distribution of ions at the charged surface

Báo cáo y học: "Effects of Losartan on expression of connexins at the early stage of atherosclerosis in rabbits"

Báo cáo y học: "Effects of Losartan on expression of connexins at the early stage of atherosclerosis in rabbits"

... seamless connections The present study aimed to detect the expression of Cx40 and Cx43 in the artery at early stage of high fat diet induced atherosclerosis and to investigate the effects of AT1 antagonist ... formation of the atherosclerotic plaque Previous study demonstrated that rats lack of Cx43 expression showed 50% lower rate of attack with atherosclerotic plaque compared with normal rats (9) Our ... endothelium and resulted in the formation of atherosclerosis (9) Javid et al also found that in the early stage of atherosclerosis, the number of Cx43 gap junction plaques increased and the diameter...

Ngày tải lên: 26/10/2012, 09:39

8 467 0
Identifying common errorss in written english of students of english at the intermediate level

Identifying common errorss in written english of students of english at the intermediate level

... discussed in the contents of the thesis, point out the limitations of the study and give some suggestions for further research 4 Part II: content Chapter theoretical background 1.1 .the overview of writing ... students of English at the intermediate level in particular - help us widen our knowledge of English Subjects of the study are a group of eighty students of English at the intermediate level of Foreign ... deals with the theoretical background Chapter is about the study and presentation of common written English errors of students of English at the intermediate level The description of research...

Ngày tải lên: 19/12/2013, 10:39

38 479 0
Tài liệu One Hundred Eleventh Congress of the United States of America - AT THE SECOND SESSION pptx

Tài liệu One Hundred Eleventh Congress of the United States of America - AT THE SECOND SESSION pptx

... (A) the extent of the leverage of the company; (B) the extent and nature of the United States related off-balance-sheet exposures of the company; (C) the extent and nature of the transactions ... regulations prior to the expiration of the 3-year period following the date of publication of final regulations, the Office, in consultation with the Chairperson, may implement such regulations ... assess the state of the United States financial system, including— (A) an analysis of any threats to the financial stability of the United States; (B) the status of the efforts of the Office...

Ngày tải lên: 17/02/2014, 21:20

848 411 0
Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx

Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx

... AGCAAGCACTACGTATCACGACAAACCAAC GCTTCTGGATCGTAGTTCAA CATTATTGGAATGAGGAAAT ATTTCCTCATTCCAATAATG TTGAACTACGATCCAGAAGC GGATCCTCATTGAGAACAATTTCCTTGA GGATCCATCATGTTCTCATCATCATAATATG GGATCCGTTAAATATAATGCAGTGACGAAGATA GGATCCAAGTCAAACCTTGAGAAAGAACGA ... ATGATGATGATAACAAAGGAGCTACAATCAAGGAAATTGTTCTCAATGATCGGATCCCCGGGTTAATTAA ATCCAAACTTATAATATTAAAAAAAGCGCTACTTATATGCATCATTTCATGAATTCGAGCTCGTTTAAAC GCACTAGTATGAAAAGAATAAGATCGCTTT GCCCCGGGATCATTGAGAACAATTTCC GCGGATCCGTATGACCACATTCTATACTGA ... CACGGCATATTATGATGATGAGAACATGATGGATCTCG CGCGGATCCCCGGGTTAATTAA TTTAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTGAATTCGAGCTCGTTTAAAC ATTTCCTCATTCCAATAATG TACCCATACGATGTTCCTG CAAAGCGATCTTATTCTTTT...

Ngày tải lên: 18/02/2014, 06:20

15 475 0
Tài liệu Báo cáo khoa học: Critical roles of Asp40 at the haem proximal side of haem-regulated phosphodiesterase from Escherichia coli in redox potential, auto-oxidation and catalytic control doc

Tài liệu Báo cáo khoa học: Critical roles of Asp40 at the haem proximal side of haem-regulated phosphodiesterase from Escherichia coli in redox potential, auto-oxidation and catalytic control doc

... are only slightly higher than that (0.045 mM)1Æs)1) of the wild-type protein (Table 2) The data indicate that mutation of Asp40 at the haem proximal side alters the cyanide binding property only ... relationships of Ec DOS Mutations at Asp40 did not essentially affect the optical absorption spectra of this enzyme However, Asp40 mutations at the haem proximal side significantly altered the ... spectral maxima in the visible region of the Fe(III) species, spectra of the Asp40 mutants were essentially similar to that of the wild-type protein Additionally, spin states of the Fe(III), Fe(II)...

