a role for the computer

phosphatidylserine exposure in red blood cells: a suggestion for the active role of red blood cells in blood clot formation

phosphatidylserine exposure in red blood cells: a suggestion for the active role of red blood cells in blood clot formation

... Kawakami, S., Kaibara, M., Kawamoto, Y., Yamanaka, K., Rheological approach to the analysis of blood coagulation in endothelial cell-coated tubes: activation of the intrinsic reaction on the erythrocyte ... 143 Acknowledgment 144 iv Abbreviations Abbreviations ABC transporter a. u aa AChE ADP AFM AM ANOVA APLT APS ATP BCECF BLAST BLASTp CCD CD cDNA CFTR DMSO EC ECL EDTA EGTA FACS FITC ... the apoptotic process Under normal conditions, they exist in zymogens In initial stage, the caspase 8 or caspase 10 is activated and later they activate other caspases in a cascade...

Ngày tải lên: 15/11/2015, 12:54

151 581 0
Innovation plays a crucial role for the success of the business

Innovation plays a crucial role for the success of the business

... a cup of cold coffee The innovation of starbucks c Management •Recruits top performers and encourages them to step up •Push back against his ideas when they don't agree innovation helps Starbucks ... quality Bad result from no innovation b Example The KAfe coffee chain in Viet Nam closed + Menu is not changed, not refresh and new + Not paying appropriate attention to the local’s taste and ... because we want to things that are unexpected and to speak to all sorts of people who are engaged in social media” – Howard Schultz The innovation of starbucks a • Technology Mobile apps : “ Pay with

Ngày tải lên: 12/09/2017, 16:13

17 393 1
PnTgs1-like expression during reproductive development supports a role for RNA methyltransferases in the aposporous pathway

PnTgs1-like expression during reproductive development supports a role for RNA methyltransferases in the aposporous pathway

... pessino@arnet.com.ar Laboratorio de Biolog? ?a Molecular, Facultad de Ciencias Agrarias, Universidad Nacional de Rosario, Parque Villarino, (S2125ZAA) Zavalla, Santa Fe, Argentina Full list of author information ... 5′-TCTGCTGAAAAAGCCCCTGGC-3′ 51.2°C F2 reverse 5′-CCTCAACCGCCCATGGAGGA-3′ 66°C F3 forward 5′-CAGGAGTTACAGATTTGGCCCTTGC-3′ 67.8°C F3 reverse 5′-GGGGTGGACCTGACTATGCTAAAG-3′ 66.3°C F4 forward 5′-AAACCCAAACGGCTAAAACC-3′ ... Natl Acad Sci U S A 2007, 104:12955–12961 38 Kapadia B, Viswakarma N, Parsa KVL, Kain V, Behera S, Suraj SK, Babu PP, Kar A, Panda S, Zhu Y, Jia Y, Thimmapaya B, Reddy JK, Misra P: ERK2-mediated

Ngày tải lên: 27/05/2020, 00:20

10 40 0
The differential anti-tumour effects of zoledronic acid in breast cancer – evidence for a role of the activin signaling pathway

The differential anti-tumour effects of zoledronic acid in breast cancer – evidence for a role of the activin signaling pathway

... (Basel, Switzerland) Primary antibodies were purchased from Santa Cruz USA (Rap 1a) , Abcam UK (GAPDH) and Cell Signaling UK Figure The canonical activin pathway Activin binds to activin type II ... synthase and reduced prenylation of small GTPases (enzymes that hydrolyze guanosine triphosphate) [5] The clinical neo-adjuvant breast cancer study, ANZAC, evaluated the biological effects of addition ... status, hypothesising it may in part be mediated via the activin signaling pathway Methods: The effects of activin A, its inhibitor follistatin and zoledronic acid on proliferation of breast cancer

Ngày tải lên: 30/09/2020, 13:50

11 14 0
A smart management system for the computer engineering lab

A smart management system for the computer engineering lab

... turns into a "loading authentication Put user’s RFID tag near RFID The RFID tag is added to the database information reader surface The "loading circle" turns into a tick with "Added" message Click ... new hardware" modal appears missing Leave out the "Hardware name" field hardware name Click "+" icon on the RFID tag field The "+" icons turn into a "loading circle" Put hardware’s RFID tag near ... FUNC_25 passcode using wrong passcode format Failure notification appears On the web interface, navigate to "Command" tab Click the "CHANGE DOOR Passcode form appears PASSCODE" title Fill in the "Current

