2 SFH2/1D 5¢-ACGAGGCGGTCTCTGTTCTCTG-3¢ SFH2/1R 5¢- AAGCTAAACAGATCTGGCGCGCCTTATGCTTTTATGCTTCTGTGTGCG-3¢ Downstream of SFH2: SFH2/2D 5¢- GTCGAAAACGAGCTCGAATTCATCGACCACGCGACGCTCCATACTG-3¢ SFH2/2R 5¢-GGTGGCGTTCGTTCGTTAGC-3¢ Control primer 5¢ upstream of SFH2 SFH2/3D 5¢-GCTACTTGTGCCGTTGACAGC-3¢ Control primer inside SFH2 SFH2/3R 5¢-TAGAGGTGTGCCGCTTCAGC-3¢ Control primer inside kanMX4 gene kanMX/R 5¢- CCAACAAATACAAGCCTACAC-3¢ Ó FEBS 2003 Yeast SEC14 homologues (Eur. J. Biochem. 270) 3135 Table 4. Primers used to generate and test C-terminal yEGFP fusions. All primers are in 5¢ to 3¢ orientation. Sequences homologous to pMK199 plasmid are underlined. P1(SEC14) TATCGGTCCATGGAGGGATCCAAAGTATATTGGACCGGAAGGTGAAGCTCCGGAAGCCTTTTCGATGAAAGGAGCAGGTGCTGGTGCTG P2(SEC14) CAGTTGTAAAATATCGTTACTTAGAACTCCTCTTTTCTCTCTCGAAAAAAAAATGTCTTTAAAAATAATA TCGATGAATTCGAGCTCGTTTAAAC KP1(SEC14) CGCCATTCGGTTTCTCTACC KP2(SEC14) AGGTTGGCCATGGAACTGG P1(SFH1) GAGAGACCCTAGATACATCGGACCAGAAGGTGAAATTCCCAACATTTTTGGTAAATTTACTGTTACCAGC GGAGCAGGTGCTGGTGCTG P2(SFH1) CAGAGATATACATATTATAGAGTATGCATGCTATATTCACGGAAAGCTACGACGAAGGCCTGTATCATAG TCGATGAATTCGAGCTCGTTTAAAC KP1(SFH1) CTTCTTGGATCCAGTAACCGTGTC KP2(SFH1) AGGTTGGCCATGGAACTGG F(SFH1-EGFP) GGCATGTGGGTGAATTACAA R(SFH1-EGFP) GACGAGGCAAGCTAAACAGAT P1(SFH2) AAACTACTCCAAGTTAGATCCGTACATCAGATCAAGATCCGTTTATGACTACAATGGTTCTCTAAAAGTT GGAGCAGGTGCTGGTGCTG P2(SFH2) AGGGACATATAAAGAAATAGATGTTTTTATAATAAAGGTCTATACAGTATGGAGCGTCGCGTGGCTTGGCTCGATGAATTCGAGCTCGTTTAAAC KP1(SFH2) TCCAACCCCAATACATCCCT KP2(SFH2) GGTCAATTTACCGTAAGT F(SFH2-EGFP) TCGGAATCCAGATGCATTTC R(SFH2-EGFP) GACGAGGCAAGCTAAACAGAT P1(SFH3) AAGTGAGGTTGATTTAAGAGGTACTCATGAAAAACTTCTTTACCCAGTAAAATCGGAAAGCAGTACCGTG GGAGCAGGTGCTGGTGCTG P2(SFH3) ATTAAACTTTTTATTCTCTTTTATTTATTATATATTATAGTGCATTATCATTATCTATCTAAATTTGCCTTCGATGAA TTCGAGCTCGTTTAAAC KP1(SFH3) CCCTTTTATTGACCCACTGACC KP2(SFH3) AGGTTGGCCATGGAACTGG P1(SFH4) TGTCGGATTAAGTGAATATGACACCAAGGGCCAACATGACGAATTAAAATATCCTGTTGATATGGTCATT GGAGCAGGTGCTGGTGCTG P2(SFH4) ACATCTGAGTCTAGATATATACGTTTGTGTAGCGGGAAACGTTAAAAAAAAAAATCTTAATTATAGTTTATCGATGAATTCGAGCTCGTTTAAAC KP1(SFH4) GCTCCACCCATCTCTATTGC KP2(SFH4) GGTCAATTTACCGTAAGT P1(SFH5) TGTCACAAATGTCCATCCAACAGAATACGGCCTTTACATTTTACAAAAACAAATCATCGAGGACGTTGAG GGAGCAGGTGCTGGTGCTG P2(SFH5) AATATAAGGCAAAAATAAGAAATTATTATAGGGTTTATATAAGAGACTATTATTAGATCATGCCAACAAA TCGATGAATTCGAGCTCGTTTAAAC KP1(SFH5) AATGTCCCCACCGTTTTCG KP2(SFH5) AGGTTGGCCATGGAACTGG 3136 M. Schnabl et al. (Eur. J. Biochem. 270) Ó FEBS 2003 nucleotides upstream of the STOP codon of the ORF of interestandonthe3¢ end, 65–70 nucleotides of the genomic region downstream of the ORF of interest. Transformants were recovered based on their geneticine (G418) resistance, and the correct integration was verified by PCR with a pair of primers, one inside the yEGFP sequence (primer KP2, Table 4) and the other one inside the ORF of interest (primer KP1). The described procedure generated integra- tive versions of C-terminal yEGFP fusions in frame with the ORF of interest. Thus, yEGFP fusions were present in single copy in the genome and driven by the native promoter of the ORF of interest. In order to construct episomal SFH1-yEGFP and SFH2- yEGFP fusions for functional studies, the respective DNA fragments were PCR amplified from chromosomal DNA and cloned into the high-copy number plasmid YEplac181 [19]. Using primers F(SFH1-EGFP) and R(SFH1-EGFP) (Table 4) a 2663 bp SFH1-EGFP PCR fragment was generated, cut with PstIandBglI and inserted into the respective sites of YEplac181. Similarly, the SFH2-yEGFP DNA fragment was generated by PCR from the chromo- somal DNA of a strain containing the integrative version of the SFH2-yEGFP using primers F(SFH2-EGFP) and R(SFH2-EGFP). This 2778 bp PCR fragment was cut with NsiIandBglII restriction enzymes and inserted into PstI and BamHI sites of YEplac181. Fluorescence microscopy Cultures of cells harboring GFP constructs were grown over night in liquid media and collected by brief centrifugation. Cell suspension (0.5 lL) was mounted on a cover slip under a sheet of 0.8% agarose, as described by Kohlwein [22]. Fluorescence was analyzed by confocal laser scanning microscopy using Leica TCS4d and SP2 AOBS 2p confocal microscopes. GFP fluorescence was monitored at 488 nm excitation by using a 525/50 band pass filter. Staining with Nile red and DAPI (4¢,6¢-diamidino-2-phenylindole) was