Tài liệu Báo cáo khoa học: Transduced human PEP-1–heat shock protein 27 efficiently protects against brain ischemic insult pptx

Transduced human PEP-1–heat shock protein 27 efficiently protects against brain ischemic insult Jae J An1,*, Yeom P Lee1,*, So Y Kim1, Sun H Lee1, Min J Lee1, Min S Jeong1, Dae W Kim1, Sang H Jang1, Ki-Yeon Yoo2, Moo H Won2, Tae-Cheon Kang2, Oh-Shin Kwon3, Sung-Woo Cho4, Kil S Lee1, Jinseu Park1, Won S Eum1 and Soo Y Choi1 Department Department Department Department of of of of Biomedical Science and Research Institute for Bioscience and Biotechnology, Hallym University, Chunchon, Korea Anatomy and Neurobiology, College of Medicine, Hallym University, Chunchon, Korea Biochemistry, Kyungpook National University, Taegu, Korea Biochemistry and Molecular Biology, University of Ulsan College of Medicine, Seoul, Korea Keywords heat shock protein 27; ischemia; protein therapy; protein transduction; ROS Correspondence S Y Choi, Department of Biomedical Science and Research Institute for Bioscience and Biotechnology, Hallym University, Chunchon 200-702, Korea Fax: +82 33 241 1463 Tel: +82 33 248 2112 E-mail: sychoi@hallym.ac.kr W S Eum, Department of Biomedical Science and Research Institute for Bioscience and Biotechnology, Hallym University, Chunchon 200-702, Korea Fax: +82 33 241 1463 Tel: +82 33 248 2112 E-mail: wseum@hallym.ac.kr Reactive oxygen species contribute to the development of various human diseases Ischemia is characterized by both significant oxidative stress and characteristic changes in the antioxidant defense mechanism Heat shock protein 27 (HSP27) has a potent ability to increase cell survival in response to oxidative stress In the present study, we have investigated the protective effects of PEP-1–HSP27 against cell death and ischemic insults When PEP-1–HSP27 fusion protein was added to the culture medium of astrocyte and primary neuronal cells, it rapidly entered the cells and protected them against cell death induced by oxidative stress Immunohistochemical analysis revealed that, when PEP-1–HSP27 fusion protein was intraperitoneally injected into gerbils, it prevented neuronal cell death in the CA1 region of the hippocampus in response to transient forebrain ischemia Our results demonstrate that transduced PEP-1–HSP27 protects against cell death in vitro and in vivo, and suggest that transduction of PEP-1–HSP27 fusion protein provides a potential strategy for therapeutic delivery in various human diseases in which reactive oxygen species are implicated, including stroke *These authors contributed equally to this work (Received 30 October 2007, revised 10 January 2008, accepted 15 January 2008) doi:10.1111/j.1742-4658.2008.06291.x Reactive oxygen species (ROS) are formed as by-products of normal cellular processes involving interactions with oxygen Constant exposure to the harmful actions of ROS damages macromolecules Ultimately, these ROS contribute significantly to the pathological processes of various human diseases, including ischemia, carcinogenesis, radiation injury and inflammation ⁄ immune injury [1,2] Oxidative stresses are known to cause the brain lesions that characterize neurodegenerative diseases, with neuroinflammatory processes increasing free radical production [3] Ischemic injury to neurons is primarily due to the interruption of blood flow, lack of oxygenation, and subsequent reoxygenation after brain ischemia ⁄ reperfusion [4,5] However, the exact mechanisms of neuronal damage in ischemia remain to be Abbreviations GFP, green fluorescent protein; HSP27, heat shock protein 27; MDA, malondialdehyde; ROS, reactive oxygen species 1296 FEBS Journal 275 (2008) 1296–1308 ª 2008 The Authors Journal compilation ª 2008 FEBS J J An et al elucidated One hypothesis is that cellular events involving oxidative damage mediated by ROS may induce neurodegeneration [6] Previous studies have also provided evidence for the occurrence of oxidative stress in cerebral ischemia [7,8] Heat shock proteins (HSPs) are major stress proteins that are induced in response to a variety of stresses, including oxidative stress [9] HSPs consist of a family of highly conserved proteins, grouped according to their molecular size: high-molecular-mass proteins and small HSPs Various studies have shown that HSPs act as modulators of disease pathology in many neurological conditions [10–13] However, HSPs show differences in their tissue and cellular specificity and their response to different insults [14–16] Many researchers have demonstrated the successful delivery of full-length Tat fusion proteins by protein transduction technology Several small regions of proteins, called protein transduction domains, have been developed to allow the delivery of exogenous protein into living cells These include carrier peptides derived from the HIV-1 Tat protein, Drosophila Antennapedia (Antp) protein and herpes simplex virus VP22 protein [17] To increase the biological activity of transduced proteins in cells, a novel carrier is required to transduce the target protein in its active native structural form Morris et al [18] have designed a PEP-1 peptide carrier, which consists of three domains: a hydrophobic tryptophan-rich motif, a spacer, and a hydrophilic lysine-rich domain When they mixed PEP-1 peptide and a target protein (GFP or b-galactosidase) and then overlaid them on cultured cells, they found that nondenatured target protein was transduced In a previous study, we have shown that a Tat– Cu,Zn-superoxide dismutase (SOD) fusion can be transduced into HeLa cells, and protects the cells from oxidative stress-induced destruction [19] PEP-1–SOD was efficiently transduced into neuronal cells across the blood–brain barrier and protected against ischemic insults [20] Recently, we reported the protective effects of transduced PEP-1–SOD in neuronal cell death and paraquat-induced Parkinson’s disease in mice models [21] In addition, we demonstrated that the PEP-1– ribosomal protein S3 (rpS3) fusion protein efficiently transduces into skin cells ⁄ tissues and protects against UV-induced skin cell death [22] In the present study, we designed a PEP-1–HSP27 fusion protein expression vector (Fig 1) for direct transduction in vitro and in vivo in its native active form The results show that the PEP-1–HSP27 fusion protein can be directly transduced into neuronal cells and across the blood–brain barrier and can efficiently protect against cell death Therefore, we suggest that Protective effects of PEP-1–HSP27 against brain ischemia A BamH I Xho I T7 term HSP27 PEP-1 His-Tag Lac O T7 Prom MCS Apr PEP-1–HSP27 IacI ori PEP-1–HSP27 