... CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA GAACCTTTATTCGCTATTGGTACCGGTAAA GAACCTTTATTCGCTATTGGTACCGGTAAA TCACCGGTCCATGATCCATT NcoI KpnI KpnI HaeIII 4178 FEBS Journal 276 (2009) 41694183 ê 2009 The Authors ... maintain the unusual Ramachandran angles for the K12 residue, and a Ramachandran scatter plot for the K12 residues in 21 TIM structures from various sources (available f...
Ngày tải lên: 18/02/2014, 11:20
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Báo cáo khoa học: Role of hydroxyl group and R/S configuration of isostere in binding properties of HIV-1 protease inhibitors docx
... conformation of inhibitor main chain Thus, different inhibitors differ not only in the binding affinity, but also in the degree of freedom of the inhibitor inside the binding tunnel Some special inhibitors ... the inhibitor to the protease but also of the protease to the inhibitor Comparison of inhibitors side chains Boc groups at P2 of SE and RE inhibitors li...
Ngày tải lên: 19/02/2014, 16:20
Báo cáo khoa học: The role of helix 8 and of the cytosolic C-termini in the internalization and signal transduction of B1 and B2 bradykinin receptors potx
... in Role of helix and C-termini in bradykinin receptors receptor signaling because: (a) interruption of the amphipathic structure of B1wt helix in B1wt and B1KB2 through the presence of a serine ... TSIfiAAA N3 38* B1wt B1RB2 B1NB2 B1CB2 B1KB2 B1KB2 ⁄ SfiV B1KB2 ⁄ QGVfiKQ B1KB2 ⁄ VCfiCV B1YB2 B1V323S 10400 5020 52 98 383 2 625 127 511 1701 182 3 17 58 2142 1 786...
Ngày tải lên: 07/03/2014, 16:20
Role of an electrolyte and substrate on the stability of porous silicon
... conforms the viability of textured substrates and ethanol-based electrolyte as a requisite condition for the formation of highly luminescent, thick and stable porous silicon films Porous silicon ... luminescent properties and stability of porous silicon films Conclusions The visual observation of mechanically strong, stable surface bond configuration, smooth s...
Ngày tải lên: 16/03/2014, 15:19
Báo cáo khoa học: Role of glutaredoxin 2 and cytosolic thioredoxins in cysteinyl-based redox modification of the 20S proteasome docx
... Rhee SG (20 01) Inactivation of human FEBS Journal 27 5 (20 08) 29 42 29 55 ª 20 08 The Authors Journal compilation ª 20 08 FEBS 29 53 Cysteinyl-based modification of the 20 S proteasome 10 11 12 13 14 15 ... investigating whether that common feature is related to their easy entry into the latent 20 S particle Cysteinyl-based modification of the 20 S proteasome...
Ngày tải lên: 23/03/2014, 07:20
Báo cáo khoa học: The role of residues R97 and Y331 in modulating the pH optimum of an insect b-glycosidase of family 1 pdf
... determined and quantied To ll these gaps, residues Y3 31, R97 and E187 of Sfbgly50 were replaced through site-directed mutagenesis by phenylalanine (Y331F), methionine (R97M), lysine (R97K) and ... stability of the recombinant Sfbgly50 (n) was checked by incubating the enzyme in the same buers for an equal length of time and determining the remaining activity...
Ngày tải lên: 23/03/2014, 15:21
Families Under Stress - An Assessment of Data, Theory, and Research on Marriage and Divorce in the Military pptx
... to ensure high standards for research quality and objectivity Families Under Stress An Assessment of Data, Theory, and Research on Marriage and Divorce in the Military Benjamin R Karney, John ... Telephone: (310) 45 1-7 002; Fax: (310) 45 1-6 915; Email: order@rand.org Preface Since the onset of the military operations in Afghanistan and I...
Ngày tải lên: 29/03/2014, 19:20
Báo cáo khoa học: Dissecting the role of protein–protein and protein–nucleic acid interactions in MS2 bacteriophage stability potx
... protein–RNA and protein–protein interactions in virus stability, measuring the effects of urea, GdnHCl and high pressure on the structure and stability of whole particles (bacteriophage MS2 and ... the role of protein–protein and protein–RNA interactions in virus stability is not completely understood, and we have investigated these questions in...
Ngày tải lên: 30/03/2014, 11:20
Báo cáo khoa học: Role of the N- and C-terminal regions of the PufX protein in the structural organization of the photosynthetic core complex of Rhodobacter sphaeroides pptx
... processes of the assembled PufX protein The exchange of ubiquinone between the RC and the cyt bc1 in the presence of mutated PufX protein The role of the PufX protein in facilitating the ubiquinone/ ... important role in the structure of the core complex [12], we decided to investigate the possible structural role of the N-te...
Ngày tải lên: 31/03/2014, 09:20
Báo cáo hóa học: " The role of feed-forward and feedback processes for closed-loop prosthesis control" doc
... the role of feedback under motor uncertainty, such as is more typical in real-world situations We added random delays to the hand motion before the onset of movement and before the onset of the ... utility of feedforward control We hypothesised that this would increase their dependency on vibrotactile feedback Together these experiments provide a window into the r...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học:" The role of FGF-2 and BMP-2 in regulation of gene induction, cell proliferation and mineralization" pptx
... article as: Hughes-Fulford and Li: The role of FGF-2 and BMP-2 in regulation of gene induction, cell proliferation and mineralization Journal of Orthopaedic Surgery and Research 2011 6:8 Submit ... Figure FGF-2 and BMP-2, the yin and yang of mineralization: Contrast of effect of 24 hours of treatment with FGF-2 or BMP2 on fold increase in...
Ngày tải lên: 20/06/2014, 04:20