performed by adding the dyes to the agarose sheet (1 lgÆmL )1 and 10 lgÆmL )1 , respectively). Nile red fluores- cence was excited at 488 nm and detected with a LP560 nm long pass filter; DAPI fluorescence was monitored using a Mai Tai pulsed IR laser tuned to 750 nm for 2 photon excitation, and detection at 450–480 nm. Isolation and characterization of yeast subcellular fractions Yeast mitochondria were isolated by published procedures [23]. Microsomal fractions were prepared from the post- mitochondrial supernatant that had been cleared of small mitochondria by centrifugation for 30 min at 20 000 g in an SS-34 rotor (Sorvall). The resulting supernatant was sub- jected to successive steps of differential centrifugation at 30 000, 40 000, and 100 000 g [24]. The 100 000 g super- natant contains the cytosolic proteins. Lipid particles were isolated as described by Leber et al.[25].Nucleiwere prepared as described by Hurt et al. [26]. Proteins were precipitated from the aqueous phase using trichloroacetic acid (10% final concentration). The protein pellet was solubilized in 0.1% SDS, 0.1% NaOH. Protein was quantified by the method of Lowry et al.[27],using bovine serum albumin as the standard. SDS/PAGE was carried out by the method of Laemmli [28]. Samples were dissociated at 37 °C. Western blot analysis was carried out after separating proteins using a 12.5% SDS/PAGE and transferring to nitrocellulose filters (Hybond-C, Amersham, Arlington Heights, IL, USA) [29,30]. GFP-tagged proteins were detected using mouse anti-GFP as the first antibody and goat anti-mouse Ig linked to peroxidase as the second antibody. Lipid analysis of whole cell extracts Cells were homogenized for 3 min under CO 2 cooling in the presence of glass beads using a Merckenschlager Homo- genizer (Braun, Melsungen, Germany). Lipids of whole yeast cells were extracted by the procedure of Folch et al. [31], and individual phospholipids were separated by two- dimensional thin-layer chromatography on silica gel 60 plates (Merck, Darmstadt, Germany) using chloroform/ methanol/25% NH 3 (65 : 35 : 5, v/v/v) as the first, and chloroform/acetone/methanol/acetic acid/water (50 : 20 : 10 : 10 : 5 v/v/v/v/v) as the second developing solvent. Phospholipids on plates were visualized by staining with iodine vapor, scraped off and quantified by the method of Broekhuyse [32]. Alkaline hydrolysis of lipid extracts was carried out as described elsewhere [33]. Individual sterols were analyzed by gas–liquid chromatography on a Hewlett Packard HP 5890 equipped with a flame ionization detector operated at 320 °C using a capillary column (HP5, 30 m · 0.32 mm · 0.25 lm film thickness). After a 1 min hold at 50 °Cthe temperature was increased to 310 °Cat10°CÆmin )1 .The final temperature was held for 10 min. Nitrogen was used as a carrier gas and 1 lL aliquots of samples were injected cool on column. Relative retention times of sterols were similar as described previously [34–36]. Analysis of water soluble lipid degradation products in the growth medium Strains expressing Sec14 homologues from multicopy plasmids in a sec14 ts background were pregrown for 48 h, transferred into 10 mL of fresh synthetic medium (2% glucose, 50 l M choline and 50 l M inositol) to D 600 ¼ 0.05 and incubated for 1 h at 24 °C. Then, 20 lCi of [methyl- 14 C]choline chloride and 10 lCi of myo-[2- 3 H]ino- sitol (NEN Life Science Products) were added, and the incubation was continued for 14 h at 24 °C to label PtdCho and PtdIns. Cells were collected by centrifugation, washed three times with 5 mL sterile cold water, and resuspended in 10 mL of fresh medium supplemented with unlabeled choline, inositol, GroPCho, and GroPIns, 100 l M each. Then, each cell culture was divided into two parts of 5 mL and cultivated for another 6 h at 24 °Cor37°C, respect- ively. Aliquots were removed at time zero and after 6 h cells were precipitated by centrifugation, and radioactivity of supernatants was determined by liquid scintillation count- ing. The secretion products inositol, inositol phosphate, and GroPIns were isolated by anion exchange chromatography (AG1-X2, 200–400 mesh, Bio-Rad) as described by Haw- kins et al. [37]. Radioactivity in GroPCho and choline was determined after separation on a cation exchange column Ó FEBS 2003 Yeast SEC14 homologues (Eur. J. Biochem. 