a role for the cerebellum

Tài liệu Báo cáo khoa học: A role for the intersubunit disulﬁdes of seminal RNase in the mechanism of its antitumor action docx

... outside the cells, before internalization, we investigated the role of plasma membranes (PM) in the transformation of MSSAE into a dimeric protein 125I-labelled MSSAE was incubated with isolated ... that the cell sulfhydryls responsible for the exchange with the protein disuldes are located in the plasma membrane Furthermore, they show that, as proposed in the hypothesis above, the RNase ... with the tight pestle of a Dounce homogenizer The homogenate was centrifuged at 1000 g for 10 and the supernatant was centrifuged at 16 000 g for 30 The pellet, representing the plasma membrane...

8
604
0

A Role for the International Criminal Court in the Fight against Terrorism? potx

Danh mục: Quản lý nhà nước

... The Institute for International Law of the K.U.Leuven groups the teaching and research in public international law and the law of international organisations at the Faculty of Law of the ... in the aftermath of the September 11 Events, one of the reasons for the Taliban regime not to extradite Osama bin Laden to the United States, was probably the Taliban’s belief that Osama bin Laden ... facts to a Trial Chamber for eventual trial.90 101 Before it can reach a decision, the Pre-Trial Chamber organizes a hearing at which the Prosecutor and the accused may present their case91 The Pre-Trial...

53
449
1

Báo cáo y học: "A case-control study of rheumatoid arthritis identifies an associated single nucleotide polymorphism in the NCF4 gene, supporting a role for the NADPH-oxidase complex in autoimmunity" doc

Danh mục: Báo cáo khoa học

... investigator for the project and has carried out SNP selection, genotype preparation, statistical analyses and drafted the manuscript A- KL participated in the design of the study and the statistical analyses ... analyses are truly independent The allele frequencies of the SNPs are affected by the LD of the region, and the stratified analyses are based on the same SNPs and samples as the initial analysis and ... make NCF1 and the other genes of the NOX complex candidate genes for human RA However, transferring animal data to the human setting is not straightforward in this case In contrast to rats, the...

11
475
0

Báo cáo y học: "A role for the histone deacetylase HDAC4 in the life-cycle of HIV-1-based vectors" ppsx

Danh mục: Báo cáo khoa học

... that the formation of these foci is dependent on active retroviral integrase, and HDAC4, but not HDAC2 and HDAC6, associates with viral DNA Taken together, these data indicate that HDAC4 plays ... presence of the 85kDa PARP fragment, an apoptotic marker generated by caspase-mediated cleavage of the PARP protein [30] As shown in Fig 8, ATM inhibition and infection stimulated PARP cleavage However, ... with the HIV-1based vector DNA was extracted days post-infection and analyzed by Alu-PCR (see “Experimental Procedures”) +Alu - DNA was analyzed using Alu-PCR, -Alu - a negative control, the Alu...

10
386
0

Báo cáo khoa học:" A role for the JAK-STAT1 pathway in blocking replication of HSV-1 in dendritic cells and macrophages" docx

Danh mục: Cao đẳng - Đại học

... 5'-CCTCGCCGGCAACAAAA-3'; and probe, 5'-FAM-CTCCAGGCGGACTTC-3' – Amplicon length = 59 bp; and 4) gB: forward primer, 5'AACGCGACGCACATCAAG-3', reverse primer, 5'-CTGGTACGCGATCAGAAAGC-3'; and probe, 5'-FAMCAGCCGCAGTACTACC-3' ... replication, viral gB mRNA, and viral genomic DNA in macrophages was done as in Fig for DCs Panel A Virus replication, n = 12 Panel B gB mRNA, n = Panel C Viral genomic DNA, n = The results are the ... Cunningham AL, Carbone F, Geijtenbeek TB: Langerhans cells and viral immunity Eur J Immunol 2008, 38:2377-2385 Cella M, Salio M, Sakakibara Y, Langen H, Julkunen I, Lanzavecchia A: Maturation, activation,...

