Quantifying solar radiation at the earth surface with meteorological and satellite data

... Field in the Atmosphere 1. 2 Interaction of the Radiation and the Atmosphere 1. 3 Radiative Transfer in the Atmosphere 1. 4 Reflection of the Radiation from the Underlying Surface 1. 5 Cloud ... “integral scattering cross-section” The sense of these names is evident from (1. 12)– (1. 15) 12 Solar Radiation in the Atmosphere The substitution of the...

Ngày tải lên: 05/08/2014, 21:21

... the global cloud field (Bilingual) Izv RAS Atmosphere and Ocean Physics 20 : 120 5– 121 8 Minin IN (1988) The theory of radiation transfer in the planets atmospheres Nauka, Moscow (in Russian) Mazin ... provided 2 ≤ τ(z) ≤ τ1 (2. 12) Equation (2. 12) is also used in the case of the photon going out of the atmosphere ( 2 < 0) or reaching the surface ( 2 ≥ τ0 ) Aft...

Ngày tải lên: 05/08/2014, 21:21

... called an initial processing and obtained the radiance and irradiance spectra on the basis of the output signal of the instrument During the initial processing, the beginning point of the spectrum ... derived in the book by Minin (1988) after integrating (2.41): i↓↑ = ± 2s + 3s2 1.5 − g 0.8 ± 3s3 − 3g + + O(s4 ) 1+g 1+g (2. 43) It is also convenient to describe the interna...

Ngày tải lên: 05/08/2014, 21:21

... of Solar Irradiance and Radiance in Clear and Cloudy Atmospheres Fig 3.3a,b.Scheme of the airborne sounding: a in the coordinates “time-altitude”, b in the coordinates “cosine of the solar incident ... radiation decreases owing to the radiation extinction in the atmosphere For the upwelling irradiance this effect points to the predominance of scattering proce...

Ngày tải lên: 05/08/2014, 21:21

... for investigation of short-wave radiation field in the atmosphere In: Problems of Atmospheric Physics 6:Leningrad University Press, Leningrad, pp 1 75 181 (in Russian) Minin IN (1988) The theory ... for intermediate angles, the surface radiation budget is insensitive to the presence of or changes in, cloud cover.” The linear dependence of the cloud radiative forcing...

Ngày tải lên: 05/08/2014, 21:21

... the atmospheric gases Gas Wavelength interval (nm) H2 O O3 O2 NO2 NO3 444–4 46, 468 –470, 502–510, 538–552, 566 60 2, 62 6 66 6, 68 4–7 46, 784–978 330–3 56, 4 26 848 62 6 63 2, 68 6 69 4, 758–774 330 61 6, ... of the uncertainties of the obtained results As per Sect 4.4 the etalon algorithm for modeling the observational values while taking into account the processes of the...

Ngày tải lên: 05/08/2014, 21:21

... to the revealing of the methodological algorithm shortcomings Therefore, we are presenting the analysis of all retrieved parameters of the atmosphere including even the parameters whose obtaining ... method in the atmosphere optics Springer-Verlag, New York Minin IN (1988) The theory of radiation transfer in the planets atmospheres Nauka, Moscow (in Russian) Otnes...

Ngày tải lên: 05/08/2014, 21:21

... transmitted solar radiation J Atmos Sci 57:623–630 Minin IN (1 988 ) The theory of the radiation transfer in the planets atmospheres Nauka, Moscow (in Russian) Minin IN, Tarabukhina IM (1990) To studying ... Concerning the second reason, we present the following consideration According to the book by Minin (1 988 ), the part of diffused radiation in the cloud...

Ngày tải lên: 05/08/2014, 21:21

... 480 490 500 510 520 530 540 550 560 570 580 590 600 610 26.7 35.0 47.8 48 .9 51.2 69. 9 74.3 82.2 61.2 75.6 93 .0 94 .3 93 .2 98 .5 92 .0 90 .7 94 .7 87.7 93 .8 90 .5 92 .9 90.8 91 .4 91 .8 87.1 89. 3 88 .9 29. 8 ... 1 09. 80 107.64 104. 79 101. 39 100.41 98 . 89 96.32 96 .10 94 . 79 85.71 86 .96 87.12 84.81 78.82 80. 79 80.24 47.16 55.08 68.52 60 .97 62.74 87 .95 89. 4...

Ngày tải lên: 05/08/2014, 21:21

... 0214 0281 0076 0106 0078 0106 0077 0106 0077 0106 0078 0105 0076 0105 0077 0105 0076 0105 0076 0104 0075 0105 0075 0104 0075 0104 0075 0104 0075 0103 0074 0103 0074 0102 0074 0100 0074 0998 0073 ... 322 010 321 010 314 010 312 010 311 010 302 010 292 010 288 010 283 010 279 010 264 009 257 009 257 009 254 009 262 011 258 011 251 012 252 011 248 010 241 010 239 010 233 010 228 01...

Ngày tải lên: 05/08/2014, 21:21

... ATTTCCTCATTCCAATAATG TTGAACTACGATCCAGAAGC GGATCCTCATTGAGAACAATTTCCTTGA GGATCCATCATGTTCTCATCATCATAATATG GGATCCGTTAAATATAATGCAGTGACGAAGATA GGATCCAAGTCAAACCTTGAGAAAGAACGA CACGGCATATTATGATGATGAGAACATGATGGATCTCG ... ATCCAAACTTATAATATTAAAAAAAGCGCTACTTATATGCATCATTTCATGAATTCGAGCTCGTTTAAAC GCACTAGTATGAAAAGAATAAGATCGCTTT GCCCCGGGATCATTGAGAACAATTTCC GCGGATCCGTATGACCACATTCTATACTGA GAGCCAATATCAAATCTGGTGGT...

Ngày tải lên: 18/02/2014, 06:20

... dna naciremA htroN ruof-ytnewT RCP-TR emit-laer neerG RBYS yb snigiro cihpargoeg tnereffid fo setalosi VASI fo noitceteD stluseR )ASU ,batiniM( erawtfos 31 batiniM gnisu demrofrep saw AVONA ehT ... evitisop erew dna 63 naht retaerg ro lauqe seulav tC dah taht snoitcaer noitacifilpma wef fo sesylana leg eht ,gniniats edimorb muidihte dna siserohportcele leg gniwollof deniatbo erew sezis pb ......

Ngày tải lên: 07/08/2014, 18:21

... http://www.biomedcentral.com/1471-2229/6/22 At3 g62220 At3 g17410 Arabidopsis thaliana Arabidopsis At1 g48210 thaliana Arabidopsis At2 g47060 Arabidopsis thaliana thaliana gi|51038251 Oryza sativa At1 g48220 Arabidopsis thaliana M-[GS]-C-F-[AGS]-[CFW]-C ... Myr:GFP was cloned by in vitro annealing of oligonucleotides Myr -A (5'-P-gatccatgggatgcttttcatgctgctgtgtggcagatgacgacaacgttggcag...

Ngày tải lên: 12/08/2014, 05:20

Ngày tải lên: 12/06/2015, 22:25