270) 3137 Dowex 50 WX 8 (200–400 mesh, Serva) as described by Cook and Wakelam [38]. PtdCho turnover in a cki1 genetic background was analyzed as reported earlier [6,39]. Yeast strains were grown overnight at 37 °C in 2 mL Ins–/Cho– media containing 1 lCiÆmL )1 [methyl- 14 C]choline chloride. Cultures were harvested during mid logarithmic growth phase, washed twice with sterile distilled water and resuspended in 5 mL of fresh unlabeled Ins–/Cho– media. At time points indicated, 1.4 mL of the cultures were removed and cells were precipitated by centrifugation. The supernatant was saved as the medium fraction. The cell pellet was suspended in 0.5 mL of 5% trichloroacetic acid and incubated on ice for 20 min. After centrifugation, the supernatant was saved as the intracellular water-soluble fraction. The pellet was resuspended in 0.5 mL of 1 M Tris buffer, pH 8, centri- fuged, and the resulting supernatant was combined with the intracellular water-soluble fraction effectively neutralizing the acidic extract. The final pellet was saved as the total membrane fraction. To solubilize the cell pellet it was suspended in 100 lL of 1% Triton X-100, frozen at )70 °C and incubated in the presence of 10% deoxycholate overnight at 37 °C. Radioactivity of all fractions was determined by liquid scintillation counting. Results Complementation of the sec14 growth defect by overexpressed Sec14 homologues As shown previously [10], some Sec14 homologues when placed under the transcriptional control of the powerful and constitutive yeast phosphoglycerate kinase promoter are able to complement the sec14 ts growth defect. Results presented here (Table 5) extend these findings by showing the effect of individual Sec14 homologues expressed from their own promoters on a sec14 ts defect in two genetic backgrounds, namely in a strain bearing the sec14–1 ts allele (PGY84) and in a sec14–1 ts cki1 pld1 (PGY57) triple mutant. Our data confirmed the previous finding that SFH2 and SFH4 overexpression complemented the growth defect of the sec14–1 ts strain in a most efficient way. In our hands, however, also SFH1-overexpression suppressed the sec14–1 ts associated growth defect to a low but significant degree. In the sec14–1 ts cki1 pld1 background SFH2- overexpression and, less efficiently, SFH1-overexpression rescued the growth defect. Interestingly, SFH4-overexpres- sion did not suppress the growth defect of the sec14–1 ts cki1 pld1 strain under restrictive conditions, indicating that functional phospholipase D1 or a functional CDP-choline pathway are necessary to manifest the activity related to Sfh4p. We also performed complementation experiments using yeast strains with a sec14 deletion. As sec14 deletion mutants are not viable, bypass mutations causing dys- function of the CDP-choline pathway of PtdCho biosyn- thesis [3] had to be introduced. Thus, strains S3 (sec14D pct1D) and S7 (sec14D cki1D) (Table 2) were viable due to a combination of sec14D with mutations in phospho- choline:CTP cytidylyltransferase (pct1) or choline kinase (cki1), respectively. Diploids sec14D/sec14D CKI1/cki1D pct1D/PCT1, obtained by the genetic cross of S3 and S7 strains failed to grow, because these diploids are homo- zygous for the sec14D allele but heterozygous for both recessive suppressors cki1D and pct1D, unless an intact SEC14 gene or an efficiently complementing Sec14 homo- logue were introduced. As can be seen from Fig. 1, only overexpression of Sfh2p, Sfh4p and, to a lesser extent, Sfh1p yielded viable diploids. Phenotype analysis of yeast mutants deleted of SEC14 homologous genes None of the five SEC14 homologues is essential for growth under standard conditions [10]. Variation of growth tem- perature and carbon sources, however, resulted in changes of the growth behavior of sfh mutant strains (Table 6). Most significantly, sfh3D and sfh4D, and especially the sfh3D sfh4D double mutant (previously characterized as pdr16D pdr17D) exhibited reduced growth rates at low temperature. Thus, these mutants are not only drug sensitive as shown before [11], but also cold sensitive. Moreover, the sfh3D sfh4D double mutant failed to grow on ethanol at all temperatures. The sensitivity against ethanol might result from changes in the plasma membrane lipid composition [11]. Among the five