taking care of your voice as a teachers

... comfortable volume, and loud. ã Breath in deeply. Exhale for as long as possible through pursed lips. ã Say alphabet as many times as possible on one breath. Concentrate on controlling airflow and ... airflow and making voice as resonant as possible. ã Be dramatic! Using diaphragmatic support and open throat, say: “Cry, God for Harry, England and Saint George” or ”Friends, Romans, countrymen, ... general health of throat and larynx: 1. Hydration ã Drink plenty of water throughout the day to keep your larynx hydrated. ã Have water or herbal tea at hand to sip during extended teaching....

Ngày tải lên: 10/12/2013, 05:15

Ngày tải lên: 10/08/2014, 10:23

Ngày tải lên: 13/08/2014, 20:21

... euent was detected with a UV detector at 232 nm. e main pharmacokinetic parameters were calculated by DAS 1.0 (Anhui, China) program. Bioavailability (BA) is a measurement of the rate and extent ... (Sonaje et al., 2009): BA (AUC )Dose (AUC )Dose 100 R AB BA = ì ì ì% () () where AUC is the area under the curve. Statistical analysis All data are presented as a mean value with its stand- ard ... Tang et al. ing and release studies of a water soluble drug. J Contr Rel. 57:171–85. Gu, X.G., Schmitt, M., Hiasa, A. , Nagata, Y., Ikeda, H., Sasaki, Y., Akiyoshi, K., Sunamoto, J., Nakamura,...

Ngày tải lên: 23/04/2013, 21:38

Ngày tải lên: 05/09/2013, 09:38

Ngày tải lên: 05/09/2013, 15:28

... Linear elements, such as roads, waterways, and fences placed diagonally, are generally perceived as more dynamic than horizontally placed ones: the width of the whole image relates to ... based on the fact that the human eye is naturally drawn to a point about two-thirds up a page. Crop your photo so that the main subjects are located around one of the intersection points rather ... so that the width of the resulting small part of the image relates to that of the big part exactly as Photography composition - Your photo as a story Photo composition rules ã Rule of Thirds...

Ngày tải lên: 27/10/2013, 23:15

... channel. A channel map has three components: (1) a diagram of the information and product flow at each channel stage, including handling, storage, moving, processing, etc.; (2) a quantitative ... sides of the relationship. Innovative supplier management, using your suppliers as a resource, allows both companies to move past the traditional adversarial relationship toward a partnership with ... projects fail because adequate care is not taken in " Showcase" projects are particularly effective at this stage. These differ from pilot projects in important ways. A showcase offers...

Ngày tải lên: 26/01/2014, 03:20

... Increase the risk of damaging a consumers credit rating ã Increase the risk of identity theft and other nancial fraud ã Face negative consequences of credit abuse, such as loan denial or bankruptcy ... critical thinking skills to choose an appropriate credit card Vocabulary ATM card — card that allows withdrawals and deposits from bank accounts using an automatic teller machine (ATM) and functions ... made. Savings account — account at a nancial institution that allows an individual to deposit money into that account, which may or may not be accessed on demand and is typically used as a...

Ngày tải lên: 16/02/2014, 03:20

... disease a few days after taking medication. But as a precautionary step, taking in solid or liquid food that contains caffeine must be avoided as this substance can aggravate bladder irritation. ... To Take Care Of Your Babys Health â Wings Of Success Page 10 of 10 Make Your Child Develop Sleep Associations One of the key factors in your baby's development is in creating associations ... general habits and associations for your child, you will ensure a hasty and healthy sleep development. How To Take Care Of Your Babys Health â Wings Of Success Page 37 of 37 having some potato...

Ngày tải lên: 08/03/2014, 14:20

... influence have argued that the Internet would make ascriptive personal characteristics such as race, and family background characteristics such as religion and social class less important (Barlow ... gay bars were not always safe or pleasant, and the bars inevitably reached only a small percentage of the local gay and lesbian communities. Compared to the gay bar, the Internet provides a ... overturned (Kraut et al. 2002) or broadly challenged (Katz and Rice 2002; Wang and Wellman 2010). Scholarly debate about the social impacts of the Internet has been hampered by a lack of nationally...

