... that the PX domain of p47phox binds intramolecularly to the SH3 domain in the same protein, and that this intramolecular interaction suppresses the lipid-binding activity of the PX domain in the ... 5579 fad49 plays a crucial role in adipogenesis T Hishida et al Fig Characterization of the PX domain of FAD49 (A) Phosphoinositide binding specificity of the...
Ngày tải lên: 16/03/2014, 04:20
... derivatives used in this study Name Sequence (residues 91–100) WT polyAla AGG GAG GGA GAA AGA AAG GGD GGE GGL GGN GGS GGP GGGAGGGGGG *SA*AAAAA* AAA******* ****AAA*** *******AAA ****AAAAAA AAA****AAA ... Transit peptide of Toc75 A J Baldwin and K Inoue Fig The biogenesis of pea Toc75 The precursor, intermediate, and mature forms of Toc75 are indicated as prToc75, iToc75...
Ngày tải lên: 19/02/2014, 07:20
Báo cáo y học: "A crucial role for tumor necrosis factor receptor 1 in synovial lining cells and the reticuloendothelial system in mediating experimental arthritis" pps
... crucial role for tumor necrosis factor receptor in synovial lining cells and the reticuloendothelial system in mediating experimental arthritis Arthritis Research & Therapy 2 010 , 12 :R 61 ... = 0. 01 Ct, cycle threshold; IL, interleukin; TNF, tumor necrosis factor Page of 11 Figure Tumor necrosis factor receptor (TNFR1) silencing in t...
Ngày tải lên: 12/08/2014, 12:20
Báo cáo khoa học: Kinetic studies and molecular modelling attribute a crucial role in the specificity and stereoselectivity of penicillin acylase to the pair ArgA145-ArgB263 pdf
... O atoms of the main chain CO groups of LeuB387 and TrpB240, Od1 atom of AsnB241, and Oc atom of SerB386 and is expected to stabilize the positive charge of ArgB263 All of these views remain arguable, ... substrates The data for the PA catalysed hydrolysis of PhAc-Asp and PhAc-Glu [13] and our data for PhAc-pAB, PhAc-mAB and PhAcoAB (Table 2) imply that the...
Ngày tải lên: 16/03/2014, 16:20
Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt
... carried out in duplicate isolated and incubated in the same way as the experiments with MonoMac cells (Fig 3) In addition to TNF -a, the in ammatory cytokine IL-6 was also measured to check that ... LPCAT may alter the cell membrane lipid environment so as to favor the assembly of a signaling complex which can then activate the cellular response [15] To elucid...
Ngày tải lên: 31/03/2014, 01:20
Báo cáo Y học: Arginine 121 is a crucial residue for the specific cytotoxic activity of the ribotoxin a-sarcin potx
... His137, residues acting as the general acid and base on the catalysis by a- sarcin [19,20], rendered proteins with no detectable activity against ApA [20] Cleavage of ApA by a- sarcin is a low-specificity ... However, Table Activity of a- sarcin and its mutant variants against ApA at pH 5.0 Kinetic parameters (^ SD) determined from the transesterification of ApA by linear...
Ngày tải lên: 31/03/2014, 23:20
báo cáo khoa học: " The transcription factor PHR1 plays a key role in the regulation of sulfate shoot-to-root flux upon phosphate starvation in Arabidopsis" potx
... Cite this article as: Rouached et al.: The transcription factor PHR1 plays a key role in the regulation of sulfate shoot-to-root flux upon phosphate starvation in Arabidopsis BMC Plant Biology 2011 ... regulation was reflected in a decrease in the shoot-to-root sulfate transfer in the phr1 mutant relative Page of 10 to WT Interesting...
Ngày tải lên: 11/08/2014, 11:21
Báo cáo y học: "The membrane-spanning domain of gp41 plays a critical role in intracellular trafficking of the HIV envelope protein" pptx
... GAGGCTTGGTAGGTGCGGCCGCATTAAGAATAGTTTTTGCTGTACGTACAGCAAAAACTATTCTTAATGCGGCCGCACCTACCAAGCCTCCTAC, 695+ 4A, GGAGGCTTGGTAGGTGCGGCCGCAGCCTTAAGAATAGTTT TTGCTGTAC/GTACAGCAAAAACTATTCTTAAGGCTGCGGCCGCACCTACCAAGCCT CC,696+ 2A, ... TCC, 696 +A, GGCTTGGTAGGTTTAGCTAGAATAGTTTTTGCT/AGCAAAAACTATTCTAGCTAAAC CTACCAAGCC,695+ 2A, GAGGCTTGGTAGGTGCTG CCTTAAGAATAGTTTTTGC/GCAAAAACTATTCTTAAGGCAGCACCTACCAAGCCTC,695+ 3A...
