design and fe analysis of a 150 kw machine
Lightweight Electric/Hybrid Vehicle Design ppt
... substructures and individual elements Designing against fatigue Finite-element analysis (FEA) Case study of FEA for EVs and structural analysis assemblies Running gear design for optimum performance and ... Faculty and became a member of the first year’s intake of Graduate Apprentices at General Motors’ UK Vauxhall subsidiary He later worked as a chassis-systems layout draughtsman with the company before ... any surplus mass These structural analysis techniques gave early warning of buckling collapse and provided a means of idealization that allowed load paths to be traced In the dramatic weight reduction...
- 280
- 555
- 0
Lightweight Electric/Hybrid Vehicle Design docx
... substructures and individual elements Designing against fatigue Finite-element analysis (FEA) Case study of FEA for EVs and structural analysis assemblies Running gear design for optimum performance and ... Faculty and became a member of the first year’s intake of Graduate Apprentices at General Motors’ UK Vauxhall subsidiary He later worked as a chassis-systems layout draughtsman with the company before ... any surplus mass These structural analysis techniques gave early warning of buckling collapse and provided a means of idealization that allowed load paths to be traced In the dramatic weight reduction...
- 280
- 434
- 0
Lightweight Electric/Hybrid Vehicle Design pptx
... substructures and individual elements Designing against fatigue Finite-element analysis (FEA) Case study of FEA for EVs and structural analysis assemblies Running gear design for optimum performance and ... Faculty and became a member of the first year’s intake of Graduate Apprentices at General Motors’ UK Vauxhall subsidiary He later worked as a chassis-systems layout draughtsman with the company before ... any surplus mass These structural analysis techniques gave early warning of buckling collapse and provided a means of idealization that allowed load paths to be traced In the dramatic weight reduction...
- 280
- 333
- 0
Lightweight Electric/Hybrid Vehicle Design Ron ppt
... substructures and individual elements Designing against fatigue Finite-element analysis (FEA) Case study of FEA for EVs and structural analysis assemblies Running gear design for optimum performance and ... Faculty and became a member of the first year’s intake of Graduate Apprentices at General Motors’ UK Vauxhall subsidiary He later worked as a chassis-systems layout draughtsman with the company before ... any surplus mass These structural analysis techniques gave early warning of buckling collapse and provided a means of idealization that allowed load paths to be traced In the dramatic weight reduction...
- 280
- 492
- 0
Báo cáo khoa học: Isolation, characterization and expression analysis of a hypoxia-responsive glucose transporter gene from the grass carp, Ctenopharyngodon idellus potx
... 5¢-CCTGATCGACGCACGAGT-3¢ and GT1-R, 5¢-TTTTGCAAGTCATAGTAATCAGTTT-3¢ for GTcDNA1 ( 2150 bp); and GT2-F, 5¢-CACCAGCAACTAC CTGATCGA-3¢ and GT2-R, 5¢-CACAAAATATGCTT CCAAGTGC-3¢ for GT-cDNA2 (3043 bp) RNA isolation and ... for 3¢-RACE were: Primer C, 5¢-CCAGTGTCCCCAT CATCAG-3¢ and Primer D, 5¢-GGCAATTTTAAA GTCATTATGGCGCAAA-3¢ First strand cDNAs were synthesized using Superscript II RNase H– reverse transcriptase (Invitrogen) ... ORF showed that it encodes a putative polypeptide of 533 amino acids, with a predicted molecular mass of 57 kDa and a pI of 8.34 A database search using BLASTX showed that the ORF shared high...
- 8
- 465
- 0
Báo cáo Y học: Heterologous expression and folding analysis of a b-tubulin isotype from the Antarctic ciliate Euplotes focardii ppt
... the Materials and methods section and analysed by SDS/ Fig Immunodetection of CCT a- subunit in the cytoplasm of E focardii SDS/PAGE of an E focardii cytoplasmic fraction (20 lg, lane 1) and of ... immediately after dilution or after h of incubation at 30 °C b-T1 behaviour was similar to that of b5 tubulin [33] At early times, the bulk of the radioactivity migrates as a broad band with a slower ... from rabbit reticulocyte lysate (2 lg and lg in lanes and 3, respectively) Lanes and were Western blotted and immunostained by an anti-(TCP- 1a) polyclonal Ig Lane was Coomassie stained Molecular...
- 7
- 500
- 0
DELIVERING HEALTH EDUCATION VIA THE WEB: DESIGN AND FORMATIVE EVALUATION OF A DISCOURSE-BASED LEARNING ENVIRONMENT pot
... Postgraduate Award and a Social Sciences and Humanities Research Council of Canada Doctoral Fellowship 474 Delivering Health Education via the Web: Design and Formative Evaluation REFERENCES Agostinho, ... discussion); and, a ‘Discussion Area’ For each activity, a single graphic was selected and placed at the top left corner of each page of that activity as a visual cue for students engaged in a particular ... activities and tasks in more detail resulted in a clarification of the structure of each learning activity and thus, a proliferation of pages for each activity Now, each learning activity is associated...
