importance of english language as a medium of business communication

MINISTRY OF EDUCATION AND TRAINING HUE COLLEGE OF AGRICULTURE AND FORESTRY - A COURSE OF ENGLISH pptx

Ngày tải lên : 05/03/2014, 20:20

... specific characteristics that differentiate the term from other members of its class. For example, a definition of a giraffe should include a classification, such as, A giraffe is an animal, and specific ... fragments. Clay is produced by chemical weathering. In the case of rocks such as granite, when the clay-producing parts are weathered away the more resistant quartz crystals are left as sand ... sandy, with a structure which is a cemented and compact mass, made up of decomposed felspars. 40 LANGUAGE SUMMARY A. Adjectives and adverbs Look at these examples: - Our vacation was too...

128
1.2K
0

A study of using english songs as a type of supplementary material in teaching listening for first year non major students of english at phuong dong university

Ngày tải lên : 29/01/2014, 10:33

... was within fifteen minutes. During the test, the teacher worked as a cassette player and examiner. The marking was done with the same way of assessment and then was analyzed in turn. The class ... appendix 1- task 3) D, Vocabulary Learning. Active vocabulary learning is an activity that is seldom paid any attention in most language classrooms. It is here that songs can be of great help. ... reveal that the class B seems to be better than class A as its modes of six is higher than the one of class A which is five. -Correlation: N Mean Std. Deviation Median Class A 30 5.3667...

39
1.1K
3

Tài liệu Huntington’s Borghese Style Urn as a Study of Two-Dimensional Art & The Production of a Piece of Two-Dimensional Art pptx

Ngày tải lên : 19/02/2014, 10:20

... myth and mythologies. Compare the "god-like" qualities of a particular character (such as Diana, goddess of the hunt) to a modern character (such as Mia Hamm, huntress of a soccer goal). Huntington ... work of art is defined by the visual. Social, ethical. moral, and contemporary standards of a society. armature A structure of wood or wire for example. used under sculptural materials, such as ... such as clay for support. asymmetry A balance achieved through the use of unequal parts or elements. Visualize a beach ball sitting on one side of a stick and two baseballs on the other—balancing...

6
681
0

American Negro Slavery A Survey of the Supply, Employment and Control of Negro Labor as Determined by the Plantation Regime docx

Ngày tải lên : 08/03/2014, 00:20

... bookkeepers and auditors, as well as a corps of white artisans and an abundance of native interpreters, boatmen, carriers and domestic servants. The Dutch and English stations alternated in a series east ... commanded by a governor and garrisoned by a score or two of soldiers; and each with its outlying factories had a staff of perhaps a dozen factors, as many sub-factors, twice as many assistants, and a few ... whereas Jews, Mohammedans and Christian heretics were considered as champions of rival faiths, the pagan blacks came increasingly to be reckoned as having no religion and therefore as a mere passive...

268
608
0

Báo cáo khoa học: Identiﬁcation of calreticulin as a ligand of GABARAP by phage display screening of a peptide library pdf

Ngày tải lên : 16/03/2014, 05:20

... fitted as global parameters, whereas the maxi- mum response R max was fitted as a separate parameter for each binding sensorgram. The dissociation constant was obtained as K d ẳ k off k on . NMR All ... human GABA A receptor-associated protein (GABARAP) is a protein implicated in the trafficking of GABA A receptors to the plasma membrane [2,3]. Keywords calreticulin; GABA A receptor; GABARAP; phage ... Identification of calreticulin as a ligand of GABARAP by phage display screening of a peptide library Jeannine Mohrlu ă der 1,2 , Thomas Stangler 1,2 , Yvonne Hoffmann 1,2 , Katja Wiesehan 2 , Anja Mataruga 3 and...

13
560
0

Báo cáo Y học: The mitochondrial-lysosomal axis theory of aging Accumulation of damaged mitochondria as a result of imperfect autophagocytosis ppt

Ngày tải lên : 17/03/2014, 23:20

... cardiomyopathy. Intern. Med. 34, 670–673. 51. Wada, H., Woo, M., Nishio, H., Nagaki, S., Yanagawa, H., Imamura, A. , Yokoyama, S., Ohbayashi, C., Matsuo, M., Itoh, H. & Nakamura, H. (1996) Vascular ... 774–779. 48. Yoneda, M., Chomyn, A. , Martinuzzi, A. , Hurko, O. & Attardi, G. (1992) Marked replicative advantage of human mtDNA car- rying a point mutation that causes the MELAS encephalomyo- pathy. ... that the recycling mechanisms are inherently imperfect [15,25], and this may provide an attractive explanation for many of the features of aging. A number of early explanations of aging, such as Orgel’s...

