Slide matlab based transient stability analysis of a power system

... Pa (d δ) =A2 (negative area); EQUAL AREA CRITERION (cont.) A 1= Area of acceleration A2 = Area of deceleration If the area of acceleration is larger than the area of deceleration, i.e., A > A2 ... 1964) RAMNARAYAN PATEL, T S BHATTI and D P KOTHARI Centre for Energy Studies, Indian Institute of Technology, Hauz Khas, New Delhi, India MATLAB/ Simulink -based transient stabil...

Ngày tải lên: 03/12/2016, 14:16

... V RELIABILITY ANALYSIS OF THE POWER SYSTEM The reliability of the power system is analyzed using the multi- state system theory According to (2), the universal generating function of the battery ... this paper, and is compared 97 (1) The reliability of the power system obtained by the traditional system reliability theory is always co...

Ngày tải lên: 03/01/2014, 19:38

... capacity and location There are two distinct means of placing a FACTS device in the system for the purpose of increasing the system s ability to transmit power, thereby allowing for the use of ... capacitors at weak buses But with FACTS devices both the active and reactive power flow pattern can be changed and significant system performance is noticed Th...

Ngày tải lên: 26/03/2016, 02:38

... Performance Analysis of T-GSC in Nakagami Channels 245 ¯ ¯ where βmax = γmax / γ and βth = γth / γ Note that the solution in (5) for Nakagami fading is valid only for integer values of the Nakagami ... I Sulyman and M Kousa, Bit error rate performance of a generalized diversity selection combining scheme in Nakagami fading channels,” in Proc IEEE Wir...

Ngày tải lên: 23/06/2014, 00:20

... Friedman and Maniatis Genome Biology 2011, 12:R69 http://genomebiology.com/2011/12/7/R69 SOFTWARE Open Access ExpressionPlot: a web-based framework for analysis of RNA-Seq and microarray gene expression ... data Brad A Friedman1,2,3* and Tom Maniatis4 Abstract RNA-Seq and microarray platforms have emerged as important tools for detecting changes in gene...

Ngày tải lên: 09/08/2014, 23:20

... manual and automated analysis Correlation between manual and automated analysis In this evaluation, 45 experiments (each consisting of two microscopic slides) were analyzed by a human expert as well ... Binarize enhanced image based on color saturation • Classifiy object on axis of maximum discriminance • Transform feature vector into one dimension via LDA Figure Image an...

Ngày tải lên: 12/08/2014, 05:20

... risk of contracting a hip fracture during subsequent years, result in zero net costs and an increase in health of 35 QALYs, in comparison with a do-nothing alternative All sensitivity analyses, including ... risk that mere chance affects the estimates The effect evaluation data was however analysed in a longitudinal analysis, that seeks to take account of both within-ar...

Ngày tải lên: 13/08/2014, 11:22

... plasmid backbone in DNA vaccines We examined the use of a novel L lactis vector as the plasmid backbone in DNA vaccines The main advantages of this vector and its production strain are avoidance ... Immunological properties of bacterial DNA Ann N Y Acad Sci 1995, 772:152-163 Yamamoto S, Yamamoto T, Shimada S, Kuramoto E, Yano O, Kataoka T, Tokunaga T: DNA from bacteria, but no...

Ngày tải lên: 14/08/2014, 19:22

... understand the behavior of the variables involved in economical and financial assessing of a wind farm as a manner of validating the indicators of attractiveness and risk of energy projects and analysis ... projects and costs evaluation The economic assessment of hypothetical wind farm installed in Caldas da Rainha, we obtained the following results: Attr...

Ngày tải lên: 05/09/2013, 14:59

... types of Darrieus rotors are mainly available, namely troop skein (Eggbeater) Darrieus rotor and H-Darrieus rotor H-Darrieus rotor was in the same patent of 1931[2] It has two to three airfoil shaped ... 0.265 at a TSR of 2.214, and the maximum Ct obtained is 0.124 at a TSR of 1.962 And the standard deviation of computational Cp from experimental Cp is 0.81% an...

Ngày tải lên: 05/09/2013, 15:28

... GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGCCCTTCCGGAGAAGA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGGCACTTAACCCATG ... GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTATGGAGTTGAACTAGCTGT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCC...

Ngày tải lên: 22/02/2014, 04:20

... Financial Crimes Enforcement Network  Mortgage Loan Fraud Financial Crimes Enforcement Network Mortgage Loan Fraud An Update of Trends based Upon an Analysis of Suspicious Activity Reports ... 2006 and March 2007 Mortgage Loan Fraud: An Industry Assessment based upon Suspicious Activity Report Analysis, ” see http://www.fincen.gov/MortgageLoanF...

Ngày tải lên: 06/03/2014, 19:20

... and Crystal structure of Staphylococcus aureus EF -G Carl Trygger’s Foundation to M Selmer and S Sanyal, the Goran Gustafsson Foundation to S Sanyal, ¨ and Magnus Bergvall’s foundation and the ... Crystal structure of a mutant elongation factor G trapped with a GTP analogue FEBS Lett 579, 449 2–4 497 Laurberg M, Kristensen O, Martemyanov K, Gudkov AT, Nagaev I...

Ngày tải lên: 06/03/2014, 22:21