a role for the endothelin system
Tài liệu Báo cáo khoa học: A role for the intersubunit disulfides of seminal RNase in the mechanism of its antitumor action docx
... outside the cells, before internalization, we investigated the role of plasma membranes (PM) in the transformation of MSSAE into a dimeric protein 125I-labelled MSSAE was incubated with isolated ... that the cell sulfhydryls responsible for the exchange with the protein disuldes are located in the plasma membrane Furthermore, they show that, as proposed in the hypothesis above, the RNase ... with the tight pestle of a Dounce homogenizer The homogenate was centrifuged at 1000 g for 10 and the supernatant was centrifuged at 16 000 g for 30 The pellet, representing the plasma membrane...
- 8
- 604
- 0
A Role for the International Criminal Court in the Fight against Terrorism? potx
... The Institute for International Law of the K.U.Leuven groups the teaching and research in public international law and the law of international organisations at the Faculty of Law of the ... in the aftermath of the September 11 Events, one of the reasons for the Taliban regime not to extradite Osama bin Laden to the United States, was probably the Taliban’s belief that Osama bin Laden ... facts to a Trial Chamber for eventual trial.90 101 Before it can reach a decision, the Pre-Trial Chamber organizes a hearing at which the Prosecutor and the accused may present their case91 The Pre-Trial...
- 53
- 449
- 1
Báo cáo y học: "A case-control study of rheumatoid arthritis identifies an associated single nucleotide polymorphism in the NCF4 gene, supporting a role for the NADPH-oxidase complex in autoimmunity" doc
... investigator for the project and has carried out SNP selection, genotype preparation, statistical analyses and drafted the manuscript A- KL participated in the design of the study and the statistical analyses ... analyses are truly independent The allele frequencies of the SNPs are affected by the LD of the region, and the stratified analyses are based on the same SNPs and samples as the initial analysis and ... make NCF1 and the other genes of the NOX complex candidate genes for human RA However, transferring animal data to the human setting is not straightforward in this case In contrast to rats, the...
- 11
- 475
- 0
Báo cáo y học: "A role for the histone deacetylase HDAC4 in the life-cycle of HIV-1-based vectors" ppsx
... that the formation of these foci is dependent on active retroviral integrase, and HDAC4, but not HDAC2 and HDAC6, associates with viral DNA Taken together, these data indicate that HDAC4 plays ... presence of the 85kDa PARP fragment, an apoptotic marker generated by caspase-mediated cleavage of the PARP protein [30] As shown in Fig 8, ATM inhibition and infection stimulated PARP cleavage However, ... with the HIV-1based vector DNA was extracted days post-infection and analyzed by Alu-PCR (see “Experimental Procedures”) +Alu - DNA was analyzed using Alu-PCR, -Alu - a negative control, the Alu...
- 10
- 386
- 0
Báo cáo khoa học:" A role for the JAK-STAT1 pathway in blocking replication of HSV-1 in dendritic cells and macrophages" docx
... 5'-CCTCGCCGGCAACAAAA-3'; and probe, 5'-FAM-CTCCAGGCGGACTTC-3' – Amplicon length = 59 bp; and 4) gB: forward primer, 5'AACGCGACGCACATCAAG-3', reverse primer, 5'-CTGGTACGCGATCAGAAAGC-3'; and probe, 5'-FAMCAGCCGCAGTACTACC-3' ... replication, viral gB mRNA, and viral genomic DNA in macrophages was done as in Fig for DCs Panel A Virus replication, n = 12 Panel B gB mRNA, n = Panel C Viral genomic DNA, n = The results are the ... Cunningham AL, Carbone F, Geijtenbeek TB: Langerhans cells and viral immunity Eur J Immunol 2008, 38:2377-2385 Cella M, Salio M, Sakakibara Y, Langen H, Julkunen I, Lanzavecchia A: Maturation, activation,...
- 13
- 266
- 0
Báo cáo khoa học: " A role for the JAK-STAT1 pathway in blocking replication of HSV-1 in dendritic cells and macrophages" pps
... 5'-CCTCGCCGGCAACAAAA-3'; and probe, 5'-FAM-CTCCAGGCGGACTTC-3' – Amplicon length = 59 bp; and 4) gB: forward primer, 5'AACGCGACGCACATCAAG-3', reverse primer, 5'-CTGGTACGCGATCAGAAAGC-3'; and probe, 5'-FAMCAGCCGCAGTACTACC-3' ... replication, viral gB mRNA, and viral genomic DNA in macrophages was done as in Fig for DCs Panel A Virus replication, n = 12 Panel B gB mRNA, n = Panel C Viral genomic DNA, n = The results are the ... Cunningham AL, Carbone F, Geijtenbeek TB: Langerhans cells and viral immunity Eur J Immunol 2008, 38:2377-2385 Cella M, Salio M, Sakakibara Y, Langen H, Julkunen I, Lanzavecchia A: Maturation, activation,...
