Goodwill Impairment Charges Under Sfas 142: Role Of Executives’ Incentives And Corporate Governance
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA GAACCTTTATTCGCTATTGGTACCGGTAAA GAACCTTTATTCGCTATTGGTACCGGTAAA TCACCGGTCCATGATCCATT NcoI KpnI KpnI HaeIII 4178 FEBS Journal 276 (2009) 41694183 ê 2009 The Authors ... maintain the unusual Ramachandran angles for the K12 residue, and a Ramachandran scatter plot for the K12 residues in 21 TIM structures from various sources (available from the Protein Data Bank and ... W, Thanki N, Jaenicke R & Wierenga RK (1997) A double mutation at the tip of the dimer interface loop of triosephosphate isomerase generates active Effect of mutation on the dimer interface of...
- 15
- 635
- 0
Tài liệu Báo cáo khoa học: Role of hydroxyl group and R/S configuration of isostere in binding properties of HIV-1 protease inhibitors docx
... conformation of inhibitor main chain Thus, different inhibitors differ not only in the binding affinity, but also in the degree of freedom of the inhibitor inside the binding tunnel Some special inhibitors ... the inhibitor to the protease but also of the protease to the inhibitor Comparison of inhibitors side chains Boc groups at P2 of SE and RE inhibitors lie in the same position Only in the case of ... substitutes the role of the hydroxyl group in hydroxyethylene inhibitors In this paper, we present another unusual binding mode of the ethyleneamine inhibitor OE where only its isostere NH group makes...
- 11
- 615
- 0
Báo cáo khoa học: The role of helix 8 and of the cytosolic C-termini in the internalization and signal transduction of B1 and B2 bradykinin receptors potx
... in Role of helix and C-termini in bradykinin receptors receptor signaling because: (a) interruption of the amphipathic structure of B1wt helix in B1wt and B1KB2 through the presence of a serine ... TSIfiAAA N3 38* B1wt B1RB2 B1NB2 B1CB2 B1KB2 B1KB2 ⁄ SfiV B1KB2 ⁄ QGVfiKQ B1KB2 ⁄ VCfiCV B1YB2 B1V323S 10400 5020 52 98 383 2 625 127 511 1701 182 3 17 58 2142 1 786 2957 84 6 3.91 ± 1.06 3.76 ± 1.61 2 .82 ± 0.92 ... Faussner et al Role of helix and C-termini in bradykinin receptors Fig Schematic representation of the C-terminal B1wt and B2wt sequences and chimera thereof The C-terminal sequences beginning at transmembrane...
- 12
- 595
- 0
Role of an electrolyte and substrate on the stability of porous silicon
... conforms the viability of textured substrates and ethanol-based electrolyte as a requisite condition for the formation of highly luminescent, thick and stable porous silicon films Porous silicon ... luminescent properties and stability of porous silicon films Conclusions The visual observation of mechanically strong, stable surface bond configuration, smooth surface morphology and hydrogen-passivated ... evaluating the degradation of stability of PS on electrolyte (HF–C2H5OH and HF–H2O2) and current density formed on textured and polished Si substrates, respectively The emphasis is mainly 265 on the...
- 9
- 537
- 0
Báo cáo khoa học: Role of glutaredoxin 2 and cytosolic thioredoxins in cysteinyl-based redox modification of the 20S proteasome docx
... Rhee SG (20 01) Inactivation of human FEBS Journal 27 5 (20 08) 29 42 29 55 ª 20 08 The Authors Journal compilation ª 20 08 FEBS 29 53 Cysteinyl-based modification of the 20 S proteasome 10 11 12 13 14 15 ... investigating whether that common feature is related to their easy entry into the latent 20 S particle Cysteinyl-based modification of the 20 S proteasome According to our data, Grx2 is ubiquitinated ... preparations obtained FEBS Journal 27 5 (20 08) 29 42 29 55 ª 20 08 The Authors Journal compilation ª 20 08 FEBS 29 43 Cysteinyl-based modification of the 20 S proteasome G M Silva et al from cells grown in glycerol...
- 14
- 364
- 0
Báo cáo khoa học: The role of residues R97 and Y331 in modulating the pH optimum of an insect b-glycosidase of family 1 pdf
... determined and quantied To ll these gaps, residues Y3 31, R97 and E187 of Sfbgly50 were replaced through site-directed mutagenesis by phenylalanine (Y331F), methionine (R97M), lysine (R97K) and ... stability of the recombinant Sfbgly50 (n) was checked by incubating the enzyme in the same buers for an equal length of time and determining the remaining activity in the pH optimum Fig Inactivation of ... 97 and 3 31 side chains are conserved in the mutants R97M and Y331F, but the hydrogen bond-forming atoms have been removed In mutant E187D, the distance between the catalytic nucleophile and the...