13
266
0

Báo cáo khoa học: " A role for the JAK-STAT1 pathway in blocking replication of HSV-1 in dendritic cells and macrophages" pps

Danh mục: Báo cáo khoa học

... 5'-CCTCGCCGGCAACAAAA-3'; and probe, 5'-FAM-CTCCAGGCGGACTTC-3' – Amplicon length = 59 bp; and 4) gB: forward primer, 5'AACGCGACGCACATCAAG-3', reverse primer, 5'-CTGGTACGCGATCAGAAAGC-3'; and probe, 5'-FAMCAGCCGCAGTACTACC-3' ... replication, viral gB mRNA, and viral genomic DNA in macrophages was done as in Fig for DCs Panel A Virus replication, n = 12 Panel B gB mRNA, n = Panel C Viral genomic DNA, n = The results are the ... Cunningham AL, Carbone F, Geijtenbeek TB: Langerhans cells and viral immunity Eur J Immunol 2008, 38:2377-2385 Cella M, Salio M, Sakakibara Y, Langen H, Julkunen I, Lanzavecchia A: Maturation, activation,...

13
468
0

a role for the endosomal snare complex and tethers in autophagy

Danh mục: Tổng hợp

... Atg13 (Kabeya et al., 2005) Furthermore, complex formation between Atg17-Atg29Atg31 and Atg1-Atg13 is required for Atg1 kinase activity and thereby autophagy (Kamada et al., 2000; Kabeya et al., ... suggestive of a role for the ER in autophagosome formation in mammalian cells (Yla-Anttila et al., 2009) Following the organisation of the vesicle-formation complex at the PAS, the isolation membrane sequesters ... glucagon-mediated 1.1.2 Functional significance of autophagy Autophagy is an evolutionary conserved and adaptive catabolic process that plays a central role in maintaining intracellular homeostasis and thereby...

220
267
0

ORCHESTRATING FEAR RESPONSES IN LARVAL ZEBRAFISH a ROLE FOR THE HABENULA

Danh mục: Cao đẳng - Đại học

... to the medial and lateral habenula from the ventral PAG, as well as serotonergic innervations to medial and lateral habenula from the median raphe, and dopaminergic innervations to the lateral ... expression The dorsal habenula in zebrafish is homologous to the mammalian medial habenula, while the ventral habenula is homologous to the mammalian lateral habenula (Amo et al., 2010) In the KR11 ... in Larval Zebrafish: A Role for the Habenula What is fear, and why is it vital to physical and mental well-being? Fear is a primal emotion that has evolved to enable animals to deal with danger...

84
316
0

báo cáo hóa học: " Replication of the association of HLA-B7 with Alzheimer''''s disease: a role for homozygosity?" pptx

Danh mục: Hóa học - Dầu khí

... performed the HLA genotyping; DRW isolated the DNA and performed the APOE genotyping; LB supplied all the background data on the OPTIMA cohort; DJL was responsible for the data analysis and drafted ... many years and to the staff of OPTIMA for their contribution to this project We thank MG Lehmann for help with the data analysis We are most grateful to Dr Abderrahim Oulhaj for advice on statistics ... S, Yamaoka LH, Farrer LA, Auerbach SH, Saunders AM, Roses AD, Haines JL, Pericak-Vance MA: No association between the HLA -A2 allele and Alzheimer disease Neurogenetics 1999, 2:177-182 Lehmann DJ,...