His-Tag PEP-1 Control HSP27 B His-Tag HSP27 HSP27 Fig The expression vector for the PEP-1–HSP27 fusion protein (A) Construction of the PEP-1–HSP27 expression vector system based on the vector pET-15b A synthetic PEP-1 oligomer was cloned with into the NdeI and XhoI sites, and human HSP27 cDNA was cloned into the XhoI and BamHI sites of pET-15b (B) Diagram of the expressed control HSP27 and PEP-1–HSP27 fusion proteins Each contains a His tag consisting of six histidine residues Expression was induced by adding isopropyl thio-b-D-galactoside (IPTG) the PEP-1–HSP27 fusion protein could be useful as a potential therapeutic agent for transient forebrain ischemia Results Expression and purification of PEP-1–HSP27 fusion protein Following induction of expression, PEP-1–HSP27 fusion proteins were purified using an Ni2+-nitrilotriacetic acid Sepharose affinity column and PD-10 column chromatography SDS–PAGE and western blot analysis of the purified PEP-1–HSP27 fusion proteins were performed As shown in Fig 2A, PEP-1–HSP27 fusion proteins were highly expressed, and the purified recombinant PEP-1–HSP27 fusion protein had an estimated molecular mass of approximately 30 kDa The PEP-1– HSP27 fusion protein was confirmed by western blot FEBS Journal 275 (2008) 1296–1308 ª 2008 The Authors Journal compilation ª 2008 FEBS 1297 Protective effects of PEP-1–HSP27 against brain ischemia J J An et al B b d B a b c A A a c (kDa) d 150 75 50 37 25 3 Fig Expression and purification of the PEP-1–HSP27 fusion protein Protein extracts of cells and purified fusion proteins were analyzed by 12% SDS–PAGE (A) and subjected to western blot analysis with antibody against rabbit polyhistidine (B) Lane 1, non-induced PEP-1–HSP27; lane 2, induced PEP-1–HSP27; lane 3, purified PEP-1–HSP27 analysis using antibody against rabbit polyhistidine (Fig 2B) Transduction of PEP-1–HSP27 fusion protein into astrocyte and neuronal cells The intracellular delivery of PEP-1–HSP27 fusion proteins into astrocytes was confirmed by direct fluorescence analysis As shown in Fig 3A, almost all cultured cells were found to be transduced with PEP-1– HSP27 fusion proteins However, fluorescence signals were not detected in the negative control cells or in cells treated with control HSP27 To exclude the possibility that cell fixation with paraformaldehyde may have affected detection of PEP-1–HSP27 fusion protein transduction by direct fluorescence, we used FITC-conjugated PEP-1–HSP27 fusion proteins for transduction into non-fixed or fixed astrocytes The intracellular distribution of the PEP-1–HSP27 fluorescence signal for non-fixed cells was similar to that for fixed cells Under the same experimental conditions, we also confirmed the intracellular distribution of the PEP-1– HSP27 fluorescence signal in primary neuronal cells (Fig 3B) These results indicate that cell fixation with paraformaldehyde is not required for PEP-1–HSP27 fusion protein transduction To evaluate the transduction ability of PEP-1– HSP27 fusion proteins, we added them to astrocyte cell-culture medium at lm for various periods of time (10–60 min), and then analyzed the transduced protein levels by western blotting Transduced PEP-1– HSP27 fusion proteins were detected in cells within 1298 Fig Transduction of PEP-1–HSP27 fusion proteins into astrocytes (A) and primary neuronal cells (B) After transduction of FITClabeled PEP-1–HSP27 fusion proteins (3 lM) astrocytes, the cells were washed twice with trypsin ⁄ EDTA and NaCl ⁄ Pi and immediately observed by fluorescence microscopy (a) Negative control cells, (b) positive control cells treated with HSP27, (c) non-fixed cells treated with PEP-1–HSP27, and (d) fixed cells treated with PEP-1–HSP27 10 min, and the intracellular concentration gradually increased up to 60 The dose-dependency of the transduction of PEP-1–HSP27 fusion proteins was then analyzed Various concentrations (0.5–3 lm) of PEP-1–HSP27 fusion proteins were added to astrocytes in culture for 60 min, and the levels of transduced proteins were determined by western blotting The results indicate that the fusion proteins are transduced into astrocytes in a concentration-dependent manner Figure 4A shows that PEP-1–HSP27 fusion protein was efficiently transduced into astrocytes in a timeand dose-dependent manner However, control HSP27 was not transduced into the cells (data not shown) We also assessed the transduction of PEP-1–HSP27 fusion protein into primary neuronal cells As shown FEBS Journal 275 (2008) 1296–1308 ª 2008 The Authors Journal compilation ª 2008 FEBS J J An et al Protective effects of PEP-1–HSP27 against brain ischemia 120 C 20 10 C 0.5 30 45 60 (min) (µM) B Cell viability (% of control) A 100 C 10 20 0.5 30 45 C C 12 * 60 40 20 C H2O2 0.5 (µM) 60 (min) (µM) + + 80 C + 24 (h) Fig Transduction of PEP-1–HSP27 fusion proteins into astrocytes (A) and primary neuronal cells (B) PEP-1–HSP27 (3 lM) was added to the culture medium for 10–60 or 0.5–3 lM PEP-1– HSP27 was added to the culture medium for h (C) Cells pretreated with lM PEP-1–HSP27 were incubated for 1–24 h Analysis was performed by western blotting in Fig 4B, PEP-1–HSP27 fusion protein transduction into primary neuronal cells was similar to that for astrocytes These results demonstrate that PEP-1–HSP27 fusion protein can not only be transduced into cultured astrocytes but can also penetrate primary neuronal cells The intracellular stability of transduced PEP-1– HSP27 fusion protein in astrocytes is shown in Fig 4C The PEP-1–HSP27 fusion protein was added to the culture medium at a concentration lm for various time periods, and the resulting levels of transduced protein were analyzed by western blotting Transduced PEP-1–HSP27 was initially detected in cells after 10 The level declined gradually over the period of observation However, significant levels of transduced HSP27 fusion protein persisted in the cells for 12 h The same patterns were obtained when we used primary neuronal cells (data not shown) Effect of transduced PEP-1–HSP27 fusion proteins on the viability of cells under oxidative stress To determine whether the transduced fusion protein has a functional role in cells under oxidative stress, we Fig Effect of transduced PEP-1–HSP27 on cell viability Hydrogen peroxide (1.2 mM) was added to astrocytes pretreated with 0.5–3 lM PEP-1–HSP27 for h Cell viabilities were estimated using an MTT colorimetric assay Each bar represents the mean ± SEM obtained from five experiments Asterisks and crosses denote statistical significance at P < 0.05 and P < 0.01, respectively examined the viability of cells containing transduced fusion proteins