tissue banking a new role for the transfusion service

Tài liệu VIRTUAL REALITY - A NEW TECHNOLOGY FOR THE MECHANICAL ENGINEER docx

Tài liệu VIRTUAL REALITY - A NEW TECHNOLOGY FOR THE MECHANICAL ENGINEER docx

... the input component on a PC is that there are a wide variety of devices available for the PC platform, as opposed to the UNIX platform This also has an important practical advantage in that a ... the lack of software that exploits the advantages of this new generation of devices Thus, the user interface for CAD programs has remained essentially the mouse/keyboard/menu paradigm The availability ... orientation tracking of a user's head and/or hand These data are then used to update the virtual world scene The tracker is sometimes also used to track the user's hand position (usually wearing a...

Ngày tải lên: 23/01/2014, 07:20

10 634 1
báo cáo hóa học:" Tuberculosis and HIVNeeded: A New Paradigm for the Control and Management of Linked Epidemics" pot

báo cáo hóa học:" Tuberculosis and HIVNeeded: A New Paradigm for the Control and Management of Linked Epidemics" pot

... current paradigm and a proposed alternative paradigm The current common paradigm is characterized by separate and distinct programs with little coordination or overlap The alternate paradigm emphasizes ... at the healthcare delivery level in urban and rural areas have been carried out or are ongoing In Rwanda, integration of TB and HIV services at a district hospital increased HIV counselling and ... highly encouraging while at the same time their examples highlight the technical, programmatic, staffing and scale-up challenges that remain and demonstrate that although broad program principles...

Ngày tải lên: 20/06/2014, 08:20

5 470 0
báo cáo hóa học:" Research Article A New Technique for the Digitization and Restoration of Deteriorated Photographic Negatives" pptx

báo cáo hóa học:" Research Article A New Technique for the Digitization and Restoration of Deteriorated Photographic Negatives" pptx

... has created an urgent need for a technique that can capture the information in each of the negatives of a large collection before the damage causes a complete and irretrievable loss of information ... for each one (Figure 5) For each pixel, the intensity values are normalized to one, and the scale factor, the Gaussian amplitude α, is saved as the attenuation factor for that pixel Then a nonlinear ... vertical Gaussian stripes The initial pass is captured with only the display device in the scene to acquire a base case for the Gaussian parameters σ and X0 The next pass of the stripes is captured...

Ngày tải lên: 21/06/2014, 20:20

13 569 0
Báo cáo khoa học: "A new method for the histochemical localization of laccase in Rhus verniciflua Stokes" docx

Báo cáo khoa học: "A new method for the histochemical localization of laccase in Rhus verniciflua Stokes" docx

... the present paper may be used to bridge these gaps In the lacquer tree, laccase may play a role in sealing-off damaged tissue It could also be involved in a defense mechanism against pathogens by ... laccase catalysis is mainly distributed in the canals and their sheath cells, epithelial cells and the ducts with latex droplets In the control section, almost no deposit can be seen in the canals ... significant features of laccase in Rhus species The brown deposit in the sections indicates the localization of active laccase in situ Activity of laccase is also stimulated by its natural substrate...

Ngày tải lên: 09/08/2014, 03:24

4 355 0
Báo cáo y học: "A new approach for the large-scale generation of mature dendritic cells from adherent PBMC using roller bottle technology" ppt

Báo cáo y học: "A new approach for the large-scale generation of mature dendritic cells from adherent PBMC using roller bottle technology" ppt

... without fixation Immediately before FACS analysis µg/ml 7-ADD was added as viability indicator The dot plots shown the total cells in the floating fractions with the CD83+, 7-AAD- and CD83+, 7-AAD+ ... surface area used during the loading process in the bottles allows the monocytes to roll along and stay in close contact with the surface and then eventually attach This is akin to the attachment ... from the original DC donor were also used as stimulators as a control The average cpm and standard deviation of triplicate cultures are shown for each stimulator type static flasks In both cases,...