7
286
0

báo cáo hóa học: " A role for DNA-dependent activator of interferon regulatory factor in the recognition of herpes simplex virus type 1 by glial cells" pot

Danh mục: Hóa học - Dầu khí

... [21,23,24] After incubation with a rabbit polyclonal antibody against DAI (Abcam, Cambridge, MA), RIP3 (Abcam, Cambridge, MA), STING (Abcam, Cambridge, MA) or a mouse monoclonal antibody against gG1 (Abnova, ... Rintahaka J, Søby S, Horan KA, Poltajainen A, Østergaard L, Paludan SR, Matikainen S: Early innate recognition of herpes simplex virus in human primary macrophages is mediated via the MDA5/MAVSdependent ... HSV-1 and elicit inflammatory CNS damage Replicating DNA viruses generate genomic DNA that serves as a ligand for DAI DAI then associates with IPS-1 and STING, subsequently activating NF-kB via the...

12
529
0

Báo cáo y học: " Tumour necrosis factor-α stimulates dehydroepiandrosterone metabolism in human fibroblast-like synoviocytes: a role for nuclear factor-κB and activator protein-1 in the regulation of expression of cytochrome p450 enzyme 7b" doc

Danh mục: Báo cáo khoa học

... primers (Pharmacia, Woerden, The Netherlands) and reverse transcriptase (Pharmacia) For reverse transcription PCR, human Cyp7b sense (GTCCTGGAGAAATATTATGTGCAG) and antisense (CGCACACAGTAGTCCCCGG) ... washed with PBS and total RNA was extracted with RNAzol (Campro, Veenendaal, The Netherlands) cDNA synthesis was done according to the manufacturer's protocol using random hexamer primers (Pharmacia, ... the nuclear translocation of the transcription factors AP-1, NFAT and STAT1 in Jurkat T cells stimulated with IFN-γ or phorbol myristate acetate (PMA) as well R1277 Arthritis Research & Therapy...

10
462
0

báo cáo khoa học: " Bridging the gap between basic science and clinical practice: a role for community clinicians" pptx

Danh mục: Báo cáo khoa học

... information that would help them gauge the quantitative and qualitative value of their participation in studies A clinical trial registry would also provide a venue for sharing trial data among ... Newberry for editorial assistance and Nancee Inouye for research assistance associated with the project Author details RAND Health, Santa Monica, California, USA 2Department of Medicine, David Geffen ... Clinicians working with their patients can facilitate meaningful quality assurance practices related to patient inclusion and exclusion, to data gathering, and to a nuanced awareness of the fidelity...

11
460
0

Báo cáo y học: " Angiotensin-converting enzyme 2 autoantibodies: further evidence for a role of the renin– angiotensin system in inflammation" potx

Danh mục: Báo cáo khoa học

... to alter the balance of the renin–angiotensin system to favor the ACE2– Ang-(1–7)–AT7 receptor axis and promote the antiﬁbrotic and anti-inﬂammatory actions of the heptapeptide, as well as attenuate ... and inﬂammatory events [5] Pre-eclampsia is associated with circulating autoantibodies against the AT1 protein that act as functional receptor agonists to promote vasoconstriction and inﬂammation ... inhibition ameliorated the autoimmune inﬂammation [7] The present ﬁndings by Takahashi and colleagues reveal increased expression of circulating ACE2 in patients with vasculopathy utilizing a novel...

2
364
0

Retrovirology Research BioMed Central Open Access A role for CD81 on the late steps of HIV-1 pdf

Danh mục: Báo cáo khoa học

... possesses an interacting motif with the adaptor AP-3 protein, is mainly targeted to the endocytic pathway [24] while most of the other tetraspanins are found both at the plasma membrane and in intracellular ... immunoblotting and for the presence of tetraspanins and other cellular proteins as already described Reverse Transcriptase assay RT activity of viral immunoprecipitated supernatant was measured using the ... surface tetraspanin inaccessibility after treatment of MOLT/HIV-1 cells with the anti-tetraspanin antibodies was evaluated by FACS analysis The histograms present the surface staining of untreated...

16
343
0

Báo cáo y học: "A role for adrenomedullin in the pathogenesis of alveolar edema" pdf

Danh mục: Báo cáo khoa học

...

