Fundamentals of zinc oxide as a semiconductor

Báo cáo khoa học: Zinc-binding property of the major yolk protein in the sea urchin ) implications of its role as a zinc transporter for gametogenesis ppt

Báo cáo khoa học: Zinc-binding property of the major yolk protein in the sea urchin ) implications of its role as a zinc transporter for gametogenesis ppt

... implies that MYP has a role as a zinc transporter for gametogenesis In vertebrates, vitellogenin, a precursor of yolk protein, is a zinc- bind4994 ing protein that transports the zinc required for oogenesis ... as a substrate for localization of the labeled MYP Statistical analysis Data were expressed as the mean ± SEM Statistical analysis was...

Ngày tải lên: 16/03/2014, 05:20

14 442 0
Long term effects of zinc oxide nanoparticles on wastewater treatment in a membrane bioreactor (MBR) process

Long term effects of zinc oxide nanoparticles on wastewater treatment in a membrane bioreactor (MBR) process

... of zinc oxide nanoparticles 19 2.2.1 Mechanisms of zinc oxide nanoparticles 21 2.2.2 Effects of zinc oxide nanoparticles on bacteria 23 2.2.3 Effects of zinc oxide nanoparticles on wastewater treatment ... of this project I would also like to express appreciate to all my laboratory mates, namely Divya Shankari Srinivasa Ragha, Shruti Vyas, Subhabr...

Ngày tải lên: 10/11/2015, 11:07

144 379 0
Stability and in vivo evaluation of pullulan acetate as a drug nanocarrier

Stability and in vivo evaluation of pullulan acetate as a drug nanocarrier

... stability of PANs was studied in the aqueous medium, and the acute toxicity of PANs was evaluated in mice Morever, EPI was loaded into PANs and its pharmacokinetics was also assessed in rats to compare ... main pharmacokinetic parameters were calculated by DAS 1.0 (Anhui, China) program Bioavailability (BA) is a measurement of the rate and extent of a therapeutically...

Ngày tải lên: 23/04/2013, 21:38

7 391 0
Evaluation of Dredged Sediment as a Silt and Clay Source for Artificial Tidal Flats

Evaluation of Dredged Sediment as a Silt and Clay Source for Artificial Tidal Flats

... in artificial tidal flats in Japan, a growth test of R philippinarum was also carried out in DS mixtures MATERIALS AND METHODS Artificial tidal flats in real seashore Five artificial tidal flats ... observed variation in the macrobenthos population in the artificial tidal flats and the natural tidal flat The abundance of macrobenthos in the artificial ti...

Ngày tải lên: 05/09/2013, 09:38

13 586 0
Assessment of pretreatments and enzymatic hydrolysis of wheat straw as a sugar source for bioprocess industry

Assessment of pretreatments and enzymatic hydrolysis of wheat straw as a sugar source for bioprocess industry

... And such a whole suite of accessory enzymes is required for efficient xylan hydrolysis such as α-arabinofuranosidases and α-Larabinases that release arabinan [31], α-glucuronidases that release ... pretreatment, enzymatic saccharification and fermentation of wheat straw to ethanol Journal of Biobased Materials and Bioenergy 2008, 2(3), 210-217 [68] Saha B.C., Cotta...

Ngày tải lên: 05/09/2013, 15:28

20 437 0
Searching for a Mate: The Rise of the Internet as a Social Intermediary potx

Searching for a Mate: The Rise of the Internet as a Social Intermediary potx

... Searching for a Mate: The Rise of the Internet as a Social Intermediary Abstract This paper explores how the efficiency of Internet search is changing the way Americans find romantic partners ... geographically concentrated in areas such as Silicon Valley, California, because the face-to-face networks are crucial for the cross fertilization of ideas...

Ngày tải lên: 15/03/2014, 21:20

50 470 0
Báo cáo Y học: The mitochondrial-lysosomal axis theory of aging Accumulation of damaged mitochondria as a result of imperfect autophagocytosis ppt

Báo cáo Y học: The mitochondrial-lysosomal axis theory of aging Accumulation of damaged mitochondria as a result of imperfect autophagocytosis ppt

... features of aging A number of early explanations of aging, such as Orgel’s error catastrophe theory and the somatic mutation theory, were based on the idea that aging results from the accumulation ... neonatal rat cardiac myocytes, inhibition of autophagocytosis by 3-methyladenine results in a dramatic accumulation of small mitochondria while the number...