Ngày tải lên: 19/02/2014, 16:20

6 424 0
Báo cáo "QUATERNARY GEOLOGICAL MAP OF THE CONTINENTAL SHELF OF VIETNAM AT THE SCALE OF 1:1,000,000 " potx

Báo cáo "QUATERNARY GEOLOGICAL MAP OF THE CONTINENTAL SHELF OF VIETNAM AT THE SCALE OF 1:1,000,000 " potx

... Vu The selection of scale of the map is very important for interpretation and performance of geological formation on the map Stratigraphical boundaries in Quaternary are divided by comparison the ... developed along the littoral zone at different times, especially Holocene corals The typical ones located in the Gulf of Tonkin, near shore of Central Vietnam, in the Paracel and Spratley The coral ... another coral platform was produced at recent depth of 2-3 meters The active transgression has produced coral platform and wave-cut bench The corals of Paracel and Spratley Corals had a large atoll...

Ngày tải lên: 05/03/2014, 16:20

10 404 0
Signaling at the Cell Surface in the Circulatory and Ventilatory Systems docx

Signaling at the Cell Surface in the Circulatory and Ventilatory Systems docx

... intracellular concentrations of second messengers and, in turn, the latter change the concentrations of and activate via posttranslational modifications and conformational variations their signaling ... at Université Pierre et Marie Curie in the framework of prerequisite training of Master “Mathematical Modeling”, part of Master of “Mathematics and Applications”, Centre de Recherches Mathématiques, ... pathways occur at the cell membrane and cortex The dynamics of a biochemical process can be represented by a set of equations that link the time variations of concentrations of implicated substances...

Ngày tải lên: 05/03/2014, 22:21

999 3,2K 0
Báo cáo khoa học: Binding of ATP at the active site of human pancreatic glucokinase – nucleotide-induced conformational changes with possible implications for its kinetic cooperativity doc

Báo cáo khoa học: Binding of ATP at the active site of human pancreatic glucokinase – nucleotide-induced conformational changes with possible implications for its kinetic cooperativity doc

... helix 15) A conformational change was also indicated by the MD simulations of the modelled ternary hGK–Glc– ATP complex In the final structure of the simulations, the interactions of the adenosine ... MD simulations of the modelled binary GK–ATP complex revealed that the global rmsd of the structure converged at the end of the 2-ns simulation period (Fig S2A) The dynamic changes in the active ... 222 nm at a constant heating rate of 40 °CÆh)1 The midpoint of the transition (Tm) was determined from the first derivative of the smoothed denaturation curve The associated high-voltage (pseudoabsorbance)...

Ngày tải lên: 06/03/2014, 00:20

15 374 0
Báo cáo khoa học: Differential tissue-specific distribution of transcripts for the duplicated fatty acid-binding protein 10 (fabp10) genes in embryos, larvae and adult zebrafish (Danio rerio) docx

Báo cáo khoa học: Differential tissue-specific distribution of transcripts for the duplicated fatty acid-binding protein 10 (fabp10) genes in embryos, larvae and adult zebrafish (Danio rerio) docx

... in the same clade (bootstrap value of 56 ⁄ 100) The single copy of the fabp10 gene found in the Tetraodon genome sequence database may indicate that the genome of this fish has lost one of the ... that regulate the spatiotemporal transcription of duplicated genes Although subfunctionalization was proposed as an alternative mechanism to neofunctionalization in the degeneration–duplication–complementation ... (Sb) the high retention rate of duplicate genes in the genome, Force et al [47] did not exclude neofunctionalization in their degeneration–duplication– complementation model, where one of the...