1
399
0

Báo cáo y học: "Genomic neighborhoods for Arabidopsis retrotransposons: a role for targeted integration in the distribution of the Metaviridae" docx

Danh mục: Báo cáo khoa học

... element abundance in A thaliana Wright et al [33] examined recombination rate relative to element abundance in detail and found that the abundance of most A thaliana TE families actually had a small ... RetroMap-generated datafile was used as the data source for statistical testing The data file contains chromosomal element coordinates, LTR identity, age and lineage information for all A thaliana ... that of the Pseudoviridae than to the mean lengths of the Athila and Tat lineages The Pseudoviridae are also more uniformly sized than the Metaviridae A second factor contributing to the abundance...

16
304
0

Báo cáo y học: "A genome wide analysis of the response to uncapped telomeres in budding yeast reveals a novel role for the NAD+ biosynthetic gene BNA2 in chromosome end protection" doc

Danh mục: Báo cáo khoa học

... measurements Table Primers for Q RT-PCR Primer Alias Sequence 1082 ACT1F GCCTTCTACGTTTCCATCCA 1083 ACT1R GGCCAAATCGATTCTCAAAA 1367 PAC2F AATAACGAATTGAGCTATGACACCAA 1368 PAC2R AGCTTACTCATATCGATTTCATACGACTT ... GTAACCAGTACGAAAAAAGATA CATTT 1165 MSC1F TCTTCGGATCACCCAGTTTC 1278 NPT1 5' 1166 MSC1R G AAGCCTTAGCGTCGTCAAC CATTGTGATTTTATTCAATGTTT CTTT 1084 CTT1F AAAGAGTTCCGGAGCGTGTA 1279 NPT1 3' CAGGGTGTGGAAGAACAGGT ... contributions AG designed and carried out the majority of the experiments, analyzed the data and drafted and edited the manuscript GL, DCS, and DJW processed and analyzed array data KJ and AW carried...

17
432
0

A role for chondroitin sulfate proteoglycan in regulating the survival and growth of neural stem cells

Danh mục: Tổng hợp

... to the basal side during G1 phase, being at the basal side during S phase, migrating back to the apical side during G2 phase, and mitosis occurring at the apical surface (b) In radial glial cells, ... (Sugiyama-Nakagiri et al., 2006), stomach (Nagata et al., 2006) and intestine (Asai et al., 2005) Prominin-1, also known as CD133, is a glycoprotein found on the apical surface of neuroepithelial and ... neural tube The neural plate immediately above the notochord differentiates into the floorplate, whereas the neural crest emerges at the lateral margins of the neural plate (farthest from the notochord)...

226
590
0

phosphatidylserine exposure in red blood cells: a suggestion for the active role of red blood cells in blood clot formation

Danh mục: Tổng hợp

... 10 is activated and later they activate other caspases in a cascade This cascade eventually leads to the activation of the effector caspases, such as caspase and caspase These caspases are responsible ... Because the antibody against scramblase is not available at the moment, only two antibodies against scramblase and have been used for detecting the scramblases The antibody against human antigen ... types of ATPases in biological membranes: P-type ATPases, V-type ATPases, F-type ATPases, and ABC transporters [24] a) P-type ATPases (P stands for phosphorylation) have a phophorylated aspartate...

151
581
0

A role for selfgravity at multiple length scales in the process of star formation

Danh mục: Vật lý

... Supplementary Information) with a plot showing the fraction of ‘self-gravitating’ (aobs , 2) material as a function of spatial scale for both our L1448 data and for a synthetic data cube4 The simulation ... Supplementary Fig 4) clearly shows that the data and simulation appear quite different in the context of dendrogram analysis: in the simulation, nearly all material (much more than in the observations) ... over the range of Tmb (main-beam temperature) test-level values for which the virial parameter is less than The x–y locations of the four ‘selfgravitating’ leaves labelled with billiard balls are...

4
515
0