strains deleted of Sec14 homologues, only sfh3D (pdr16D)andsfh4D (pdr17D)andthesfh3D sfh4D Table 5. Complementation of the se c1 4 ts growth defect by overexpres- sion of Sec14 homologues. The sec14–1 ts (PGY 84) and sec14–1 ts cki1 pld1 (PGY 57) strains were transformed with yeast multicopy plasmids containing individual Sec14 homologues under their own promoters. Rate of growth at 37 °C (nonpermissive temperature for sec14–1 ts )in YPD was used as a measure to determine the ability of the homologues to rescue the sec14–1 ts associated growth defect. sec14 ts sec14 ts cki1 pld1 SEC14 +++ +++ SFH1 ++ SFH2 +++ ++ SFH3 –– SFH4 ++ – SFH5 –– YEplac181 (control) – – Degree of complementation: + + +, very good; + +, good; +, weak; –, no complementation. Fig. 1. Complementation of the sec14D growth defect by Sec14 homo- logues. Strain S3 (sec14D pct1D) transformed with individual Sec14 homologues was crossed with the S7 (sec14D cki1D) strain and replica plated to selective medium. Diploids grew only when the respective Sec14 homologue complemented the growth defect caused by the sec14 deletion. 3138 M. Schnabl et al. (Eur. J. Biochem. 270) Ó FEBS 2003 double mutant turned out to be sensitive against various drugs such as miconazole, terbinafine, edelfosine, and 4-nitroquinoline-N-oxide (data not shown) confirming pre- vious results from our laboratory [11]. Similarly, only deletions of SFH3 and SFH4 caused significant changes of the lipid composition of plasma membrane and total cell extracts as reported earlier [11]. Subcellular localization of the Sec14p homologues To determine the subcellular localization of Sec14p homo- logues we constructed C-terminal chromosomal fusions of individual Sec14 homologues with yEGFP, expressed under control of their native promoters. To confirm functionality of the hybrids, we performed complementation tests as follows: SFH3-yEGFP and SFH4-yEGFP fusions rescued the miconazole sensitivity [11] of sfh3D (pdr16D)andsfh4D (pdr17D) strains (Fig. 2A); overexpression of SFH1-yEGFP and SFH2-yEGFP complemented the sec14D growth defect similarly to overexpression of SFH1 and SFH2 (Fig. 2B). As SFH5 is not complementing the sec14 defect in an efficient way no such tests could be performed for this Sec14 homologue to proof functionality of the GFP fusion. Laser scanning fluorescence microscopy of strains bear- ing yEGFP fusions showed presence of SEC14-yEGFP mainly in the cytosol (Fig. 3). Similarly, SFH2-yEGFP, SFH4-yEGFP and SFH5-yEGFP localized mainly to the cytosol, but SFH4-yEGFP and SFH5-yEGFP were also visualized at the cell periphery close to or at the plasma membrane. Localization of SFH2-yEGFP in punctuate structures identified earlier as endosomes [10] were also observed in our investigation, although less pronounced. SFH3-yEGFP was localized to lipid particles and at the cell periphery (plasma membrane) and SFH1-yEGFP was found mainly in the nucleus. Localization of the latter fusion proteins to lipid particles and nuclei was confirmed by double staining with Nile red (for lipid particles) (Fig. 4A–C) or DAPI (nucleus) (Fig. 4D–F), respectively. In addition to fluorescence microscopy, Sfh-yEGFP hybrids were localized by subcellular fractionation using standard techniques of organelle isolation [24] and West- ern blot analysis (Fig. 5). EGFP hybrids of SEC14, SFH2 and SFH5, which were localized mainly to the cytosol by fluorescence microscopic inspection, were also detected in the cytosol by Western blot analysis. Significant amounts of these polypeptides were also found in microsomal fractions, which correlates with the fluorescence signal in punctuate intracellular and peripheral structures, the latter probably representing peripheral endoplasmic reticulum or plasma membrane [40]. SFH1-yEGFP was localized to microsomes, cytosol and also to the nucleus although at minor concentration. This discrepancy between microscopy and cell fractionation data will be discussed below (see Discussion). SFH3-yEGFP was localized mainly to micro- somal fractions and also to lipid particles. Thus, Sfh3p may be dually located similar to many other lipid particles proteins [41]. Regulation of phospholipase D1 and phospholipase B1 mediated PtdCho turnover by Sec14p and its homologues Previous reports have shown that in S. cerevisiae PtdCho can be