after administration of hydrogen peroxide When cells were exposed to 1.2 mm hydrogen peroxide, only 35% of the cells were viable The viability of cells pre-treated with PEP-1–HSP27 fusion proteins and then exposed to hydrogen peroxide was markedly increased up to 95% (Fig 5) Next, we examined the effect of PEP-1–HSP27 transduction on DNA fragmentation induced by hydrogen peroxide Biological macromolecules are known to be major targets of oxidative stress As shown in Fig 6, DNA fragmentation was considerably induced by hydrogen peroxide in astrocytes; however, the levels of DNA fragmentation were significantly decreased by transduction of the PEP-1–HSP27 fusion protein We also measured cell viability and DNA fragmentation using hydrogen peroxide in primary neuronal cells Transduced PEP-1–HSP27 efficiently protects the neuronal cell viability (data not shown), as seen for astrocytes These results indicate that transduced PEP-1–HSP27 fusion protein plays a defensive role against cell death induced by oxidative stress in the cells Transduced PEP-1–HSP27 protects against ischemic damage To determine whether transduced PEP-1–HSP27 performs biological roles in vivo, we tested the effects of transduced PEP-1–HSP27 fusion protein on neuronal cell viabilities after transient forebrain ischemia in a gerbil model We injected PEP-1–HSP27 fusion protein FEBS Journal 275 (2008) 1296–1308 ª 2008 The Authors Journal compilation ª 2008 FEBS 1299 Protective effects of PEP-1–HSP27 against brain ischemia J J An et al A a Vehicle f g h days days Fig Transduced PEP-1–HSP27 fusion protein inhibits stressinduced DNA damage Astrocytes were exposed to hydrogen peroxide in the absence or presence of lM PEP-1–HSP27 After hydrogen peroxide exposure, DNA fragmentation was analyzed by agarose gel electrophoresis M represents DNA molecular mass markers (100 bp DNA ladder) Lane 1, control cells; lane 2, hydrogen peroxide-exposed cells; lane 3, PEP-1–HSP27-treated hydrogen peroxide-exposed cells 120 B Relative density (%) d e Sham c M b 100 80 60 40 20 30 before ischemia At and days following ischemic insult, PEP-1–HSP27-treated, vehicle-treated and sham-operated control animals were killed and the protective effects of PEP-1–HSP27 fusion proteins after ischemic insult were evaluated using cresyl violet histochemistry (Fig 7) In the vehicle-treated group, the percentage of positive neurons detected was 11.2% of that in the sham-operated group In the PEP-1– HSP27 fusion protein-treated groups, and days after ischemic insult, the percentages of positive neurons were 78% and 70% of that in the sham-operated group, respectively To determine whether the PEP-1–HSP27 fusion protein crossed the blood–brain barrier, we performed immunohistochemistry on brain sections of PEP-1– HSP27-treated and sham-operated control gerbils HSP27 protein was not detected in the control animals However, HSP27 protein levels were significantly increased throughout the brain of PEP-1–HSP27-treated animals (Fig 8) These results indicate that PEP-1– HSP27 fusion proteins are efficiently transduced beyond the gerbil blood–brain barrier, and effectively protect against neuronal cell damage caused by ischemic insult 1300 NC PC days days PEP-1–HSP27 Fig Effects of transduced PEP-1–HSP27 on neuronal cell viability after ischemic insult (A) Representative photomicrography of the cresyl violet-stained hippocampus of the gerbil brain and days after ischemic insult Negative control (a,b; normal); positive control (c,d; vehicle-injected group); PEP-1–HSP27 (2 mgỈkg)1) injected into the gerbil as a single dose (e–h) Scale bars = 400 lm (a,c,e,g) and 50 lm (b,d,f,h) (B) Neuronal cell density in the hippocampal CA1 region of gerbils injected with PEP-1–HSP27 fusion protein Each bar represents the mean ± SE obtained from seven gerbils Effect of transduced PEP-1–HSP27 on lipid peroxidation We examined whether PEP-1–HSP27 could inhibit ischemia-induced lipid peroxidation by the measuring levels of malondialdehyde (MDA), a marker of lipid peroxidation, in the hippocampus Three hours after ischemic insult, MDA levels were significantly elevated compared to the sham-operated control group (no ischemic insult, no PEP-1–HSP27 treatment) However, the PEP-1–HSP27-treated group showed FEBS Journal 275 (2008) 1296–1308 ª 2008 The Authors Journal compilation ª 2008 FEBS J J An et al Protective effects of PEP-1–HSP27 against brain ischemia B A Fig Transduction of PEP-1–HSP27 fusion protein across the blood–brain barrier Transduction of PEP-1–HSP27 fusion protein in gerbil brain was analyzed by immunohistochemistry using antibody against histidine Animals were treated with a single injection of PEP-1–HSP27 and killed after h (A) Negative control; (B) PEP-1–HSP27-treated gerbil 12 MDA (nmol·g–1) 10 Sham Ischemia PEP-1–HSP27 + Ischemia Fig Effects of transduced PEP-1–HSP27 on brain malondialdehyde (MDA) level PEP-1–HSP27 was administered 30 before ischemia At h after the ischemic insult, hippocampi were dissected for measurement of MDA Each bar represents the mean ± SEM obtained from five gerbils Values are significantly different between the sham-operated group and the ischemia group (P < 0.001) and between the PEP-1–HSP27 + ischemia group and the ischemia group (P < 0.01) significantly lower hippocampal MDA levels after ischemic insult compared to the ischemic insult group that was not treated with PEP-1–HSP27 (Fig 9) Neuronal cell death in the hippocampal CA1 region In the sham-operated group, ionized calcium-binding adapter molecule (iba-1)-immunoreactive cells were detected in all layers of the CA1 region (Fig 10A) but the iba-1 immunoreactivity in the cells was weak Four days after ischemic insult, iba-1-immunoreactive cells aggregated in the stratum pyramidale, and their iba-1 immunoreactivity was very strong (Fig 10C) However, in the PEP-1–HSP27-treated groups (4 and days), the presence of iba-1-immunoreactive cells and their iba-1 immunoreactivities were markedly decreased in the CA1 regions (Fig 10E,G) Under the same experimental conditions, we performed Fluoro-Jade B (F-JB) histofluorescence staining In the sham-operated control group, no F-JB-positive neurons were detected in the hippocampal CA1 region (Fig 10B) F-JB-positive neurons were abundant in the hippocampal CA1 region days after ischemic insult because of neuronal death in this region (Fig 10D) However, the numbers of F-JB-positive neurons in the hippocampal CA1 region in the PEP-1– HSP27-treated group after and days were significantly decreased (Fig 10F,H) Discussion Heat shock proteins (HPSs) have very important functions, such as acting as