Ngày tải lên: 11/08/2014, 10:23

11 469 0
báo cáo khoa học: " A new model for the characterization of infection risk in gunshot injuries:Technology, principal consideration and clinical implementation" pptx

báo cáo khoa học: " A new model for the characterization of infection risk in gunshot injuries:Technology, principal consideration and clinical implementation" pptx

... of barium titanate particles in the temporary cavity The radiological examination of the infiltration depth of barium titanate particles within the ruptures of a temporary cavity in the gelatin ... Yoganandan N, Pintar FA, Kumaresan S, Maiman DJ, Hargarten SW: Dynamic analysis of penetrating trauma J Trauma 1997, 42:266-72 Yetiser S, Kahramanyol M: High-velocity gunshot wounds to the head ... of the temporary cavity and the infiltration depth of the barium titanate particles In contrast to this, the infiltration depth of barium titanate particles in the case of the full metal jacket...

Ngày tải lên: 11/08/2014, 20:21

5 574 0
Báo cáo sinh học: " Jane: a new tool for the cophylogeny reconstruction problem" ppt

Báo cáo sinh học: " Jane: a new tool for the cophylogeny reconstruction problem" ppt

... the graphical user interface but can be set in the command-line version of Jane Values of these parameters were systematically evaluated and the best values found are used as defaults Jane can ... in either Tarzan or a Nexusbased format A file must specify the host and parasite trees and the tip associations Optionally, the file can specify time zones or time zone ranges as well as regions ... process is repeated and nodes b and c are placed in times and Table shows the table at this point Now, d and f are candidates for time In general, the algorithm chooses the candidate whose time...

Ngày tải lên: 12/08/2014, 17:20

10 551 0
Báo cáo y học: "Green tea: a new option for the prevention or control of osteoarthritis" ppt

Báo cáo y học: "Green tea: a new option for the prevention or control of osteoarthritis" ppt

... treatment approach for OA, and agents such as GTPs could fill the gap In fact, complete deletion of the Il1b gene leads to disease exacerbation in a mouse model of OA, suggesting both a catabolic ... radiation-induced inflammation-associated skin diseases including skin cancers [9,10] The physician and the patients want to understand the real targets and mechanism of action of GTPs that lead to the prevention ... Proc Natl Acad Sci U S A 1999, 96:4524-4529 Ahmed S, Rahman A, Hasnain A, Lalonde M, Goldberg VM, Haqqi TM: Green tea polyphenol epigallocatechin-3-gallate inhibits the IL-1β-induced activity and...

Ngày tải lên: 12/08/2014, 17:22

2 338 0
Báo cáo y học: " Host-virus interaction: a new role for microRNAs" pdf

Báo cáo y học: " Host-virus interaction: a new role for microRNAs" pdf

... (shRNAs) can saturate the RNA interference machinery [17] This would have far reaching implications on determining dosage of artificial microRNAs for therapeutics as well as for experimental research ... microRNAs can act as a trans-acting element for reversible and dynamic regulation of spatial and temporal protein expression Computational tools for discovery of microRNA and their targets Computational ... Curiously, the expression of the viral microRNAs did not have any untoward effect on the viral replication Further analysis revealed that the microRNAs had near perfect complementary matches in the early...

Ngày tải lên: 13/08/2014, 09:20

9 340 0
Báo cáo y học: "Inhaled activated protein C: a new therapy for the prevention of ventilator-induced lung injury" docx

Báo cáo y học: "Inhaled activated protein C: a new therapy for the prevention of ventilator-induced lung injury" docx

... whether inhaled APC can prevent or minimize primary or secondary lung damage when low tidal volumes are used for mechanical ventilation Abbreviations APC, activated protein C; ERK, extracellular-regulated ... treatment with APC was started before the initiation of injurious ventilation Therefore, it remains unknown at present whether inhaled APC would be beneficial if initiated after the lungs have ... protein C ameliorates endotoxin-induced lung injury in anaesthetised sheep Crit Care 2009, 13:R51 Kotanidou A, Loutrari H, Papadomichelakis E, Glynos C, Magkou C, Armaganidis A, Papapetropoulos A, Roussos...