Ngày tải lên: 03/06/2022, 11:26

83 4 0
endoplasmic reticulum stress induced apoptosis in the development of diabetes is there a role for adipose tissue and liver

endoplasmic reticulum stress induced apoptosis in the development of diabetes is there a role for adipose tissue and liver

... degradation (ERAD), and degraded by the proteasome As a major intracellular calcium storage compartment, the ER also plays a critical role towards maintenance of cellular calcium homeostasis In addition, ... this paper, there is also evidence that diabetes can induce or aggravate ER stress and thereby affect the complications of diabetes, such as renal disease, retinopathy and vascular abnormalities ... leads to activation of ASK1 and JNK, followed by apoptosis, and (3) activation of the ER localized cysteine protease, caspase 12 Caspase 12 is activated by m-Calpain in the cytoplasm Activation

Ngày tải lên: 02/11/2022, 09:29

11 1 0
opensbli a framework for the automated derivation and parallel execution of finite difference solvers on a range of computer architectures

opensbli a framework for the automated derivation and parallel execution of finite difference solvers on a range of computer architectures

... instantiated separately For the purpose of spatial discretisation, handled by the OpenSBLI SpatialDiscretisation class, an Evaluations object is created for each of the formulas, and the derivatives ... problem as a high-level, nearmathematical specification The task of taking this specification and transforming it into executable computer code can then be handled in the subsequent abstraction layer; ... backends, making the code generation technique an attractive way of future-proofing the codebase and preparing the framework for exascale-capable hardware when it arrives The main achievement

Ngày tải lên: 04/12/2022, 16:02

12 1 0
A Role for the International Criminal Court in the Fight against Terrorism? potx

A Role for the International Criminal Court in the Fight against Terrorism? potx

... The Institute for International Law of the K.U.Leuven groups the teaching and research in public international law and the law of international organisations at the Faculty of Law of the ... in the aftermath of the September 11 Events, one of the reasons for the Taliban regime not to extradite Osama bin Laden to the United States, was probably the Taliban’s belief that Osama bin Laden ... facts to a Trial Chamber for eventual trial.90 101 Before it can reach a decision, the Pre-Trial Chamber organizes a hearing at which the Prosecutor and the accused may present their case91 The Pre-Trial...

Ngày tải lên: 10/07/2014, 13:21

53 449 1
Báo cáo y học: "A case-control study of rheumatoid arthritis identifies an associated single nucleotide polymorphism in the NCF4 gene, supporting a role for the NADPH-oxidase complex in autoimmunity" doc

Báo cáo y học: "A case-control study of rheumatoid arthritis identifies an associated single nucleotide polymorphism in the NCF4 gene, supporting a role for the NADPH-oxidase complex in autoimmunity" doc

... investigator for the project and has carried out SNP selection, genotype preparation, statistical analyses and drafted the manuscript A- KL participated in the design of the study and the statistical analyses ... analyses are truly independent The allele frequencies of the SNPs are affected by the LD of the region, and the stratified analyses are based on the same SNPs and samples as the initial analysis and ... make NCF1 and the other genes of the NOX complex candidate genes for human RA However, transferring animal data to the human setting is not straightforward in this case In contrast to rats, the...

Ngày tải lên: 09/08/2014, 10:21

11 476 0
Báo cáo y học: "A role for the histone deacetylase HDAC4 in the life-cycle of HIV-1-based vectors" ppsx

Báo cáo y học: "A role for the histone deacetylase HDAC4 in the life-cycle of HIV-1-based vectors" ppsx

... that the formation of these foci is dependent on active retroviral integrase, and HDAC4, but not HDAC2 and HDAC6, associates with viral DNA Taken together, these data indicate that HDAC4 plays ... presence of the 85kDa PARP fragment, an apoptotic marker generated by caspase-mediated cleavage of the PARP protein [30] As shown in Fig 8, ATM inhibition and infection stimulated PARP cleavage However, ... with the HIV-1based vector DNA was extracted days post-infection and analyzed by Alu-PCR (see “Experimental Procedures”) +Alu - DNA was analyzed using Alu-PCR, -Alu - a negative control, the Alu...