hydrolyzed by phospholipase D1 (Pld1p) to produce phosphatidic acid and choline [5,6], and by phospholipase B1 (Plb1p) [14,42] to produce GroPCho and fatty acids. Sec14p has been previously shown to downregulate Pld1p activity in yeast cells [5,6,10], whereas homologues of Sec14p were reported to collectively activate Pld1p [10]. In our previous work increased GroPCho release was observed in a sec14 ts mutant at the nonpermissive temperature [15]. To study the role of individual Sec14 homologues in phospholipid turnover, strains overproducing Sec14p and the five homologues were analyzed in the sec14 ts background. To assess the role of Sec14 homologues in the regulation of Pld1p-mediated PtdCho turnover a mutant lacking choline kinase (cki1), the first enzyme of the CDP-choline pathway, was employed. Introduction of the cki1 mutation has two major advantages: (a) sec14 ts cki1 strains are viable at the otherwise sec14 ts nonpermissive temperature of 37 °C [3]; and (b) cki1 prevents reincorporation of the majority of released free choline into PtdCho via the CDP-choline pathway [6]. On the other hand, strains bearing the cki1 mutation have a strongly reduced capacity to incorporate [ 14 C]choline into PtdCho during the labeling period [6]. Ethanolamine kinase, however, can phosphorylate choline to some extent [43] and is thus responsible for choline Table 6. Growth characteristics of mutants deleted of SFH genes. Strains were grown on solid media with different carbon sources at different temperatures as indicated in the Materials and methods section. Strain Temperature (°C) YPD YP lactate YP ethanol 15 30 37 15 30 37 15 30 37 FY 1679–28c ++++++±++ sfh1D ++++++±++ sfh2D ± ++±++ – ++ sfh3D – ++±++ – ++ sfh4D – ++±++ – ++ sfh3Dsfh4D – ++– ±+ – – – sfh5D ++++++±++ +, good; ±, weak; –, no growth. Ó FEBS 2003 Yeast SEC14 homologues (Eur. J. Biochem. 270) 3139 phosphorylation and incorporation of [ 14 C]choline into PtdCho of these strains. After overnight labeling with [ 14 C]choline at 37 °Ccells were shifted to unlabeled medium and grown for additional 6 h at 37 °C. Radioactivity in the membrane associated pool, i.e. PtdCho, the intracellular water-soluble pool and the medium was estimated at indicated time points (Fig. 6). In wild-type cells (Fig. 6A), only a small amount of the label appeared in the medium after a 6-h chase. SEC14 cki1 cells (Fig. 6B) showed a steady loss of label from PtdCho with corresponding appearance of labeled free choline in the medium [6]. In sec14 ts cki1 cells (Fig. 6C), the label from PtdCho was rapidly lost and appeared as free choline in the medium as a result of Pld1p activation upon inactivation of Sec14p [5]. In a similar experiment, Sec14 homologues were tested for their ability to regulate phospholipase D1 mediated PtdCho degradation. For this purpose, strains overexpress- ing Sec14 homologues in a sec14 ts cki1 genetic background were used. The strain sec14 ts cki1 bearing the empty cloning vector YEplac181 showed the same PtdCho turnover pattern as sec14 ts cki1 cells, and sec14 ts cki1 cells with the control construct YEplac181-SEC14 exhibited the same PtdCho turnover as SEC14 cki1 (data not shown). Among the transformants overexpressing the Sec14 homologues cells containing Sfh2p and Sfh4p exhibited a significan- tly higher turnover of PtdCho than sec14 ts cki1 cells (Fig. 6D,E) as judged from the fast disappearance of the label in the membrane fraction and the appearance of free intra- and extracellular choline. Is this massive choline release into the media result of enhanced Pld1p activity? To answer this question, PtdCho turnover in a sec14 ts cki1 pld1D strain overexpressing Sfh2p (Fig. 6F) was studied. In this strain, a slow steady loss of the label from the membrane fraction, representing PtdCho, was observed with corresponding appearance of label in the medium. Most of this label was in the form of GroPCho based on chromatography of the medium on Dowex 50 WX 8 (data not shown). The slow turnover of PtdCho in the pld1D strain compared to the high level of PtdCho turnover in the strain with intact PLD1 gene and analysis of the turnover products indicate that high PtdCho turnover observed in SFH2 and SFH4 overexpressing cells is linked to Pld1p activity. Determination of choline release in a strain overexpress- ing Sfh-proteins