7
444
0

Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot

Ngày tải lên : 23/03/2014, 05:22

... Idem MAP2-for MAP2-rev GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC 91489–91517 92431–92404 NC_000067 Idem Tau-for Tau-rev GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC 78772–78800 79013–78981 NC_000077 ... Quı ´ mica Biolo ´ gica, Facultad de Ciencias Quı ´ micas, Universidad Nacional de Co ´ rdoba, Argentina 2 Departamento de Biologı ´ a Molecular, Facultad de Ciencias Exactas, Fı ´ sico-Quı ´ micas ... Idem Doublecortin-for Doublecortin-rev CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG 705–728 967–943 NM_010025 Idem LIS1-for LIS1-rev CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG 1288–1303 1427–1407 NM_95116 Idem Tubulin a6 -for Tubulin a6 -rev AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA 6854–6876 7646–7624 NC_000081...

14
416
0

A Study on the Effects of Argentine Tango as a Form of Partnered Dance for those with Parkinson Disease and the Healthy Elderly pptx

Ngày tải lên : 28/03/2014, 20:20

... to Madeleine Hackney and a grant from the American Parkinson Disease Association to Gammon Earhart. References Argue, J. (2000) Parkinson’s disease and the art of moving. Oakland, CA: New Harbinger. Beauchet, ... et al. Adherence to an exercise program may be more likely if it is novel and enjoyable. A study of those at risk of heart failure found that the waltz was just as good as traditional aerobic ... phenomenon, and it is deserving of attention (Judge 2003; Pratt 2004). Argentine tango has recently emerged as a promising non-traditional approach to ameliorating balance and gait problems among elderly individuals....

19
648
0

A Portrait of the Artist as a Young Man ppt

Ngày tải lên : 31/03/2014, 14:20

... bat- tleeld of Prague far away over the sea. He was standing on the eld; his hand was pressed to his side; his face was pale and strange and he wore the white cloak of a marshal. O how cold and strange ... was a noise of curtain-rings running back along the rods, of water being splashed in the basins. ere was a noise of rising and dressing and washing in the dormitory: a noise of clapping of ... O’SHEA! —And what did you do, John? asked Mr Dedalus. —I let her bawl away, said Mr Casey. It was a cold day and to keep up my heart I had (saving your presence, ma’am) a quid of Tullamore...

317
341
0

Research report: "Writing in teams to improve writing skills for students of English Language at the University of Vinh" doc

Ngày tải lên : 23/07/2014, 13:20

... individual-based activities into a community-based workshop with various interactive activities. Table 1: Teachers' ideas about advantages and disadvantages of group writing Advantages Disadvantages ... an understanding of the need and interest of each class on the part of the teacher. Vietnamese classes of English are often very big. In regular classes, students are often of the same age, ... marks of group papers, individual papers and examination papers. IV. Impications for Vietnamese classrooms 4.1. Class management and preparation 4.1.1. Class management This factor...

10
540
4

báo cáo khoa học: "Clinical relevance of "withdrawal therapy" as a form of hormonal manipulation for breast cancer" doc

Ngày tải lên : 09/08/2014, 02:21

... 9:101 http://www.wjso.com/content/9/1/101 Page 2 of 4 RESEARC H Open Access Clinical relevance of “withdrawal therapy” as a form of hormonal manipulation for breast cancer Amit Agrawal * , John FR Robertson and KL Cheung Abstract Background: ... operable primary breast cancer in elderly (age > 70 years), locally advanced or metastatic breast cancer; (2) disease deemed suitable for treatment by hormonal manipulation; (3) disease assessable ... [http://www. breastinternationalgroup.org/LinkClick.aspx?fileticket=dmcZc0avwBc% 3d&tabid=2341]. doi:10.1186/1477-7819-9-101 Cite this article as: Agrawal et al.: Clinical relevance of “withdrawal therapy” as a form of hormonal manipulation...

4
253
0

báo cáo khoa học: "The applicability of normalisation process theory to speech and language therapy: a review of qualitative research on a speech and language intervention" pps

Ngày tải lên : 10/08/2014, 11:20

... RESEARC H Open Access The applicability of normalisation process theory to speech and language therapy: a review of qualitative research on a speech and language intervention Deborah M James Abstract Background: ... 2009). Authors’ Information DJ prepared this article whilst employed as an academic speech and language therapist in Speech and Language Sciences at Newcastle University, UK. During that time she was ... was a collaborating member of the Institute of Health and Society and was mentored by Professor Carl May. DJ is now working as a translational scientist in child and family at the NIHR National...

10
600
0

báo cáo khoa học: "Pyosalpinx as a sequela of labial fusion in a post-menopausal woman: a case report" pptx

Ngày tải lên : 10/08/2014, 22:20

... the anatomical area of the right adnexa. Our patient had developed a pyosalpinx as a Sequela of labial fusion. At laparoscopy the right pyosalpinx was identified and resected, whereas the labia ... complications of this presentation are infections of the urinary tract and retention of urine in the vagina. We present the case of a post-menopausal woman with adnexal mass and abdominal pain ... the article as it appeared upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon. Pyosalpinx as a sequela of labial fusion in a post-menopausal woman: a...