Ngày tải lên: 12/08/2014, 01:21

10 386 0
Báo cáo khoa học:" A role for the JAK-STAT1 pathway in blocking replication of HSV-1 in dendritic cells and macrophages" docx

Báo cáo khoa học:" A role for the JAK-STAT1 pathway in blocking replication of HSV-1 in dendritic cells and macrophages" docx

... 5'-CCTCGCCGGCAACAAAA-3'; and probe, 5'-FAM-CTCCAGGCGGACTTC-3' – Amplicon length = 59 bp; and 4) gB: forward primer, 5'AACGCGACGCACATCAAG-3', reverse primer, 5'-CTGGTACGCGATCAGAAAGC-3'; and probe, 5'-FAMCAGCCGCAGTACTACC-3' ... replication, viral gB mRNA, and viral genomic DNA in macrophages was done as in Fig for DCs Panel A Virus replication, n = 12 Panel B gB mRNA, n = Panel C Viral genomic DNA, n = The results are the ... Cunningham AL, Carbone F, Geijtenbeek TB: Langerhans cells and viral immunity Eur J Immunol 2008, 38:2377-2385 Cella M, Salio M, Sakakibara Y, Langen H, Julkunen I, Lanzavecchia A: Maturation, activation,...

Ngày tải lên: 12/08/2014, 04:21

13 267 0
Báo cáo khoa học: " A role for the JAK-STAT1 pathway in blocking replication of HSV-1 in dendritic cells and macrophages" pps

Báo cáo khoa học: " A role for the JAK-STAT1 pathway in blocking replication of HSV-1 in dendritic cells and macrophages" pps

... 5'-CCTCGCCGGCAACAAAA-3'; and probe, 5'-FAM-CTCCAGGCGGACTTC-3' – Amplicon length = 59 bp; and 4) gB: forward primer, 5'AACGCGACGCACATCAAG-3', reverse primer, 5'-CTGGTACGCGATCAGAAAGC-3'; and probe, 5'-FAMCAGCCGCAGTACTACC-3' ... replication, viral gB mRNA, and viral genomic DNA in macrophages was done as in Fig for DCs Panel A Virus replication, n = 12 Panel B gB mRNA, n = Panel C Viral genomic DNA, n = The results are the ... Cunningham AL, Carbone F, Geijtenbeek TB: Langerhans cells and viral immunity Eur J Immunol 2008, 38:2377-2385 Cella M, Salio M, Sakakibara Y, Langen H, Julkunen I, Lanzavecchia A: Maturation, activation,...

Ngày tải lên: 12/08/2014, 04:21

13 468 0
a role for the endosomal snare complex and tethers in autophagy

a role for the endosomal snare complex and tethers in autophagy

... Atg13 (Kabeya et al., 2005) Furthermore, complex formation between Atg17-Atg29Atg31 and Atg1-Atg13 is required for Atg1 kinase activity and thereby autophagy (Kamada et al., 2000; Kabeya et al., ... suggestive of a role for the ER in autophagosome formation in mammalian cells (Yla-Anttila et al., 2009) Following the organisation of the vesicle-formation complex at the PAS, the isolation membrane sequesters ... glucagon-mediated 1.1.2 Functional significance of autophagy Autophagy is an evolutionary conserved and adaptive catabolic process that plays a central role in maintaining intracellular homeostasis and thereby...

Ngày tải lên: 22/12/2014, 21:44

220 267 0
ORCHESTRATING FEAR RESPONSES IN LARVAL ZEBRAFISH  a ROLE FOR THE HABENULA

ORCHESTRATING FEAR RESPONSES IN LARVAL ZEBRAFISH a ROLE FOR THE HABENULA

... to the medial and lateral habenula from the ventral PAG, as well as serotonergic innervations to medial and lateral habenula from the median raphe, and dopaminergic innervations to the lateral ... expression The dorsal habenula in zebrafish is homologous to the mammalian medial habenula, while the ventral habenula is homologous to the mammalian lateral habenula (Amo et al., 2010) In the KR11 ... in Larval Zebrafish: A Role for the Habenula What is fear, and why is it vital to physical and mental well-being? Fear is a primal emotion that has evolved to enable animals to deal with danger...

Ngày tải lên: 16/10/2015, 12:00

84 316 0
Tài liệu COMPUTER NUMERICAL CONTROL PROGRAMMING BASICS A Primer for the SkillsUSA/VICA Championships Steve docx

Tài liệu COMPUTER NUMERICAL CONTROL PROGRAMMING BASICS A Primer for the SkillsUSA/VICA Championships Steve docx

... storage matrix The advantage of the CDC feature is that it: allows the use of cutters that have been sharpened to a smaller diameter permits the use of a larger or smaller tool already in the machine’s ... information Each block should contain enough information to perform one machining operation Word Address Format Every program for any part to be machined, must be put in a 17 format that the machine ... load a program or the basics of CNC programming These students are naturally frustrated that an educational system has shortchanged them by not realizing that metalworking technology has changed...