Ngày tải lên: 16/03/2014, 00:20

11 402 0
“Net Neutrality,” Non-Discrimination and Digital Distribution of Content Through the Internet* docx

“Net Neutrality,” Non-Discrimination and Digital Distribution of Content Through the Internet* docx

... discriminate with respect to the identity of those receiving information packets, those sending them, or the nature of the information packets and the function they served The content of the packets ... rate than the profit from users is decreasing Figure shows an example of that case Figure shows the relationship between the network’s fee to the application, the network profit, the application’s ... d measures the strength of the complementarity between the network and the application.30,31 The profit function of the access network is 27 The mathematical structure of this model is similar...

Ngày tải lên: 23/03/2014, 03:20

25 393 0
báo cáo sinh học:" Measuring inequalities in the distribution of health workers: the case of Tanzania" doc

báo cáo sinh học:" Measuring inequalities in the distribution of health workers: the case of Tanzania" doc

... only 8% of the health workers, while the quintile with the most health workers has 46% of the workers The value of the Gini index is 0.229 Part of the inequality in the distribution of health ... alternatives to the standard measure of health care needs (i.e the level of population) By combining the use of concentration curves for these alternative measures of need with the Lorenz curve of ... Lorenz curve and the concentration curves where G is the Gini index, n is the number of observations, Xi is the number of health workers in the ith location and μ is the mean number of health workers...

Ngày tải lên: 18/06/2014, 17:20

12 531 0
Báo cáo y học: "Summary of presentations at the NIH/NIAID New Humanized Rodent Models 2007 Workshop" ppsx

Báo cáo y học: "Summary of presentations at the NIH/NIAID New Humanized Rodent Models 2007 Workshop" ppsx

... over the next decade by the targeting of genes at a number of loci including the recombination activating genes and (Rag1 and Rag2) and the beta microglobulin (B2m) locus [26] Mutations at the ... nodes Therefore, further dissection of the mechanism of human T cell maturation in this system could provide new methods to increase the qualitative function of T cells that mature in the human ... reflect the views of the Division of AIDS, the National Institute of Allergy and Infectious Diseases, the National Institutes of Health, or any other governmental agency Presenters at the workshop...

Ngày tải lên: 10/08/2014, 05:21

14 409 0
báo cáo khoa học: "Localization of DIR1 at the tissue, cellular and subcellular levels during Systemic Acquired Resistance in Arabidopsis using DIR1:GUS and DIR1:EGFP reporters" ppsx

báo cáo khoa học: "Localization of DIR1 at the tissue, cellular and subcellular levels during Systemic Acquired Resistance in Arabidopsis using DIR1:GUS and DIR1:EGFP reporters" ppsx

... from the ER and the secretory system Nevertheless, these data support the idea that some DIR1 protein is present in the cytosol and therefore Page 11 of 16 gains access to the phloem through the ... In the final, or manifestation, stage of SAR, the plant responds to normally virulent pathogens in a resistant manner [3] Manifestation of SAR is associated with the expression and activity of ... displayed demonstrate that reduction in DIR1 observed after inoculation with Pst is not a response by the plant, but rather a consequence of the delivery of Pst virulence effectors into the plant cell...

Ngày tải lên: 11/08/2014, 11:21

16 233 0
báo cáo khoa học:" Quality of life at the dead sea region: the lower the better? an observational study" pptx

báo cáo khoa học:" Quality of life at the dead sea region: the lower the better? an observational study" pptx

... and HRQOL The results of previous studies have demonstrated the advantage of the DS region for climatotherapy Most of these studies examined the health benefits of the DS region for patients with ... came to the DS for treatment None of these studies assessed permanent residents of the DS region to determine whether the affects of this unique climate are beneficial to residents of the region ... psoriasis: climatotherapy at the Dead Sea Br J Dermatol 1999, 141:1088-1091 Ben-Amitai D, David M: Climatotherapy at the dead sea for pediatriconset psoriasis vulgaris Pediatr Dermatol 2009, 26:103-104...