Ngày tải lên: 13/08/2014, 20:21

2 391 0
Báo cáo y học: "A genome wide analysis of the response to uncapped telomeres in budding yeast reveals a novel role for the NAD+ biosynthetic gene BNA2 in chromosome end protection" doc

Báo cáo y học: "A genome wide analysis of the response to uncapped telomeres in budding yeast reveals a novel role for the NAD+ biosynthetic gene BNA2 in chromosome end protection" doc

... measurements Table Primers for Q RT-PCR Primer Alias Sequence 1082 ACT1F GCCTTCTACGTTTCCATCCA 1083 ACT1R GGCCAAATCGATTCTCAAAA 1367 PAC2F AATAACGAATTGAGCTATGACACCAA 1368 PAC2R AGCTTACTCATATCGATTTCATACGACTT ... GTAACCAGTACGAAAAAAGATA CATTT 1165 MSC1F TCTTCGGATCACCCAGTTTC 1278 NPT1 5' 1166 MSC1R G AAGCCTTAGCGTCGTCAAC CATTGTGATTTTATTCAATGTTT CTTT 1084 CTT1F AAAGAGTTCCGGAGCGTGTA 1279 NPT1 3' CAGGGTGTGGAAGAACAGGT ... contributions AG designed and carried out the majority of the experiments, analyzed the data and drafted and edited the manuscript GL, DCS, and DJW processed and analyzed array data KJ and AW carried...

Ngày tải lên: 14/08/2014, 21:20

17 432 0
THAI FUNERAL RITE RITUAL PROCESS TO CREATE a NEW LIFE FOR THE DEAD (THAI FUNERAL IN PHU YEN, SON LA)

THAI FUNERAL RITE RITUAL PROCESS TO CREATE a NEW LIFE FOR THE DEAD (THAI FUNERAL IN PHU YEN, SON LA)

... to the sorcerer They have to take meal before the dead so as they are capable for taking the dead to go away Apart from introduction, inviting to take meal and ending like other chants, there are ... Whenever a funeral tray is arranged, another tray for tay of the sorcerer, or the tum is also prepared After that food trays for the whole funeral are prepared 2.3.6 Digging grave The funeral family ... take a bath before coming back home since attending a funeral relates to the death” To prevent any undesirable effects, the funeral attendants drive away all the bad and the dirty in the water...

Ngày tải lên: 18/05/2016, 07:42

27 434 0
developing a marketing plan for the keywordz service of gapit communication joint-stock company

developing a marketing plan for the keywordz service of gapit communication joint-stock company

... colected and analyzed, used as secondary data In addition, informations about Gapit in my thesis is experienced after I worked for Keywordz department as Asistant, product and contract management ... Methodology Analysis and Generalization : The information in the thesis was analyed and created by a number of documents and records of electronic marketing, digital marketing, concepts and ideas of planned ... capture and retain positions in identified markets The marketing plan can and should be an essential document for organizational success The marketing plan is also an operational document that...

Ngày tải lên: 08/01/2015, 12:41

87 539 0
The future of finance a new model for banking and investment

The future of finance a new model for banking and investment

... Too-Big-to-Fail Bank, Moral Hazard, and Macroprudential Regulation Banks and Moral Hazard Addressing Too-Big-to-Fail: Mitigating Moral Hazard Risk Macroprudential Regulation: Regulating Bank Systemic ... they can avoid its impact altogether The financial crash and its aftermath have already been covered extensively in the literature Academics, practitioners, and journalists have provided the market ... a longer term perspective at the causal factors behind the crash, and this has paid off in the value and tractability of their policy recommendations They point out the paradox of financial markets:...

Ngày tải lên: 30/10/2014, 16:18

227 509 2
Tài liệu The Book Of Personal Transformation - How To Use Ancient Wisdom To Create A New Life For Yourself docx

Tài liệu The Book Of Personal Transformation - How To Use Ancient Wisdom To Create A New Life For Yourself docx

... poem like a mantra as often as I can remember: Thank you for the abundance, Thank you for the wealth; Thank you for all the happiness, Protections and Good Health Repeat this mantra consistently ... what they visualised in their lives AFFIRMATIONS Jeff Staniforth, the creator of Sculptor 3, an amazing software that can make affirmations work for anyone, has this to say about affirmations: “By ... thoughts and mental imprints Before sleep, these: A Recite this poem of gratitude and abundance “Thank you for the abundance, Thank you for the wealth; Thank you for all the happiness, Protection and...

Ngày tải lên: 15/12/2013, 06:15

59 771 3
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

... GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products ... the wild-type SV40T Ag and the 3¢ portion of the tsA58T Ag cDNA carrying the A4 38V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ ... Dong QG, Bernasconi S, Lostaglio S, De Calmanovici RW, Martin-Padura I, Breviario F, Garlanda C, Ramponi S, Mantovani A & Vecchi A (1997) A general strategy for isolation of endothelial cells from...