molecular chaperones under physiological conditions or in response to stress The most common inducible HSPs in the nervous system are HSP70 and HSP27, and they have been shown to be neuroprotective In particular, HSP27 belongs to the family of small heat shock proteins, which protect against apoptotic cell death triggered by various stimuli such as oxidative stress, and increase the antioxidant defense of cells by decreasing the levels of reactive oxygen species (ROS) [23–25] HSPs have been implicated as modulators of disease pathology in many neurological conditions [10–13] Moreover, studies have demonstrated marked differences for each HSP FEBS Journal 275 (2008) 1296–1308 ª 2008 The Authors Journal compilation ª 2008 FEBS 1301 Protective effects of PEP-1–HSP27 against brain ischemia iba-1 J J An et al F-JB A B Sham C D Vehicle E F days G H days with regard to their tissue and cellular specificity and their response to different insults [14–16] However, the exact role of HSP27 in the disease process remains unclear Although HSP27 has been considered as having potential as a therapeutic protein, its inability to enter cells hinders its use for this purpose Therefore, in an effort to deliver HSP27 protein to cells and tissues, we investigated the possibility of protein transduction As the HSP27 has multiple roles, it may be considered as a potential therapeutic protein against various neuronal diseases if the protein can be delivered into cells Morris et al [18] have designed a 21-residue peptide carrier, the PEP-1 peptide, that 1302 Fig 10 iba-1 and Fluoro-Jade B (F-JB) staining in the CA1 region in sham-operated (A,B), vehicle-treated (C,D) and PEP-1– HSP27-treated groups (E,F) and (G,H) days after ischemic insult With F-JB staining, only damaged neurons are fluorescent In the PEP-1–HSP27-treated groups, the numbers of iba-1- and F-JB-positive neurons were markedly decreased in the hippocampal CA1 region in comparison with the vehicle-treated group Scale bar = 50 lm allows transduction of proteins in their native condition To express the cell-permeable PEP-1–HSP27 protein, the human HSP27 gene was fused to a PEP-1 peptide in a bacterial expression vector to produce a genetic in-frame PEP-1–HSP27 fusion protein The PEP-1– HSP27 fusion protein was a major component of the total soluble proteins in cells, and was found to be nearly homogeneous and more than 95% pure by SDS–PAGE analysis The identity of the expressed and purified PEP-1–HSP27 fusion proteins was confirmed by western blot analysis using an anti-rabbit polyhistidine antibody FEBS Journal 275 (2008) 1296–1308 ª 2008 The Authors Journal compilation ª 2008 FEBS J J An et al It has been shown that protein transduction across the cell membrane by HIV-1 Tat and (Arg)9 protein transduction domain fusions does not occur in living cells, and that it is an artifactual redistribution caused by cell fixation [26] The cell fixation technique disrupts the cell membrane and therefore cannot be reliably used to study membrane-translocating proteins These peptides and fusion proteins are internalized into cells by endocytosis Thus, cell fixation should be avoided in studies of protein transduction into living cells [26] However, in this study, we were unable to detect any differences in the distribution of the fluorescence of transduced PEP-1–HSP27 fusion proteins in non-fixed and fixed cells These results demonstrate that cell fixation with paraformaldehyde is not required for PEP-1–HSP27 transduction Similar observations have been reported indicating that artifacts of protein transduction are not induced by paraformaldehyde fixation [27] Our previous studies showed that transduction of PEP-1–SOD and PEP-1– rpS3 fusion proteins into neuronal and skin cells was not affected by paraformaldehyde fixation [21,22] Purified PEP-1–HSP27 fusion proteins were efficiently transduced into astrocytes in a time- and dosedependent manner The fusion protein was transduced into cells within 10 min, and levels gradually increased up to 60 after transduction Morris et al [18] showed that PEP-1 peptide ⁄ green fluorescent protein (GFP, 30 kDa) or b-Gal (b-galactosidase, 119 kDa) mixtures can be transduced into a human fibroblast cell line (HS-68) and into Cos-7 cells by incubation with a PEP-1 peptide carrier and the GFP or b-Gal proteins for 30 at 37 °C These differences in the time courses of transduction may depend on whether the target protein is fused to the PEP-1 vector or mixed with the PEP-1 peptide Fusion with the PEP-1 vector may alter the conformation, polarity or molecular shape of the target protein, improving transduction of the fusion proteins into cells To determine whether transduced PEP-1–HSP27 fusion proteins can play a biological role in the cells, we tested the effect of transduced PEP-1–HSP27 fusion proteins on cell viability under oxidative stress The viability of cells treated with hydrogen peroxide was significantly increased when cells were pretreated with PEP-1–HSP27 fusion proteins Only 35% of cells treated with hydrogen peroxide without PEP-1–HSP27 were viable Next, we examined the ability of transduced PEP-1–HSP27 fusion protein to inhibit stressinduced DNA damage, and found that it efficiently protects against such damage It is well known that DNA damage triggers a cell-death mechanism and induces apoptosis These results indicate that the trans- Protective effects of PEP-1–HSP27 against brain ischemia duced PEP-1–HSP27 fusion protein efficiently protects against cell death caused by oxidative stress This protective effect is in agreement with other reports indicating that overexpression of HSP27 protects neuronal cells from a variety of death-inducing stimuli [12,28] To examine the ability of transduced PEP-1–HSP27 fusion protein to protect against ischemic damage, we designed a gerbil animal model The formation of a large amount of toxic ROS in the hypoxic and ischemic brain has been proposed to be an important step in the sequence of events that links cerebral blood flow reduction to neuronal death ROS formation has been demonstrated during acute ischemic attack and after blood and oxygen are eventually returned to the brain by reperfusion [29] In this study, PEP-1–HSP27 was intraperitoneally administered 30 before ischemia At and days following ischemia, the protective effects of the fusion proteins were confirmed by immunohistochemistry The magnitude of the protective effect of PEP-1–HSP27 fusion protein was indicated by the 78% and 70% survival of CA1 neurons, respectively, after and days In addition, we observed that the PEP-1–HSP27 fusion protein crossed the