Ngày tải lên: 12/08/2014, 01:22

7 400 0
Generation of vorticity at a free surface of miscible fluids with different liquid properties

Generation of vorticity at a free surface of miscible fluids with different liquid properties

... Formation of the secondary ring at the bottom of the crater 169 Fig 4- Formation of the secondary ring 170 167 xiii Fig 4- Formation of the secondary ring at the bottom of the crater 171 Fig 4- The ... impact of identical liquids The curvature of the neck during the initial coalescence is determined by the impact velocity, the shape of the bottom surface of the drop and the strength of the surface ... approximations of the Euler equations to calculate the dynamics of a splash event In their computation, the fluid was considered as inviscid and they completely neglected the effect of surface...

Ngày tải lên: 11/09/2015, 16:07

206 218 0
Customer satisfaction, return intention and word   of   mouth at the coffee bean  tea leaf in the vietnamese market

Customer satisfaction, return intention and word of mouth at the coffee bean tea leaf in the vietnamese market

... their expectations, they will be dissatisfied On the other hand, if customer‘s perceptions meet expectations, they will be satisfied Otherwise, if customers perceive more than their expectations, ... Title of Thesis: Customer Satisfaction, Return Intention and Word -of- Mouth at The Coffee Bean & Tea Leaf in the Vietnamese market Advisor: Dr Trương Quang Được I assure that the content of this thesis ... above statement will automatically lead to the rejection from the MBA program at the International University – Vietnam National University Hochiminh City Copyright Statement This copy of the thesis...

Ngày tải lên: 22/10/2015, 13:31

118 701 2
Báo cáo khoa học: Cofactor-independent oxygenation reactions catalyzed by soluble methane monooxygenase at the surface of a modified gold electrode pot

Báo cáo khoa học: Cofactor-independent oxygenation reactions catalyzed by soluble methane monooxygenase at the surface of a modified gold electrode pot

... shows the effect of increasing catalase concentrations (0, 2.4, 4.8 and 7.2 lM, respectively) The effect of ventilating the reaction at the highest catalase concentration was also investigated as ... between the substrate and the active oxygen species to generate product Previous data have led to the conclusion that the species responsible for oxygenation of substrate is the diferryl intermediate ... but to drive the reaction high concentrations are needed to form intermediate P The catalytic efficiency of the peroxide shunt reaction is not high, the maximum rate of methane oxygenation being...

Ngày tải lên: 17/03/2014, 09:20

6 464 0
Báo cáo Y học: A single charged surface residue modifies the activity of ikitoxin, a beta-type Na+ channel toxin from Parabuthus transvaalicus doc

Báo cáo Y học: A single charged surface residue modifies the activity of ikitoxin, a beta-type Na+ channel toxin from Parabuthus transvaalicus doc

... shown at the top of Fig 6C,G The amplitude of the Na+ current activated by the depolarization to )7 mV measures the fraction of total current that is available for activation after shifting the ... effects, the effects at low concentrations of birtoxin are similar to those of ikitoxin Although the difference in actions at some concentrations suggests that these toxins might differ in their ... or mechanism of action, the similarity of their effects at other concentrations raised the possibility that both toxins have a common mechanism of action By assessing the effect of these toxins...

Ngày tải lên: 31/03/2014, 08:20

8 425 0
Báo cáo hóa học: " Mapping of immunogenic and protein-interacting regions at the surface of the seven-bladed β-propeller domain of the HIV-1 cellular interactor EED" pptx

Báo cáo hóa học: " Mapping of immunogenic and protein-interacting regions at the surface of the seven-bladed β-propeller domain of the HIV-1 cellular interactor EED" pptx

... β-propeller domain of EED Theoretical considerations An important feature of the β-propeller structure of the EED core was that most of the accessible surfaces should be confined to the outer β-strands ... into the host chromatin At the late steps of the virus replication cycle, we found that overexpression of isoforms EED3 and EED4 had a significant negative effect on virus production, and that ... of the binding sites of HIV-1 MA and IN [15,16] Several immunoreactive regions coincided with the MA, IN and EZH2 binding sites, confirming the accessibility of these regions at the surface of...

Ngày tải lên: 20/06/2014, 01:20

8 378 0
w