Ngày tải lên: 18/02/2014, 17:20

11 874 0
Tài liệu Báo cáo khoa học: The most C-terminal tri-glycine segment within the polyglycine stretch of the pea Toc75 transit peptide plays a critical role for targeting the protein to the chloroplast outer envelope membrane ppt

Tài liệu Báo cáo khoa học: The most C-terminal tri-glycine segment within the polyglycine stretch of the pea Toc75 transit peptide plays a critical role for targeting the protein to the chloroplast outer envelope membrane ppt

... (residues 91–100) WT polyAla AGG GAG GGA GAA AGA AAG GGD GGE GGL GGN GGS GGP GGGAGGGGGG *SA*AAAAA* AAA******* ****AAA*** *******AAA ****AAAAAA AAA****AAA AAA*AAA*** *******DDD *******EEE *******LLL ... FEBS A J Baldwin and K Inoue 21 22 23 24 tion apparatus, faces the stromal compartment J Biol Chem 273, 16583–16588 Gunasekaran K, Nagarajaram HA, Ramakrishnan C & Balaram P (1998) Stereochemical ... generate constructs for mutants GGA, GGE, GGL, GGN, GGD, GGS, and GGP cDNA sequences for GAA and AGA mutants were prepared using a plasmid encoding GGA as a template and primers that anneal to...

Ngày tải lên: 19/02/2014, 07:20

9 497 0
Tài liệu Báo cáo khoa học: A role for the intersubunit disulfides of seminal RNase in the mechanism of its antitumor action docx

Tài liệu Báo cáo khoa học: A role for the intersubunit disulfides of seminal RNase in the mechanism of its antitumor action docx

... outside the cells, before internalization, we investigated the role of plasma membranes (PM) in the transformation of MSSAE into a dimeric protein 125I-labelled MSSAE was incubated with isolated ... that the cell sulfhydryls responsible for the exchange with the protein disuldes are located in the plasma membrane Furthermore, they show that, as proposed in the hypothesis above, the RNase ... with the tight pestle of a Dounce homogenizer The homogenate was centrifuged at 1000 g for 10 and the supernatant was centrifuged at 16 000 g for 30 The pellet, representing the plasma membrane...

Ngày tải lên: 20/02/2014, 11:20

8 605 0
Báo cáo khoa học: New evidence for the role of calcium in the glycosidase reaction of GH43 arabinanases pot

Báo cáo khoa học: New evidence for the role of calcium in the glycosidase reaction of GH43 arabinanases pot

... including arabinan, arabinoxylan and arabinogalactan [6,7] ABNs attack the glycosidic bonds of the a- 1,5-l-arabinan backbone, releasing a mixture of arabinooligosaccharides and larabinose [4] These ... significant amounts in homopolysaccharides, branched and de-branched arabinans, and heteropolysaccharides such as arabinoxylans and arabinogalactans Arabinan is composed of a- 1,5-linked l-arabinofuranosyl ... degradation: redesigning the exo ⁄ endo preference of Cellvibrio japonicus arabinanase 4 3A Proc Natl Acad Sci USA 102, 2697–2702 Yamaguchi A, Tada T, Wada K, Nakaniwa T, Kitatani T, Sogabe Y, Takao...

Ngày tải lên: 15/03/2014, 23:20

13 568 0
Báo cáo khoa học: "Parsing the Internal Structure of Words: A New Paradigm for Chinese Word Segmentation" doc

Báo cáo khoa học: "Parsing the Internal Structure of Words: A New Paradigm for Chinese Word Segmentation" doc

... Innovative applications of artificial intelligence, AAAI’97/IAAI’97, pages 598–603 AAAI Press Michael Collins and Terry Koo 2005 Discriminative reranking for natural language parsing Computational ... to adapt the part-of-speech tags to facilitate this modeling strategy For example, the tag for nouns is NN as in 憞䠮䞎 ‘Iraq’ and 卣敯埚 ‘former president’ After annotation, the former is flat, but the ... some applications such as information extraction, the former segmentation is adequate, while for others like machine translation, the later finer-grained output is more preferable If the analyzer...

Ngày tải lên: 17/03/2014, 00:20

10 476 0
w