- 10
- 522
- 0
Families Under Stress - An Assessment of Data, Theory, and Research on Marriage and Divorce in the Military pptx
... to ensure high standards for research quality and objectivity Families Under Stress An Assessment of Data, Theory, and Research on Marriage and Divorce in the Military Benjamin R Karney, John ... Telephone: (310) 45 1-7 002; Fax: (310) 45 1-6 915; Email: order@rand.org Preface Since the onset of the military operations in Afghanistan and Iraq, the demands on the military have been higher than they ... data, theory, and research on marriage and divorce in the military UB403.K36 2007 306.8088'35500973—dc22 2007011014 The RAND Corporation is a nonprofit research organization providing objective analysis...
- 246
- 386
- 0
Báo cáo khoa học: Dissecting the role of protein–protein and protein–nucleic acid interactions in MS2 bacteriophage stability potx
... protein–RNA and protein–protein interactions in virus stability, measuring the effects of urea, GdnHCl and high pressure on the structure and stability of whole particles (bacteriophage MS2 and ... the role of protein–protein and protein–RNA interactions in virus stability is not completely understood, and we have investigated these questions in this work We sought to determine the role of ... [5,14] To understand the importance of capsid protein–protein contacts for the stability of coat protein, we determined the stability of dlFG and compared it with the stability of the genetically...
- 13
- 448
- 0
Báo cáo khoa học: Role of the N- and C-terminal regions of the PufX protein in the structural organization of the photosynthetic core complex of Rhodobacter sphaeroides pptx
... processes of the assembled PufX protein The exchange of ubiquinone between the RC and the cyt bc1 in the presence of mutated PufX protein The role of the PufX protein in facilitating the ubiquinone/ ... important role in the structure of the core complex [12], we decided to investigate the possible structural role of the N-terminus and the C-terminus of PufX To this aim, nine strains of Rb sphaeroides ... important protein protein hydrophobic interactions are made by the PufX N-terminus In the case of the longest N-terminal deletion (strain PufXD2)26), the PufXD2)26 protein is not detectable in the core...
- 9
- 547
- 0
Báo cáo hóa học: " The role of feed-forward and feedback processes for closed-loop prosthesis control" doc
... the role of feedback under motor uncertainty, such as is more typical in real-world situations We added random delays to the hand motion before the onset of movement and before the onset of the ... utility of feedforward control We hypothesised that this would increase their dependency on vibrotactile feedback Together these experiments provide a window into the role of feedforward and feedback ... viable platform to test this hypothesis Multifunction prostheses of the future offer increased dexterity and functionality at the expense of additional feedforward and feedback demands (as discussed...
- 12
- 503
- 0
báo cáo hóa học:" The role of FGF-2 and BMP-2 in regulation of gene induction, cell proliferation and mineralization" pptx
... article as: Hughes-Fulford and Li: The role of FGF-2 and BMP-2 in regulation of gene induction, cell proliferation and mineralization Journal of Orthopaedic Surgery and Research 2011 6:8 Submit ... Figure FGF-2 and BMP-2, the yin and yang of mineralization: Contrast of effect of 24 hours of treatment with FGF-2 or BMP2 on fold increase in abundance of mineralization-related gene expression Mineralizing ... maintained the mineralizing RNA profile of igf-1, alp, and bmp-2 and significantly increased expression of other genes associated with mineralization like col1a1, fn, ilgf-1, noggin and oc Fgf-2, ...
- 8
- 547
- 0
Từ khóa: enos uncoupling in cardiovascular diseases the role of oxidative stress and inflammationthe role of teachers schools and communities in quality educationrole of oxidative stress and inflammationrole of oxidative stress and antioxidants in male infertilitywhat is the main role of mac address and ip address in computer networksexplain the role of art music and dance in african societythe role of students attitudes and motivation in second language learning in online language coursesthe role of sound music and sound effect in the film industrythe role of oxidative stress and inflammation in dry eye diseasethe role of civil society organisations in governancethe role of effective communication and interpersonal interaction in health and social careanalyze the role of critical thinking and education for lifewhat is the role of effective communication and interpersonal interaction in health and social carerole of language skills in corporate communicationthe role of oxidative stress and antioxidant treatment in experimental diabetic neuropathyNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