blood–brain barrier and the protein levels significantly increased throughout the brain Recently, Cho et al [30] demonstrated that PEP-1–cargo fusion proteins can be efficiently delivered into neurons in the ischemic hippocampus, and that PEP-1–SOD treatment of animals with ischemic damage (induced prior to treatment) reduces that damage Oxidative stress is an important underlying factor in delayed neuronal death induced by ischemic insult Release of ROS and increases in lipid peroxidation can be detected at a very early stage [8,31,32] We observed a significant increase in brain MDA levels, a marker of lipid peroxidation, h after an ischemic insult, similar to that reported previously [33] However, increased MDA levels were significantly reduced by pretreatment with transduced PEP-1–HSP27 Neuronal death induced by injury of the central nervous system causes activation of microglia It has been reported that activated microglia contribute to various neurodegenerative diseases via the production of cytotoxic molecules such as free radicals, proinflammatory prostaglandins and cytokines [34–36] Ionized calciumbinding adaptor molecule (iba-1) is a calcium-binding protein that is specifically expressed in microglia in the brain and plays an important role in regulating their function iba-1 has been utilized as a microglial marker in several studies [37,38] In this study, we observed iba-1-immunoreactive cells in the hippocampal CA1 regions after ischemia The number of iba-1immunoreactive cells increased significantly in the FEBS Journal 275 (2008) 1296–1308 ª 2008 The Authors Journal compilation ª 2008 FEBS 1303 Protective effects of PEP-1–HSP27 against brain ischemia J J An et al hippocampal CA1 region days after an ischemic insult However, in the PEP-1–HSP27-treated group, the number of iba-1-immunoreactive cells decreased markedly in the hippocampal CA1 region at and days after the ischemic insult compared with the group that was not treated with PEP-1–HSP27 We also observed cell death using F-JB histofluorescent staining under the same experimental conditions F-JB staining confirmed the presence of damaged neurons in the hippocampal CA1 region However, transduced PEP-1–HSP27 fusion protein markedly decreased the number of damaged neurons in the hippocampal CA1 region These results indicate that PEP-1–HSP27 fusion protein is associated with delayed neuronal death in the hippocampal CA1 region after ischemia, and attenuates the neuronal damage after an ischemic insult HSP27 has a potent ability to increase cell survival in response to a wide range of cellular challenges Reports have shown that overexpression of an individual HSP using viral vectors has a protective effect in ischemic ⁄ reperfusion animal models, and demonstrated that cell damage is reduced in hippocampus neurons by approximately 50% in HSP27 transgenic animal models [39,40] Recently, Kwon et al reported that transduced Tat–HSP27 protein reduces infarct volume (29.5%) compared with controls (39.1%) in ischemic ⁄ reperfusion animals [41] In addition, Badin et al [42] demonstrated that, in animal ischemia models, herpes simplex virus carrying HSP27 reduced neuronal cell death by 44% These results indicate that HSP27 protected against neuronal cell death induced by ischemia and stroke In summary, we demonstrate here for the first time that human HSP27 fused with PEP-1 peptide (PEP-1– HSP27) can be efficiently transduced in vitro and in vivo in its native conformation Moreover, PEP-1– HSP27 fusion protein markedly protected against stress-induced cell death and ischemic insults Although the detailed mechanism remains to be further elucidated, our success in protein transduction of PEP-1–HSP27 may provide a new strategy for protecting against cell destruction resulting from ischemic damage, and therefore may provide an opportunity for development of therapeutic agents for the treatment of various human diseases including stroke Experimental procedures Materials Restriction endonuclease and T4 DNA ligase were purchased from Promega Co (Madison, WI, USA) Oligo- 1304 nucleotides were synthesized from Gibco BRL custom primers (Gibco, Grand Island, NY, USA) The Ni2+-nitrilotriacetic acid Sepharose superflow column was purchased from Qiagen (Valencia, CA, USA) Isopropyl thio-b-dgalactoside (IPTG) was purchased from Duchefa Co (Haarlem, the Netherlands) Plasmid pET-15b and Escherichia coli strain BL21 (DE3) were obtained from Novagen (Hilden, Germany) Expression and purification of PEP-1–HSP27 fusion proteins The PEP-1–HSP27 fusion construct was generated by fusion of the human HSP27 gene in-frame with the sequence encoding the 21-amino acid PEP-1 peptide in a bacterial expression vector (Fig 1) A PEP-1–HSP27 expression vector was constructed to express the PEP-1 peptide (KETWWETWWTEWSQPKKKRKV) as a fusion with human HSP27 First, two oligonucleotides 5¢-TATGAAAGAAACCTGGTGGG AAACCTGGTGGACCGAATGGTCTCAGCCGAAAAA AAAACGTAAAGTGC-3¢ (top strand) and 5¢-TCGABC ACTTTACGTTTTTTTTTCGGCTGAGACCATTCGGTC CACCAGGTTTCCCACCAGGTTTCTTTCC-3¢ (bottom strand) were synthesized and annealed to generate a doublestranded oligonucleotide encoding the PEP-1 peptide The double-stranded oligonucleotide was ligated into an NdeI– XhoI-digested pET-15b vector Second, two primers were synthesized on the basis of the cDNA sequence of human HSP27 The sense primer, 5¢-CTCGAGATGACCGAGCG CCGCGTCCCCTTC-3¢, contains an XhoI site, and the antisense primer, 5¢-GGATCCTTACTTGGCGGCAGTCT CATCGGA-3¢, contains a BamHI restriction site PCR was performed and the PCR product was excised with XhoI and BamHI, eluted, ligated into a pPEP-1 vector using T4 DNA ligase, and transformed into E coli DH5a cells The PEP-1–HSP27 sequences were confirmed by sequence analysis To produce the PEP-1–HSP27 fusion proteins, the plasmid was transformed into E coli BL21 cells The transformed bacterial cells were grown in 100 mL of LB media at 37 °C to a D600 value of 0.5–1.0 and induced with 0.5 mm IPTG at 37 °C for h Harvested cells were lysed by sonication at °C in a binding buffer (5 mm imidazole, 500 mm NaCl, 20 mm Tris ⁄ HCl, pH 7.9) The recombinant PEP-1–HSP27 was purified by loading clarified cell extracts onto a Ni2+-nitrilotriacetic acid Sepharose affinity column (Qiagen) under native conditions After washing the column with 10 volumes of binding buffer and six volumes of a wash buffer (25 mm imidazole, 500 mm NaCl, and 20 mm Tris ⁄ HCl, pH 7.9), the fusion proteins were eluted using an eluting buffer (0.25 m imidazole, 500 mm NaCl, 20 mm Tris ⁄ HCl, pH 7.9) The fractions containing the PEP-1– HSP27 fusion proteins were combined, and