Ngày tải lên: 25/12/2013, 05:16

51 502 1
báo cáo hóa học: " A role for DNA-dependent activator of interferon regulatory factor in the recognition of herpes simplex virus type 1 by glial cells" pot

báo cáo hóa học: " A role for DNA-dependent activator of interferon regulatory factor in the recognition of herpes simplex virus type 1 by glial cells" pot

... [21,23,24] After incubation with a rabbit polyclonal antibody against DAI (Abcam, Cambridge, MA), RIP3 (Abcam, Cambridge, MA), STING (Abcam, Cambridge, MA) or a mouse monoclonal antibody against gG1 (Abnova, ... Rintahaka J, Søby S, Horan KA, Poltajainen A, Østergaard L, Paludan SR, Matikainen S: Early innate recognition of herpes simplex virus in human primary macrophages is mediated via the MDA5/MAVSdependent ... HSV-1 and elicit inflammatory CNS damage Replicating DNA viruses generate genomic DNA that serves as a ligand for DAI DAI then associates with IPS-1 and STING, subsequently activating NF-kB via the...

Ngày tải lên: 19/06/2014, 22:20

12 529 0
COMPUTER NUMERICAL CONTROL PROGRAMMING BASICS : A Primer for the Skills USA/VICA Championships pot

COMPUTER NUMERICAL CONTROL PROGRAMMING BASICS : A Primer for the Skills USA/VICA Championships pot

... storage matrix The advantage of the CDC feature is that it: allows the use of cutters that have been sharpened to a smaller diameter permits the use of a larger or smaller tool already in the machine’s ... are naturally frustrated that an educational system has shortchanged them by not realizing that metalworking technology has changed dramatically over the past 40 years That some schools prepare ... the lathe and the mill, will be used because they use the same basic programming features and the Fanuc compatible controls as industrial machines Most of the G and M codes are the same for CNC...

Ngày tải lên: 27/06/2014, 14:20

50 418 0
Báo cáo y học: " Tumour necrosis factor-α stimulates dehydroepiandrosterone metabolism in human fibroblast-like synoviocytes: a role for nuclear factor-κB and activator protein-1 in the regulation of expression of cytochrome p450 enzyme 7b" doc

Báo cáo y học: " Tumour necrosis factor-α stimulates dehydroepiandrosterone metabolism in human fibroblast-like synoviocytes: a role for nuclear factor-κB and activator protein-1 in the regulation of expression of cytochrome p450 enzyme 7b" doc

... primers (Pharmacia, Woerden, The Netherlands) and reverse transcriptase (Pharmacia) For reverse transcription PCR, human Cyp7b sense (GTCCTGGAGAAATATTATGTGCAG) and antisense (CGCACACAGTAGTCCCCGG) ... washed with PBS and total RNA was extracted with RNAzol (Campro, Veenendaal, The Netherlands) cDNA synthesis was done according to the manufacturer's protocol using random hexamer primers (Pharmacia, ... the nuclear translocation of the transcription factors AP-1, NFAT and STAT1 in Jurkat T cells stimulated with IFN-γ or phorbol myristate acetate (PMA) as well R1277 Arthritis Research & Therapy...

Ngày tải lên: 09/08/2014, 07:20

10 462 0
báo cáo khoa học: " Bridging the gap between basic science and clinical practice: a role for community clinicians" pptx

báo cáo khoa học: " Bridging the gap between basic science and clinical practice: a role for community clinicians" pptx

... information that would help them gauge the quantitative and qualitative value of their participation in studies A clinical trial registry would also provide a venue for sharing trial data among ... Newberry for editorial assistance and Nancee Inouye for research assistance associated with the project Author details RAND Health, Santa Monica, California, USA 2Department of Medicine, David Geffen ... Clinicians working with their patients can facilitate meaningful quality assurance practices related to patient inclusion and exclusion, to data gathering, and to a nuanced awareness of the fidelity...

Ngày tải lên: 10/08/2014, 10:23

11 460 0
Retrovirology Research BioMed Central Open Access A role for CD81 on the late steps of HIV-1 pdf

Retrovirology Research BioMed Central Open Access A role for CD81 on the late steps of HIV-1 pdf

... possesses an interacting motif with the adaptor AP-3 protein, is mainly targeted to the endocytic pathway [24] while most of the other tetraspanins are found both at the plasma membrane and in intracellular ... immunoblotting and for the presence of tetraspanins and other cellular proteins as already described Reverse Transcriptase assay RT activity of viral immunoprecipitated supernatant was measured using the ... surface tetraspanin inaccessibility after treatment of MOLT/HIV-1 cells with the anti-tetraspanin antibodies was evaluated by FACS analysis The histograms present the surface staining of untreated...

Ngày tải lên: 12/08/2014, 23:20

16 343 0
w