in a sec14 ts CKI1 background (data not shown) confirmed the view that Sfh2p and Sfh4p contribute to the increased Pld1p mediated turnover of PtdCho. Experiments using [ 3 H]inositol as a precursor of PtdIns revealed that Sec14 homologues did not affect the turnover of this phospholipid. Similar to the release of choline, the excretion of GroPCho was significantly affected by Sec14p and some of its homologues overexpressed in the sec14 ts strain at the restrictive temperature (Fig. 7). In the sec14 ts strain the excretion of GroPCho at the nonpermissive temperature was dramatically increased as compared to a strain trans- formed with SEC14 representing wild type. Whereas overexpression of Sfh1p, Sfh3p and Sfh5p did not signifi- cantly alter the sec14 ts stimulated secretion of GroPCho, overproduction of Sfh2p and Sfh4p significantly decreased the release of GroPCho into the medium. As phospholipase B1 (Plb1p) is mainly responsible for the cleavage of PtdCho and the formation of GroPCho [42], the amount of GroPCho released into the medium represents the rate of Plb1p mediated turnover of PtdCho. Thus, Sfh2p, Sfh4p and Sec14p appear to be inhibitors of PtdCho degradation by Plb1p in vivo. Interestingly, the effect of overexpressed Sfh2p and Sfh4p was not observed in a SEC14 strain, nor did strains deleted of SFH2 and SFH4, respectively, in the SEC14 background exhibit increased Plb1p activity (data not shown). Thus, it appears that Sec14p is a Ômaster regulatorÕ of the yeast Plb1p pathway of PtdCho degradation. Fig. 2. Sfh-yEGFPs functionally replace original Sfh-proteins. (A) Drug sensitivity of sfh3D/pdr16D and sfh4D/pdr17D is cured by Sfh3p- yEGFP and Sfh4p-yEGFP, respectively. Growth of yeast strains with SFH3-yEGFP or SFH4-yEGFP integrated in their genomes instead of the wild-type SFH3 or SFH4 genes were tested on YPD plates con- taining 10 ngÆmL )1 miconazole. Early stationary phase cultures (3 lL) and 1 : 10 dilutions of these cultures were spotted onto the miconazole containing plate. (B) Functionality test of the Sfh1p-yEGFP and Sfh2p-yEGFP constructs. S3 strain (sec14D pct1D) transformed with SEC14, SFH1, SFH2 or empty vector (upper lane), and SFH1-yEGFP or SFH2-yEGFP (lower lane) on the multicopy plasmid YEplac181 was crossed with the strain S7 (sec14D cki1D) and replica plated onto selective medium. Diploids grew only when Sfh-proteins complemen- ted the growth defect caused by the sec14 deletion. 3140 M. Schnabl et al. (Eur. J. Biochem. 270) Ó FEBS 2003 Discussion The goal of this study was to gain insight into the physiological functions of the family of Sfh proteins that are homologous to the major yeast PITP Sec14p. For this purpose, we used (a) mutants deleted of the respective SFH genes; (b) strains overexpressing Sfh proteins to study their relationship to Sec14p and their effects on phospholipid metabolism; and (c) SFH-yEGFP hybrids to investigate their subcellular distribution. As reported earlier [10], Sfh2p and Sfh4p are the Sec14 homologues that complement the sec14 growth defect best. Sfh3p and Sfh5p under the transcriptional control of their own promoters failed to do so. We also confirmed an important observation that the comple- mentation of the sec14 growth defect by Sfh4p depend on functional phospholipase D1 and/or a functional CDP-choline pathway. Contrary to results obtained by Li et al. [10], we show that the polypeptide with the highest sequence homology to Sec14p, Sfh1p, also complemented the sec14 related growth defect to some degree (Table 5 and Fig. 1). Colocalization of Sec14p and its homologues could explain the complementing effects of Sfh-proteins. Interest- ingly, proteins which complement the sec14 related growth defect best are not those with the highest homology to Sec14p, but those which localize mainly to the cytosol and microsomes, similar to Sec14p (see Fig. 3), namely Sfh2p and Sfh4p. Occurrence of Sfh2p in endosomes (contained in microsomal fractions) as a modulator of Pld1p was described before by Li et al.