salts were removed using PD-10 column chromatography (Amersham, Braunschweig, Germany) The protein concentration was FEBS Journal 275 (2008) 1296–1308 ª 2008 The Authors Journal compilation ª 2008 FEBS J J An et al estimated by the Bradford procedure using BSA as the standard [43] Primary cell cultures Primary neuronal cell cultures were prepared from embryonic gestation of mouse embryos (day 14–15) Ventral mesencephalic tissue was mechanically dissociated by mild trituration in ice-cold calcium- and magnesium-free Hank’s balanced saline solution and incubated with 0.05% trypsin ⁄ EDTA at 37 °C for 15 Dissociated cells were transferred to a neurobasal medium containing 2% B27 supplement (Gibco, Grand Island, NY, USA), mm glutamate, 100 unitsỈmL)1 penicillin and 100 lgỈmL)1 streptomycin (units as defined by supplier; Bio Whittaker, Walkersville, MD, USA) Cells were seeded onto poly-dlysine-coated 24-well culture plates Cultures were maintained at 37 °C in a humidified atmosphere containing 95% air and 5% CO2 After days, half of the medium was replaced with fresh medium Cells were grown for an additional days and the cells were then used [44] Transduction of PEP-1–HSP27 fusion protein into astrocytes and primary neuronal cells Astrocytes were cultured in Dulbecco’s modified Eagle’s medium containing 20 mm Hepes ⁄ NaOH (pH 7.4), mm NaHCO3, 10% fetal bovine serum and antibiotics (100 lgỈmL)1 streptomycin, 100 unitsỈmL)1 penicillin) at 37 °C under humidified conditions (95% air and 5% CO2) For transduction of PEP-1–HSP27, the primary neuronal cells and astrocytes were grown to confluence on a 6-well plate Then the culture medium was replaced with mL of fresh solution After the cells had been treated with various concentrations of PEP-1–HSP27 for h, the cells were treated with trypsin ⁄ EDTA (Gibco) and washed with NaCl ⁄ Pi The cells were harvested for the preparation of cell extracts for western blot analysis Fluorescence analysis For direct detection of fluorescein-labeled protein, purified PEP-1–HSP27 was labeled using an EZ-Label fluorescein isothiocyanate (FITC) protein labeling kit (Pierce, Rockford, IL, USA) The FITC labeling was performed according to the manufacturer’s instructions Cultured cells were grown on glass coverslips and treated with lm PEP-1–HSP27 fusion proteins Following incubation for h at 37 °C, the cells were washed twice with NaCl ⁄ Pi and trypsin ⁄ EDTA The cells were fixed with 4% paraformaldehyde for 10 at room temperature The distribution of fluorescence was analyzed on a fluorescence microscopy (Carl Zeiss, EL-Einsatz, Goettingen, Germany) Protective effects of PEP-1–HSP27 against brain ischemia MTT assay The biological activity of the transduced PEP-1–HSP27 fusion proteins was assessed by measuring the cell viability of astrocytes treated with hydrogen peroxide The cells were seeded into 6-well plates at 70% confluence, and were pretreated with lm PEP-1–HSP27 for h, then hydrogen peroxide (1.2 mm) was added to the culture medium for h Cell viability was estimated by a colorimetric assay using MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-dipheyltetrazolium bromide) Controls cells were not pretreated with PEP-1–HSP27 Analysis of DNA fragmentation DNA fragmentation was performed according to the method described by Iwahashi et al [45] After transduction of PEP-1–HSP27 fusion proteins into astrocytes, the cells were exposed to hydrogen peroxide (1.2 mm) for h at 37 °C Then, cultured cells were lysed and treated with RNase and proteinase K (Roche, Mannheim, Germany) The DNA was then extracted with phenol–chloroform, precipitated with isopropanol, washed with ethanol, and airdried DNA samples were separated by 1.2% agarose gel electrophoresis The gel was stained with ethidium bromide and photographed under UV light Experimental animals and induction of cerebral forebrain ischemia This study used the progeny of Mongolian gerbils (Meriones unguiculatus) obtained from the Experiment Animal Center at Hallym University The animals were housed at constant temperature (23 °C) and relative humidity (60%) with a fixed 12 h light ⁄ dark cycle and free access to food and water Procedures involving animals and their care conformed to the institutional guidelines, which are in compliance with current NIH Guidelines for the Care and Use of Laboratory Animals, and were approved by the Hallym Medical Center Institutional Animal Care and Use Committee Male Mongolian gerbils weighing 65–75 g were placed under general anesthesia using a mixture of 2.5% isoflurane (Abbott Laboratories, Abbott Park, IL, USA) in 33% oxygen and 67% nitrous oxide To determine whether transduced PEP-1–HSP27 protects from ischemic damage, gerbils were intraperitoneally injected with PEP-1–HSP27 fusion protein (2 mgỈkg)1) 30 before occlusion of common carotid arteries A midline ventral incision was made in the neck The common carotid arteries were isolated, freed of nerve fibers, and occluded with non-traumatic aneurysm clips Complete interruption of blood flow was confirmed by observing the central artery in the eyeball using an ophthalmoscope After occlusion, the aneurysm clips were removed Restoration of blood flow FEBS Journal 275 (2008) 1296–1308 ª 2008 The Authors Journal compilation ª 2008 FEBS 1305 Protective effects of PEP-1–HSP27 against brain ischemia J J An et al (reperfusion) was observed directly under the ophthalmoscope Sham-operated animals (n = 7) were subjected to the same surgical procedures except that the common carotid arteries were not occluded Rectal temperature was monitored and maintained at 37 ± 0.5 °C before and during the surgery, and after the surgery until the animals had recovered fully from anesthesia At and days after ischemia ⁄ reperfusion, the sham-operated group, vehicletreated group and PEP-1–HSP27-treated group were killed for cresyl violet staining Effect of transduced PEP-1–HSP27 on cell viability after ischemic insult The animals were anesthetized with pentobarbital sodium, and perfused transcardially with NaCl ⁄ Pi (pH 7.4), followed by 4% paraformaldehyde in 0.1 m phosphate buffer (pH 7.4) in sham-operated (n = 7), vehicle-treated (n = 7) and PEP-1–HSP27-treated groups for and days (n = 7) after the surgery Brains were removed and postfixed in the same fixative for h The brain tissues were cryoprotected by infiltrating with 30% sucrose overnight Thereafter, the tissues were frozen and sectioned with a cryostat at 30 lm, and consecutive sections were collected in 6-well plates containing NaCl ⁄ Pi These free-floating sections were then mounted on glass slides and air-dried, followed by