- 13
- 468
- 0
a role for the endosomal snare complex and tethers in autophagy
... Atg13 (Kabeya et al., 2005) Furthermore, complex formation between Atg17-Atg29Atg31 and Atg1-Atg13 is required for Atg1 kinase activity and thereby autophagy (Kamada et al., 2000; Kabeya et al., ... suggestive of a role for the ER in autophagosome formation in mammalian cells (Yla-Anttila et al., 2009) Following the organisation of the vesicle-formation complex at the PAS, the isolation membrane sequesters ... Schematic representation of the endosomal system, autophagy and the Cvt pathway in yeast Key trafficking pathways within the endosomal system, autophagy and the Cvt pathway are indicated Tlg2 localises...
- 220
- 267
- 0
ORCHESTRATING FEAR RESPONSES IN LARVAL ZEBRAFISH a ROLE FOR THE HABENULA
... expression The dorsal habenula in zebrafish is homologous to the mammalian medial habenula, while the ventral habenula is homologous to the mammalian lateral habenula (Amo et al., 2010) In the KR11 ... noradrenergic fibers to the medial and lateral habenula from the ventral PAG, as well as serotonergic innervations to medial and lateral habenula from the median raphe, and dopaminergic innervations ... in Larval Zebrafish: A Role for the Habenula What is fear, and why is it vital to physical and mental well-being? Fear is a primal emotion that has evolved to enable animals to deal with danger...
- 84
- 316
- 0
Báo cáo y học: " Angiotensin-converting enzyme 2 autoantibodies: further evidence for a role of the renin– angiotensin system in inflammation" potx
... mechanism to alter the balance of the renin–angiotensin system to favor the ACE2– Ang-(1–7)–AT7 receptor axis and promote the antifibrotic and anti-inflammatory actions of the heptapeptide, as well ... renin–angiotensin system and inflammatory events [5] Pre-eclampsia is associated with circulating autoantibodies against the AT1 protein that act as functional receptor agonists to promote vasoconstriction and ... blockade or ACE inhibition ameliorated the autoimmune inflammation [7] The present findings by Takahashi and colleagues reveal increased expression of circulating ACE2 in patients with vasculopathy utilizing...
- 2
- 364
- 0
Báo cáo khoa học: "QARLA:A Framework for the Evaluation of Text Summarization Systems" pdf
... measure x, if a is more distant to all manual summaries than a , then a cannot be better than a Formally: ∀m ∈ M.x (a, m) < x (a , m) → QM,x (a) ≤ QM,x (a ) values), and is inspired in the QARLA ... should have KM ,A (x) = 3.1 QARLA evaluation framework QUEEN: Estimation of the quality of an automatic summary We are now looking for a function QM,x (a) that estimates the quality of an automatic ... test-bed is reliable (JACK measure) Formal constraints on any evaluation framework based on similarity metrics We are looking for a framework to evaluate automatic summarisation systems objectively...
- 10
- 517
- 0
báo cáo hóa học: " Replication of the association of HLA-B7 with Alzheimer''''s disease: a role for homozygosity?" pptx
... performed the HLA genotyping; DRW isolated the DNA and performed the APOE genotyping; LB supplied all the background data on the OPTIMA cohort; DJL was responsible for the data analysis and drafted ... many years and to the staff of OPTIMA for their contribution to this project We thank MG Lehmann for help with the data analysis We are most grateful to Dr Abderrahim Oulhaj for advice on statistics ... S, Yamaoka LH, Farrer LA, Auerbach SH, Saunders AM, Roses AD, Haines JL, Pericak-Vance MA: No association between the HLA -A2 allele and Alzheimer disease Neurogenetics 1999, 2:177-182 Lehmann DJ,...
- 7
- 286
- 0
báo cáo hóa học: " A role for DNA-dependent activator of interferon regulatory factor in the recognition of herpes simplex virus type 1 by glial cells" pot
... [21,23,24] After incubation with a rabbit polyclonal antibody against DAI (Abcam, Cambridge, MA), RIP3 (Abcam, Cambridge, MA), STING (Abcam, Cambridge, MA) or a mouse monoclonal antibody against gG1 (Abnova, ... Rintahaka J, Søby S, Horan KA, Poltajainen A, Østergaard L, Paludan SR, Matikainen S: Early innate recognition of herpes simplex virus in human primary macrophages is mediated via the MDA5/MAVSdependent ... HSV-1 and elicit inflammatory CNS damage Replicating DNA viruses generate genomic DNA that serves as a ligand for DAI DAI then associates with IPS-1 and STING, subsequently activating NF-kB via the...