[10].TheroleofSfh2p(Csr1p) as a multicopy suppressor to rescue the chs5 spa2 defect in cell wall synthesis is supported by its localization, because Chs5p is a cytosolic component and Spa2p a protein associated with the cytoskeleton [13]. The localization of Sfh4p (also named Pdr17p, PSTB2 or PstB2p) is in line with its role as a regulator of Psd2p, probably as a transporter of PtdSer from the site of synthesis, the endoplasmic reticulum, to a Golgi/vacuolar compartment where Psd2p is localized [12]. Sfh5p is localized to cytosol and microsomes but its ability under its own promoter to complement the sec14 defect is negligible. Li et al. [10] studied the complementa- tion effect of Sec14 homologues placed under the control of the strong constitutive phosphoglycerate kinase promoter. Fig. 3. Subcellular localization of SFH-yEGFP-fusion proteins by laser scanning fluorescence microscopy. Fluorescence microscopy was carried out on a confocal microscope as described in the Materials and methods section. Logarithmic phase cultures of cells expressing C-terminal chromo- somal yEGFP fusions were collected by centrifugation and analyzed as described previously [22]. Left panels: GFP fluorescence; right panels: Nomarski (DIC) optics. (A) SEC14-yEGFP; (B) SFH1-yEGFP; (C) SFH2-yEGFP; (D) SFH3-yEGFP; (E) SFH4-yEGFP; (F) SFH5-yEGFP. Scale bar ¼ 5 lm. Ó FEBS 2003 Yeast SEC14 homologues (Eur. J. Biochem. 270) 3141 Under these circumstances also Sfh5p was able to comple- ment sec14 related growth defect. This result indicates that in case of Sfh5p the weak expression from its own promoter, rather than from Sec14p different localization, is the reason for the failure of complementation tests. Although Sfh3p (Pdr16p) is highly homologous to Sfh4p (Pdr17p) (49% identity and 75% similarity), the localization of the two polypeptides is different insofar as Sfh3p is present in significant amounts in lipid particles. Sfh3p (Pdr16p) was shown to affect sterol metabolism [11], and as lipid particles and the endoplasmic reticulum are the major locations of sterol-synthesizing enzymes [44], this Sec14 homologue may act as a modulator of sterol biosynthesis. A further interesting link of SFH2 (CSR1) to sterol metabolism was recently uncovered [45] showing that forced expression of the SUT1 gene, which is involved in sterol utilization, suppressed sec14–1 ts by upregulating SFH2. An interesting exception among the Sec14 homologues appears to be Sfh1p, which was associated mainly with the nucleus by microscopic inspection, and with microsomes, cytosol and also partially with the nucleus by cell fraction- ation. Some probability for nuclear localization is also predicted using the PSORT (Prediction of Protein Sorting Signals) and Localization Prediction programs from Yale University (http://bioinfo.mbb.yale.edu/genome/localize) [46] supporting the observed GFP-fusion localization pat- tern. The hydropathy profile of this protein rather predicts a soluble protein [47]. These features may explain the apparent discrepancy between our localization data obtained by microscopy and cell fractionation. Sfh1p is by far the least abundant polypeptide of this family and, as a soluble protein, may be washed out from the nucleus during subcellular fractionation. The localization of Sfh1p resem- bles the localization of PITP isoform a in higher eukaryotes: upon microinjection into fetal bovine heart endothelial cells, PITP-a was predominantly present in the nucleus and in the cytoplasm [48]. Fig. 4. Laser scanning fluorescence microscopy of strains expressing SFH1-yEGFP and SFH3-yEGFP. Nuclear and mitochondrial DNA were stained using DAPI, and lipid particles using Nile red, as described previously [22]. (A–C) Strain expressing an Sfh1p-yEGFP fusion. (D–F) Strain expressing an Sfh3p-yEGFP fusion. (A,D) yEGFP-fluorescence; (B) DAPI staining; (E) Nile red staining; (C,F) Nomarski (DIC) optics. Scale bar ¼ 10 lm. Fig. 5. Localization of Sec14 homologues by cell fractionation and Western blot analysis. Western blot analysis was carried out after separating proteins using a 12.5% SDS/PAGE and transferring to nitrocellulose filters. yEGFP tagged proteins were detected using mouse anti-GFP as the first antibody and goat anti-mouse Ig linked to peroxidase as the second antibody. 1, homogenate; 2, mitochondria; 3, microsomes 30 000 g;4,microsomes40000g;5,microsomes 100 000 g;6,cytosol;N,nucleus;LP,lipidparticles. 3142 M. Schnabl et al. (Eur. J. Biochem. 270) Ó FEBS 2003 [...]