Ngày tải lên: 13/08/2014, 01:20
Báo cáo y học: "Translational control plays a prominent role in the hepatocytic differentiation of HepaRG liver progenitor cells" docx
... (a) using total and polysome-bound RNA populations and (b) using individual fractions from mRNPs and polysomal of the array data by on sucrose gradient Validation Validation of the array data ... transport Proc Natl Acad Sci USA 2001, 98:5306-5311 Tanaka T, Yamamoto J, Iwasaki S, Asaba H, Hamura H, Ikeda Y, Watanabe M, Magoori K, Ioka RX, Tachibana K, Watanabe Y, Uchiyama Y, Sumi K...
Ngày tải lên: 14/08/2014, 08:20
Báo cáo y học: "A genome wide analysis of the response to uncapped telomeres in budding yeast reveals a novel role for the NAD+ biosynthetic gene BNA2 in chromosome end protection" doc
... measurements Table Primers for Q RT-PCR Primer Alias Sequence 1082 ACT1F GCCTTCTACGTTTCCATCCA 1083 ACT1R GGCCAAATCGATTCTCAAAA 1367 PAC2F AATAACGAATTGAGCTATGACACCAA 1368 PAC2R AGCTTACTCATATCGATTTCATACGACTT ... of BNA2, intracellular NAD+ levels may be maintained by the NAD+ salvage pathway Further experiments are required to determine the mechanism by which BNA2 affects telome...
Ngày tải lên: 14/08/2014, 21:20
def (digestive organ expansion factor) is a crucial gene for the development of endoderm derived organs in zebrafish (danio rerio
... def (digestive- organ expansion factor) IS A CRUCIAL GENE FOR THE DEVELOPMENT OF ENDODERM- DERIVED ORGANS IN ZEBRAFISH (Danio rerio) RUAN HUA (M.Sc., Wuhan University, P.R.China) A THESIS SUBMITTED ... before reviewing zebrafish intestine, liver and pancreas organogenesis 1.3.1 Endoderm formation in zebrafish 1.3.1.1 Endoderm formation and...
Ngày tải lên: 11/09/2015, 16:06
Tài liệu Báo cáo khoa học: A role for the intersubunit disulfides of seminal RNase in the mechanism of its antitumor action docx
... outside the cells, before internalization, we investigated the role of plasma membranes (PM) in the transformation of MSSAE into a dimeric protein 125I-labelled MSSAE was incubated with isolated ... reconstituted in the presence of growing broblasts into the parent dimeric protein, which is internalized as a native-like dimeric RNase They also indicate for the...
Ngày tải lên: 20/02/2014, 11:20
Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf
... the arabinogalactans from potato, onion and soy was determined as described [21] Onion arabinogalactan consists of 99% D-galactose and 0.3% L -arabinose and is predominantly linear Potato arabinogalactan ... arabinogalactan consists of 86% D-galactose and 6.6% L -arabinose, while soy arabinogalactan consists of 57% D-galactose and 38% L -arabinose Methylation analysis...
Ngày tải lên: 21/02/2014, 01:21
Báo cáo Y học: The a1b1 contact of human hemoglobin plays a key role in stabilizing the bound dioxygen Further evidence from the iron valency hybrids potx
... have used this time the valency hybrid tetramers As a result, the b chain was found to acquire a noticeable resistance against the acidic autoxidation in a manner of contacting with the a chain, ... of the a1 b1 or a2 b2 contact greatly suppresses the autoxidation rate, particularly of the b chains [8] In the autoxidation reaction of HbO2, as well a...
Ngày tải lên: 31/03/2014, 15:20
Winning in the Relationship Era™A New Model for Marketing Success By Doug Levy pptx
... airline industries, we see a different way of thinking shaking up the marketing industry The new model of marketing fostering sustainable relationships—represents a meaningful change in the role ... for assessing relationships Breakthrough Success in the Relationship Era, five keys to victory in the emerging model Getting Involved, an invitation to join us Chapt...
Ngày tải lên: 27/06/2014, 23:20