staining with cresyl violet acetate in the usual manner [30] Measurement of lipid peroxidation in the hippocampus Lipid peroxidation was measured according to the method described by Zhang et al [46] An aliquot (100 lL) of brain supernatant was added to a reaction mixture containing 100 lL of 8.1% SDS, 750 lL of 20% acetic acid (pH 3.5), 750 lL of 0.8% thiobarbituric acid and 300 lL distilled water Samples were then boiled for h (95 °C) and centrifuged at 4000 g for 10 The absorbance of the supernatant was measured by spectrophotometry at 532 nm Immunohistochemistry for iba-1 To confirm the neuroprotective effects and reactive gliosis after PEP-1–HSP27 treatment, immunohistochemistry was performed according to the method previously described [49] The sections were incubated with rabbit anti-ionized calcium-binding adapter molecule (iba-1) (1 : 500; Wako, Osaka, Japan) and subsequently exposed to biotinylated goat anti-rabbit IgG and streptavidine peroxidase complex (diluted : 200; Vector (Burlingame, CA, USA)) They were then visualized by staining with 3,3’-diaminobenzidine Quantitative analysis To calculate the number of surviving neurons, sections (10 per animal) representing the same level of the hippocampus were selected for measurement Each studied field in each tissue was within the midpoint of the hippocampal CA1 region including all layers Tissue images were obtained using an Axiophot light microscope (Carl Zeiss) connected via CCD camera to a PC monitor Images of cresyl violetpositive neurons were captured using an Applescanner (Cupertino, CA, USA) Measurement of the number of neuronal somata was performed using an image-analyzing system equipped with a computer-based CCD camera and utilizing optimas 6.5 software (CyberMetrics, Scottsdale, AZ, USA) Cell counts were obtained by averaging the counts from 70 sections taken from each animal The numbers of cresyl violet-positive neurons in the PEP-1–HSP27and vehicle-treated groups were compared to that in the sham-operated group Finally, an anova test was performed to investigate the protective effect of PEP-1–HSP27 Acknowledgements This work was supported by a 21st Century Brain Frontier Research Grant (M103KV010019-03K220101910) and a Next Generation Growth Engine Program Grant from the Korean Science and Engineering Foundation Fluoro-Jade B histofluorescence staining To examine the effect of PEP-1–HSP27 on ischemic damage, the sections were stained using F-JB, a marker for neurodegeneration [47] The sections were first immersed in a solution containing 1% sodium hydroxide in 80% alcohol, followed by a solution with 70% alcohol They were then transferred to a solution of 0.06% potassium permanganate, and then to a 0.0004% F-JB staining solution (Histochem, Jefferson, AR, USA) After washing, the sections were placed on a slide warmer, and examined using an epifluorescent microscope (Carl Zeiss) Using this method, neurons that undergo degeneration are brightly stained in comparison to the background [48] 1306 References Floyd RA (1990) Role of oxygen free radicals in carcinogenesis and brain ischemia FASEB J 4, 2587–2597 Halliwell B & Gutteridge JMC (1999) Free Radicals in Biology and Medicine Oxford University Press, Oxford Dore S, Otsuka T, Mito T, Sugo N, Hand T, Wu L, Hurn PD, Traystman RJ & Andreasson K (2003) Neuronal overexpression of cyclooxygenase-2 increases cerebral infarction Ann Neurol 54, 155–162 Petito CK, Torres-Munoz J, Roberts B, Olarte JP, Nowak TS Jr & Pulsinelli WA (1997) DNA FEBS Journal 275 (2008) 1296–1308 ª 2008 The Authors Journal compilation ª 2008 FEBS J J An et al 10 11 12 13 14 15 16 17 18 19 fragmentation follows delayed neuronal death in CA1 neurons exposed to transient global ischemia in the rat J Cereb Blood Flow Metab 17, 967–976 Frantseva MV, Carlen PL & Perez Velazquez JL (2001) Dynamics of intracellular calcium and free radical production during ischemia in pyramidal neurons Free Radic Biol Med 31, 1216–1227 Numagami Y, Sato S & Ohnishi ST (1996) Attenuation of rat ischemic brain damage by aged garlic extracts: a possible protecting mechanism as antioxidants Neurochem Int 29, 135–143 Won MH, Kang TC, Jeon GS, Lee JC, Kim DY, Choi EM, Lee KH, Choi CD, Chung MH & Cho SS (1999) Immunohistochemical detection of oxidative DNA damage induced by ischemic–reperfusion insults in gerbil hippocampus in vivo Brain Res 836, 70–78 Chan PH (2001) Reactive oxygen radicals in signaling and damage in the ischemic brain J Cereb Blood Flow Metab 21, 2–14 Yenari MA, Giffard RG, Sapolsky RM & Steinberg GK (1999) The neuroprotective potential of heat shock protein 70 (HSP70) Mol Med Today 5, 525–531 Kitamura Y & Nomura Y (2003) Stress proteins and glial functions: possible therapeutic targets for neurodegenerative disorders Pharmacol Ther 97, 35–53 Slavotinek AM & Biesecker LG (2001) Unfolding the role of chaperones and chaperonins in human disease Trends Genet 17, 528–535 Takayama S, Reed JC & Homma S (2003) Heat-shock proteins as regulators of apoptosis Oncogene 22, 9041– 9047 Latchman DS (2005) HSP27 and cell survival in neurons Int J Hyperthermia 21, 393–402 Akbar MT, Wells DJ, Latchman DS & de Belleroche J (2001) Heat shock protein 27 shows a distinctive widespread spatial and temporal pattern of induction in CNS glial and neuronal cells compared to heat shock protein 70 and caspase following kainite administration Mol Brain Res 93, 148–163 Mailhos C, Howard MK & Latchman DS (1993) Heat shock protects neuronal cells from programmed cell death by apoptosis Neuroscience 55, 621–627 Wagstaff MJ, Collaco-Moraes Y, Smith J, de Belleroche JS, Coffin RS & Latchman DS (1999) Protection of neuronal cells from apoptosis by Hsp27 delivered with a herpes simplex virus-based vector J Biol Chem 274, 5061–5069 Wadia JS & Dowdy SF (2002) Protein transduction technology Curr Opin Biotechnol 13, 52–56 Morris MC, Depollier J, Mery J, Heitz F & Divita G (2001) A peptide carrier for the delivery of biologically active proteins into mammalian cells Nat Biotechnol 19, 1173–1176 Kwon HY, Eum WS, Jang HW, Kang JH, Ryu J, Lee BR, Jin LH, Park J & Choi SY (2000) Transduction of Protective effects of PEP-1–HSP27 against brain ischemia 20 21 22 23 24 25 26 27 28 29 30 31 Cu,Zn-superoxide dismutase mediated by an HIV-1 Tat protein basic domain into mammalian cells FEBS Lett 485, 163–167 Eum WS, Kim DW, Hwang IK, Yoo KY, Kang TC, Jang SH, Choi HS, Choi SH, Kim YH, Kim SY et al (2004) In vivo protein transduction: biologically active intact PEP-1–superoxide dismutase fusion protein efficiently protects against ischemic insult Free Radic Biol Med 37, 1656–1669 Choi HS, An JJ, Kim