- 12
- 529
- 0
Báo cáo hóa học: "Occupational medical prophylaxis for the musculoskeletal system: A function-oriented system for physical examination of the locomotor system in occupational medicine (fokus(C))" potx
... practical experience and the limited time allowed for occupational medical examinations speak for a systematic subdivision of the physical examination into a screening phase and, based on the ... indication but at prevention From the large number of available validated tests for function of the locomotor system a selection was made intentionally and on the basis that the tests are readily ... revising the manuscript critically All authors have read and approved the final manuscript An English version of the anamnesis is not yet available at present but is being prepared for submittal to...
- 10
- 575
- 0
Báo cáo y học: "Autoantibody profile in systemic lupus erythematosus with psychiatric manifestations: a role for anti-endothelial-cell antibodies" docx
... Houssiau FA, Ramirez G, Baguley E, McCutcheon J, Vianna J, Haga HJ, Swana GT, Khamashta MA, Taylor JC: Antibodies to endothelial cells in systemic lupus erythematosus: a potential marker for nephritis ... Ainiala H, Hietaharju A, Loukkola J, Peltola J, Korpela M, Metsanoja R, Auvinen A: Validity of the new American College of Rheumatology criteria for neuropsychiatric lupus syndromes: a population-based ... in accordance with the criteria of the American Rheumatism Association [25] ELISA for anti-glial fibrillar acidic protein Human glial fibrillary acidic protein (GFAP) purified from human brain...
- 7
- 431
- 0
Báo cáo y học: " Tumour necrosis factor-α stimulates dehydroepiandrosterone metabolism in human fibroblast-like synoviocytes: a role for nuclear factor-κB and activator protein-1 in the regulation of expression of cytochrome p450 enzyme 7b" doc
... primers (Pharmacia, Woerden, The Netherlands) and reverse transcriptase (Pharmacia) For reverse transcription PCR, human Cyp7b sense (GTCCTGGAGAAATATTATGTGCAG) and antisense (CGCACACAGTAGTCCCCGG) ... washed with PBS and total RNA was extracted with RNAzol (Campro, Veenendaal, The Netherlands) cDNA synthesis was done according to the manufacturer's protocol using random hexamer primers (Pharmacia, ... the nuclear translocation of the transcription factors AP-1, NFAT and STAT1 in Jurkat T cells stimulated with IFN-γ or phorbol myristate acetate (PMA) as well R1277 Arthritis Research & Therapy...
- 10
- 462
- 0
báo cáo khoa học: " Bridging the gap between basic science and clinical practice: a role for community clinicians" pptx
... information that would help them gauge the quantitative and qualitative value of their participation in studies A clinical trial registry would also provide a venue for sharing trial data among ... Newberry for editorial assistance and Nancee Inouye for research assistance associated with the project Author details RAND Health, Santa Monica, California, USA 2Department of Medicine, David Geffen ... Clinicians working with their patients can facilitate meaningful quality assurance practices related to patient inclusion and exclusion, to data gathering, and to a nuanced awareness of the fidelity...
- 11
- 460
- 0
Retrovirology Research BioMed Central Open Access A role for CD81 on the late steps of HIV-1 pdf
... possesses an interacting motif with the adaptor AP-3 protein, is mainly targeted to the endocytic pathway [24] while most of the other tetraspanins are found both at the plasma membrane and in intracellular ... immunoblotting and for the presence of tetraspanins and other cellular proteins as already described Reverse Transcriptase assay RT activity of viral immunoprecipitated supernatant was measured using the ... surface tetraspanin inaccessibility after treatment of MOLT/HIV-1 cells with the anti-tetraspanin antibodies was evaluated by FACS analysis The histograms present the surface staining of untreated...
- 16
- 343
- 0
Báo cáo y học: " A method for the generation of standardized qualitative dynamical systems of regulatory networks" doc
... paragraph, the equations have the same qualitative shape for any value assigned to the parameters Hence, for the sake of simplicity, it is possible to assign the same values to most of the parameters, ... logical analysis to find all the steady states of the system [15] Generalized logical analysis allows us to find all the steady states of a discrete dynamical system by evaluating the functionality ... resulting system, the modeler may modify the values of the parameters so as to fine-tune the dynamical behavior of the equations, whenever more experimental quantitative data become available The continuous...
- 18
- 288
- 0
Báo cáo y học: "Genomic neighborhoods for Arabidopsis retrotransposons: a role for targeted integration in the distribution of the Metaviridae" docx
... element abundance in A thaliana Wright et al [33] examined recombination rate relative to element abundance in detail and found that the abundance of most A thaliana TE families actually had a small ... RetroMap-generated datafile was used as the data source for statistical testing The data file contains chromosomal element coordinates, LTR identity, age and lineage information for all A thaliana ... that of the Pseudoviridae than to the mean lengths of the Athila and Tat lineages The Pseudoviridae are also more uniformly sized than the Metaviridae A second factor contributing to the abundance...
- 16
- 304
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25