Ngày tải lên: 17/03/2014, 23:20

7 444 0
Báo cáo khoa học: The effect of zinc oxide nanoparticles on the structure of the periplasmic domain of the Vibrio cholerae ToxR protein pot

Báo cáo khoa học: The effect of zinc oxide nanoparticles on the structure of the periplasmic domain of the Vibrio cholerae ToxR protein pot

... surface and the consequent effect on the structure of the protein Towards achieving this goal we studied the effect of ZnO NPs on the structure of ToxRp, alone and in the presence of denaturing ... changes of the ToxRp protein of V cholerae Based on the thermodynamic parameters of binding one can speculate on the nature of the interact...

Ngày tải lên: 23/03/2014, 03:20

11 596 0
Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot

Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot

... GTTGGTCTCGTCGCTCATCACATCACGAGG GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG ... GGCTCCTCCAGCACCCTCCGGGTCCCG CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA 82898–82923 83581–8...

Ngày tải lên: 23/03/2014, 05:22

14 416 0
Báo cáo "Investigation of zinc oxide thin film by spectroscopic ellipsometry " ppt

Báo cáo "Investigation of zinc oxide thin film by spectroscopic ellipsometry " ppt

... calculated quantities, Thin Solid Films 313314 (1998) 33 [6] R Swanepoel, Ellipsometry data for some thin film samples, J Phys E: Sci Instrum., 16 (1983) 1215 [7] Jobin-Yvon, Horiba Group Ellipsometry ... conditions (e.g the angle of polarization mirrors and modulators) and parameters of film (∆, Ψ) The measurement configuration is chosen for the purpose of simplifying the c...

Ngày tải lên: 28/03/2014, 13:20

8 362 0
A Study on the Effects of Argentine Tango as a Form of Partnered Dance for those with Parkinson Disease and the Healthy Elderly pptx

A Study on the Effects of Argentine Tango as a Form of Partnered Dance for those with Parkinson Disease and the Healthy Elderly pptx

... this study This work was supported by a grant from the Marian Chace Foundation to Madeleine Hackney and a grant from the American Parkinson Disease Association to Gammon Earhart References Argue, ... to the task: Interference effects of functional tasks on walking in Parkinson s disease and the roles of cognition, depression, fatigue, and balance Archives o...

Ngày tải lên: 28/03/2014, 20:20

19 649 0
Báo cáo Y học: Characterization of selenoprotein P as a selenium supply protein docx

Báo cáo Y học: Characterization of selenoprotein P as a selenium supply protein docx

... selenocysteine metabolism? Proc Natl Acad Sci USA 93, 15086–15091 Saito, Y. , Hayashi, T., Tanaka, A. , Watanabe, Y. , Suzuki, M., Saito, E & Takahashi, K (1999) Selenoprotein P in human plasma as an ... 2002 Selenoprotein P as a selenium supply protein (Eur J Biochem 269) 5747 provided by Ajinomoto, Co Inc., Kawasaki, Japan Human serum albumin and human outdated frozen...

Ngày tải lên: 31/03/2014, 08:20

6 371 0
A Portrait of the Artist as a Young Man ppt

A Portrait of the Artist as a Young Man ppt

... would be dark and sleeping There was cold night air in the chapel and the marbles were the colour the sea was at night The sea was cold day 16 A Portrait of the Artist as a Young Man and night: ... was not like the smell of the old peasants who knelt at the back of the chapel at Sunday mass That was a smell of air and rain and turf and corduroy But...

Ngày tải lên: 31/03/2014, 14:20

317 342 0
controlled growth of zinc oxide microrods by hydrothermal process

controlled growth of zinc oxide microrods by hydrothermal process

... substrates by hydrothermal process after 10 h of growth The precursor solution (equimolar concentration of Zn(NO3)2 and hexamine) was changed every h during the growth process; (a) mM of Zn2+, (b) mM of ... concentration of Zn(NO3)2 and hexamine) was changed every h during the growth process; (a) mM of Zn2+, (b) mM of Zn2+ and (c) 10 mM of Zn2+ Table Summary of...

Ngày tải lên: 06/05/2014, 13:23

7 447 0
w