SY, Lee SH, Kim DW, Yoo KY, Won MH, Kang TC, Kwon HJ, Kang JH et al (2006) PEP-1–SOD fusion protein efficiently protects against paraquat-induced dopaminergic neuron damage in a Parkinson disease mouse model Free Radic Biol Med 41, 1058–1068 Choi SH, Kim SY, An JJ, Lee SH, Kim DW, Ryu HJ, Lee NI, Yeo SI, Jang SH, Won MH et al (2006) Human PEP-1–ribosomal protein S3 protects against UV-induced skin cell death FEBS Lett 580, 6755– 6762 Jakob U & Buchner J (1994) Assisting spontaneity: the role of HSP90 and small HSPs as molecular chaperones Trends Biochem Sci 19, 205–211 Kiang JG & Tsokos GC (1998) Heat shock protein 70 kDa: molecular biology, biochemistry, and physiology Pharmacol Ther 80, 183–201 Mehlen P, Kretz-Remy C, Preville X & Arrigo AP (1996) Human HSP27, Drosophila HSP27 and human B-crystallin expression-mediated increase in glutathione is essential for the protective activity of these proteins against TNF-induced cell death EMBO J 15, 2695– 2706 Richard JP, Melikov K, Vives E, Ramos C, Verbeure B, Gait MJ, Chernomordik LV & Lebleu B (2003) Cellpermeable peptides: a reevaluation of the mechanism of cellular uptake J Biol Chem 278, 585–590 Cashman SM, Morris DJ & Kumar-Singh R (2003) Evidence of protein transduction but not intracellular transport by protein fused to HIV Tat in retinal cell culture and in vivo Mol Ther 8, 130–142 Concannon CG, Gorman AM & Samali A (2003) On the role of Hsp27 in regulating apoptosis Apoptosis 8, 61–70 Hall ED & Braughler JM (1989) Central nervous system trauma and stroke II Physiological and pharmacological evidence for involvement of oxygen radicals and lipid peroxidation Free Radic Biol Med 6, 303–313 Cho JH, Hwang IK, Yoo KY, Kim SY, Kim DW, Kwon YG, Choi SY & Won MH (2008) Effective delivery of Pep-1–cargo protein into ischemic neurons and long-term neuroprotection of Pep-1–SOD1 against ischemic injury in the gerbil hippocampus Neurochem Int 52, 659–668 Candelario-Jalil E, Mhadu NH, Al-Dalain SM, Martinez G & Leon OS (2001) Time course of oxidative FEBS Journal 275 (2008) 1296–1308 ª 2008 The Authors Journal compilation ª 2008 FEBS 1307 Protective effects of PEP-1–HSP27 against brain ischemia 32 33 34 35 36 37 38 39 40 J J An et al damage in different brain regions following transient cerebral ischemia in gerbils Neurosci Res 41, 233–241 Wang Q, Sun AY, Simonyi A, Jensen MD, Shelat PB, Rottinghaus GE, MacDonald RS, Miller DK, Lubahn DE, Weisman GA et al (2005) Neuroprotective mechanisms of curcumin against cerebral ischemia-induced neuronal apoptosis and behavioral deficits J Neurosci Res 82, 138–148 Sharma SS, Dhar A & Kaundal RK (2007) FeTPPS protects against global cerebral ischemic–reperfusion injury in gerbils Pharmacol Res 55, 335–342 Kreutzberg GW (1996) Microglia: a sensor for pathological events in the CNS Trends Neurosci 19, 312–318 Araham H, Losonczy A, Czeh G & Lazar G (2001) Rapid activation of microglial cells by hypoxia, kainic acid, and potassium ions in slice preparations of the rat hippocampus Brain Res 906, 115–126 Teismann P & Schulz JB (2004) Cellular pathology of Parkinson’s disease: astrocytes, microglia and inflammation Cell Tissue Res 318, 149–161 Kato H, Tanaka S, Oikawa T, Koike T, Takahashi A & Itoyama Y (2000) Expression of microglial response factor-1 in microglia and macrophages following cerebral ischemia in the rat Brain Res 882, 206–211 Ito D, Tanaka K, Suzuki S, Dembo T & Fukuuchi Y (2001) Enhanced expression of Iba1, ionized calciumbinding adapter molecule 1, after transient focal cerebral ischemia in rat brain Stroke 32, 1208–1215 Brar BK, Stephanou A, Wagstaff MJ, Coffin RS, Marber MS, Engelmann G & Latchman DS (1999) Heat shock protein delivered with a virus vector can protect cardiac cells against apoptosis as well as against thermal or hypoxic stress J Mol Cell Cardiol 31, 135–146 Akbar MT, Lundberg AMC, Liu K, Vidyadaran S, Wells KE, Dolatshad H, Wynn S, Wells DJ, Latchman DS & de Belleroche J (2003) The neuroprotective effects of heat shock protein 27 overexpression in transgenic animals against kainite-induced seizures and hippocampal cell death J Biol Chem 278, 19956–19965 1308 41 Kwon JH, Kim JB, Lee KH, Kang SM, Chung N, Jang Y & Chung JH (2007) Protective effect of heat shock protein 27 using protein transduction domain-mediated delivery on ischemia ⁄ reperfusion heart injury Biochem Biophys Res Commun 363, 399–404 42 Badin RA, Lythgoe MF, van der Weerd L, Thomas DL, Gadian DG & Latchman DS (2006) Neuroprotective effects of virally delivered HSPs in experimental stroke J Cereb Blood Flow Metab 26, 371–381 43 Bradford M (1976) A rapid and sensitive method for the quantitation of microgram quantities utilizing the principle of protein–dye binding Anal Biochem 72, 248–254 44 Peng J, Mao XO, Stevenson FF, Hsu M & Andersen JK (2004) The herbicide paraquat induces dopaminergic nigral apoptosis through sustained activation of the JNK pathway J Biol Chem 279, 32626–32632 45 Iwahashi H, Hanafusa T, Eguchi Y, Nakajima H, Miyagawa J, Itoh N, Tomita K, Namba M, Kuwajima M, Noguchi T et al (1996) Cytokine-induced apoptotic cell death in a mouse pancreatic beta cell line: inhibition by Bcl-2 Diabetologia 39, 530–536 46 Zhang DL, Zhang YT, Yin JJ & Zhao BL (2004) Oral administration of Crataegus flavonoids protects against ischemia ⁄ reperfusion brain damage in gerbils J Neurochem 90, 211–219 47 Candelario-Jalil E, Alvarez D, Merino N & Leon OS (2003) Delayed treatment with nimesulide reduces measures of oxidative stress following global ischemic brain injury in gerbils Neurosci Res 47, 245–253 48 Schmued LC & Hopkins KJ (2000) Fluoro-Jade B: a high affinity fluorescent marker for the localization of neuronal degeneration Brain Res 874, 123–130 49 Hwang IK, Yoo KY, Kim DW, Choi SY, Kang TC, Kim YS & Won MH (2006) Ionized calcium-binding adapter molecule immunoreactive cells change in the gerbil hippocampal CA1 region after ischemia ⁄ reperfusion Neurochem Res 31, 957–965 FEBS Journal 275 (2008) 1296–1308 ª 2008 The Authors Journal compilation ª 2008 FEBS ... of PEP-1–HSP27 against brain ischemia A BamH I Xho I T7 term HSP27 PEP-1 His-Tag Lac O T7 Prom MCS Apr PEP-1–HSP27 IacI ori PEP-1–HSP27 His-Tag PEP-1 Control HSP27 B His-Tag HSP27 HSP27 Fig The... results indicate that transduced PEP-1–HSP27 fusion protein plays a defensive role against cell death induced by oxidative stress in the cells Transduced PEP-1–HSP27 protects against ischemic damage... However, HSP27 protein levels were significantly increased throughout the brain of PEP-1–HSP27-treated animals (Fig 8) These results indicate that PEP-1– HSP27 fusion proteins are efficiently transduced