... formation, indicating that Sec14p and the two homologues act as inhibitors of Plb1p in vivo This observation explains at least in part the low Plb1p activity in wild-type cells Interestingly, the inhibitory effect of Sfh2p and Sfh4p overproduction became only evident in the absence of Sec14p Thus, Sec14p appears to overrule its two homologues as inhibitor of Plb1p Previous studies [2–4,8–10,12] and this investigation... SEC14 defective yeast cells thus supporting the finding that activity of Pld1p in vitro is enhanced in sec14ts strains cultivated at the restrictive temperature [5] Conclusively, Sec14p and its homologues are involved in the complex regulatory network of PtdCho turnover by decreasing or increasing, respectively, the rate Yeast SEC14 homologues (Eur J Biochem 270) 3143 Fig 7 Release of GroPCho into the growth... Fig 6 Phosphatidylcholine turnover in strains overexpressing Sfhproteins Yeast cultures were grown overnight at 37 °C in Ins–/Cho– medium containing 1 lCiÆmL)1 [methyl-14C]choline chloride to mid-logarithmic stage of growth At time point zero cells were washed and resuspended in fresh unlabeled Ins–/Cho– medium Data represent percent of total radioactivity in the medium (d), in the intracellular water-soluble... previously that Sec14p [4–6] and Sec14 homologues collectively [10] contribute to the regulation of Pld1p In this study, we show in more detail that Sfh2p and Sfh4p activate Pld1p in vivo In the sec14ts strain overexpression of Sfh2p and Sfh4p increased the Pld1p mediated PtdCho hydrolysis as judged from the higher level of choline released into the medium (see Fig 6) Direct physical interaction of Sfh2p... temperature) Mean values of two independent experiments are shown of degradation of this phospholipid in vivo Moreover, Sec14p appears to be involved in the regulation of phospholipase D2 (Pld2p) as shown recently by Tang et al [49] In addition to regulatory effects of Sec14p and two of its homologues on Pld1p we observed regulatory effects of these proteins on phospholipase B1, Plb1p The product of Plb1p-catalyzed... characteristic for Sec14p: ability to bind/transfer PtdIns, ability to bind/ transfer PtdCho, regulatory effect on PtdCho turnover through modulation of Pld1p activity, regulatory effect on PtdCho turnover by inhibition of Plb1p, and subcellular localization to the cytosol and microsomes (Golgi) When we compare the five Sec14 homologues to Sec14p by these criteria, and include the ability of Sfh proteins to complement... fraction (j), and in the membrane associated fraction (m) Total radioactivity incorporated into strains deleted of the CKI1 gene was 10–15% compared to the incorporation in the wild-type strain (A) wild type; (B) SEC14 cki; (C) sec14ts cki1; (D) sec14tscki1 – YEplac195-SFH2; (E) sec14ts cki1 – YEplac195-SFH4; (F) sec14ts cki1 pld1-YEplac195-SFH2 Data on panels D, E and F are the average of three independent... [10] The mode of interaction of Sfh2p and Sfh4p with Pld1p remains to be demonstrated As shown previously, phospholipase D1 activity was required for suppression of the yeast sec14 defect, and deletion of the PLD1 gene in a sec14ts cki1 strain yielded a strain which was not viable at the restrictive temperature of 37 °C [4,5] Thus, it was not possible to study the dependence of PtdCho turnover on phospholipase... activity in vivo in the sec14ts cki1 background As Sfh2p was able to complement the growth defect in the sec14ts cki1 pld1D mutant and rendered a sec14ts cki1 pld1D SFH2+ strain viable at 37 °C (Table 5), experiments addressing the role of Pld1p as mentioned above could be performed Our results shown in Fig 6D,F clearly indicate that Pld1p activity is responsible for increased PtdCho turnover in SEC14. .. Bruno, V., Dowd, S., Swede, M.J & Henry, S.A (1997) Role of the yeast phospha- 16 17 18 19 20 21 22 tidylinositol/phosphatidylcholine transfer protein (Sec14p) in phosphatidylcholine turnover and INO1 regulation J Biol Chem 272, 20873–20883 Kent, C & Carman, G.M (1999) Interactions among pathways for phosphatidylcholine metabolism, CTP synthesis and secretion through the Golgi apparatus Trends Biochem . Subcellular localization of yeast Sec14 homologues and their involvement in regulation of phospholipid turnover Martina Schnabl 1 , Olga. turnover observed in SFH2 and SFH4 overexpressing cells is linked to Pld1p activity. Determination of choline release in a strain overexpress- ing Sfh-proteins in a sec14 ts CKI1