Ngày tải lên: 15/03/2014, 21:20

... MYP. Statistical analysis Data were expressed as the mean ± SEM. Statistical analy- sis was performed using instat software (GraphPad Soft- ware). The normality of the distribution of data was evaluated ... weight) )1 at stage 1, which was less than half of that in ovary at stage 1, and remained at a similar value to stage 4. Testes at stage 2 were not analyzed because of a lack of samples. We calculated the ... histology, and the remainder was stored at ) 80 °C for analysis for metals. Paraffin sections 6 lm thick were prepared and stained with hematoxylin and eosin. The gonadal maturity of each animal was classified...

Ngày tải lên: 16/03/2014, 05:20

... cardiomyopathy. Intern. Med. 34, 670–673. 51. Wada, H., Woo, M., Nishio, H., Nagaki, S., Yanagawa, H., Imamura, A. , Yokoyama, S., Ohbayashi, C., Matsuo, M., Itoh, H. & Nakamura, H. (1996) Vascular ... 774–779. 48. Yoneda, M., Chomyn, A. , Martinuzzi, A. , Hurko, O. & Attardi, G. (1992) Marked replicative advantage of human mtDNA car- rying a point mutation that causes the MELAS encephalomyo- pathy. ... that the recycling mechanisms are inherently imperfect [15,25], and this may provide an attractive explanation for many of the features of aging. A number of early explanations of aging, such as Orgel’s...

Ngày tải lên: 17/03/2014, 23:20

...

Ngày tải lên: 18/03/2014, 11:22

... Idem MAP2-for MAP2-rev GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC 91489–91517 92431–92404 NC_000067 Idem Tau-for Tau-rev GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC 78772–78800 79013–78981 NC_000077 ... Quı ´ mica Biolo ´ gica, Facultad de Ciencias Quı ´ micas, Universidad Nacional de Co ´ rdoba, Argentina 2 Departamento de Biologı ´ a Molecular, Facultad de Ciencias Exactas, Fı ´ sico-Quı ´ micas ... Idem Doublecortin-for Doublecortin-rev CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG 705–728 967–943 NM_010025 Idem LIS1-for LIS1-rev CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG 1288–1303 1427–1407 NM_95116 Idem Tubulin a6 -for Tubulin a6 -rev AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA 6854–6876 7646–7624 NC_000081...

Ngày tải lên: 23/03/2014, 05:22

... performance is so closely associated with the performance of the organization, many boards choose to make the executive evaluation part of an annual cycle of broader organizational evaluation. ... desires. It can be very easy explain away performance problems that are genuinely hindering the organization. In organizations with a charismatic, powerful leader and a weak board, years of poor ... entity that the board has any power at all. Choose an Approach 4. To some extent, you are always evaluating the executive director, via observation at formal and informal meetings, in conversations...

Ngày tải lên: 24/03/2014, 01:20

... to Madeleine Hackney and a grant from the American Parkinson Disease Association to Gammon Earhart. References Argue, J. (2000) Parkinson’s disease and the art of moving. Oakland, CA: New Harbinger. Beauchet, ... et al. Adherence to an exercise program may be more likely if it is novel and enjoyable. A study of those at risk of heart failure found that the waltz was just as good as traditional aerobic ... phenomenon, and it is deserving of attention (Judge 2003; Pratt 2004). Argentine tango has recently emerged as a promising non-traditional approach to ameliorating balance and gait problems among elderly individuals....

Ngày tải lên: 28/03/2014, 20:20

... SeP in the plasma of Chinese men of varying Se status accounted for 50–60% of the total Se in their plasma [38]. In another approach based on immunoassay, 40–44% of the total Se was reported to ... low-molecular-mass substances such as metals, amino acids and fatty acids [42]. Transferrin and albumin noncovalently bind iron and many low-molecular-mass substances, respectively. As Se is covalently ... and human transferrin from Wako, Osaka, Japan; and nickel- nitrilotriacetic acid agarose from Qiagen Inc., Chatsworth, CA, USA. Recombinant human thioredoxin was kindly Correspondence to K. Takahashi,...

Ngày tải lên: 31/03/2014, 08:20

... O’SHEA! —And what did you do, John? asked Mr Dedalus. —I let her bawl away, said Mr Casey. It was a cold day and to keep up my heart I had (saving your presence, ma’am) a quid of Tullamore ... bat- tleeld of Prague far away over the sea. He was standing on the eld; his hand was pressed to his side; his face was pale and strange and he wore the white cloak of a marshal. O how cold and strange ... was a noise of curtain-rings running back along the rods, of water being splashed in the basins. ere was a noise of rising and dressing and washing in the dormitory: a noise of clapping of...

Ngày tải lên: 31/03/2014, 14:20

Ngày tải lên: 16/04/2014, 16:23