- 12
- 411
- 0
Báo cáo hóa học: " Research Article Design and Experimental Evaluation of a Vehicular Network Based on NEMO and MANET" pdf
... every packet being encapsulated and decapsulated both at MR and HA (3) Bottlenecks in HA is an important problem, since a significant amount of traffic for MNNs is aggregated at HA, particularly when ... reports the amount of transferred data and used bandwidth Additionally, the GPS patch appends location information (latitude and longitude) as well as the offset and distance from the starting point ... regarding NEMO and MANET, are also introduced, such as Multihoming, Route Optimization, and MANEMO 2.1 VANET Vehicular Ad hoc Networks (VANET) are a particular case of MANET, but they are characterized...
- 18
- 596
- 0
Báo cáo hóa học: " Research Article Design and Performance Analysis of an Adaptive Receiver for Multicarrier DS-CDMA" doc
... data, Tb is the transmission interval for each block of data, pτ (t) is defined as the rectangular pulse waveform with unit amplitude and duration τ, ωq and φq are the frequency and random phase ... precise estimate of the MAI A partial PIC is proposed in [24] to mitigate the effect of unreliable MAI estimation Motivated by [24], a hybrid approach comprising of the PIC and an adaptive technique ... can then be obtained by using (26) and (27), with Var[IMAI ] replaced by Var[IMAI ] An alternative derivation of the BER of the CPIC receiver can be obtained by regarding the CPIC as a special...
- 10
- 436
- 0
Báo cáo nghiên cứu khoa học: " EXPERIMENTAL AND THEORETICAL ANALYSIS OF A CRITICAL CHEMICAL REACTION: DECOMPOSITION OF HYDROGEN PEROXIDE (H2O2)" potx
... mass and energy balances The heat data obtained from the reaction calorimetry were fitted to a mathematical model based on mass and energy balances for a batch reactor coupled by the reaction rate ... peroxide and catalyst concentration and of the initial temperature of the reactor on the reaction rate and the heat flow behavior were evaluated The hydrogen peroxide solution used was a 30% mass ... temperature was higher The maximal difference between the values has a factor of The difference between the values of k and kwirges was not as big as the one found when assuming first order reaction...
- 9
- 463
- 0
Báo cáo y học: "ptimized design and data analysis of tag-based cytosine methylation assays" pps
... HpaII/MspI sites The means of normalization of HpaII by MspI using an angular metric is an innovation that improved the data accuracy substantially and may have applications in other MPS assay ... A GC AG AG G C T TC T A A G C A C A G C A T C 3882330 3882340 3882350 T G G C C A A C G A AG CC A G C A CC A C A GG C A GG C A C T MspI hit dbSNP Observed rs6748872 GTCTGGAGCAGAGGCTTCTAAGCACAGCAT ... strengths of MSCC and HELP-seq/Methylseq, and the supporting analytical workflow that maximizes the quantitative capabilities of the data generated Results and discussion Library preparation and sequencing...
- 11
- 345
- 0
Báo cáo y học: " Chemical fingerprinting and quantitative analysis of a Panax notoginseng preparation using HPLC-UV and HPLC-MS" pdf
... [Journal of Pharmaceutical and Biomedical Analysis 41 (2006) 274-279], (B) [Journal of Pharmaceutical and Biomedical Analysis 48 (2008) 1361-1367], (C) [Journal of Pharmaceutical and Biomedical Analysis ... The similarities of chromatograms of 10 samples (n = 3) Additional file 3: PDA Chromatograms standard compounds (A) and a XST injection (C), and total ion current chromatograms of standard compounds ... and quantitative analysis and wrote the manuscript PYS and QS assisted HY to identify the characteristic peaks using HPLC-PDA/ESI-MSn All authors read and approved the final version of the manuscript...
- 8
- 471
- 0
Design and control methodology of a lower extremity assistive device
... particular, I would like to thank Albertus Hendrawan, Huang Weiwei, Tan Boon Hwa, Syeda Mariam Ahmed, Mohan Gunasekaran, Peng Chang, Chen Nutan, Feng Xiaobing, Chao Shuzhe, Chanaka Dilhan Senanayake, ... motion of the device should be at least equal to the human range of motion during gait rehabilitation and activities of daily living (ADL) These data can be found by examining of clinical gait analysis ... 2.3 Summary In this chapter, we gave an overview of lower extremity exoskeleton research in a range of applications The advantages and disadvantages of several types of control methods are also...
- 118
- 425
- 1
Design and performance analysis of efficient wireless systems
... xiv Abbreviations ABEP Average Bit Error Probability AF Amplify -and- Forward ARQ Automatic Repeat Request ASSA Automatic Step-Size Adjustment AWGN Additive White Gaussian Noise A- ML Averaged Maximum ... and analysis of the ABEP-based and the BEOP-based power control laws are generalized for both BPSK and quadrature phase shift keying (QPSK) modulations 1.2.2 Receiver Design and Performance Analysis ... or say, decorrelated due to the delay This is a practical and general model for the design and performance analysis of actual feedback systems Based on this model, we develop both the ABEP-based...
- 195
- 377
- 0
Design and performance analysis of quadratic form receivers for fading channels
... coherent, partially coherent and differentially coherent detections can also be cast into a quadratic form of complex Gaussian random variables, and all these receivers can be classified as quadratic-form ... training signals to extract CSI is infeasible or impractical, Marzetta and Hochwald analyzed the capacity of multiple-antenna links without knowledge of channel gains at both transmitters and receivers ... we are also interested in the error performance analysis of a general QFR, which takes the general quadratic form in complex Gaussian random variables as the decision metric and is a general...
- 291
- 1,298
- 0
Design and performance analysis of MIMO space time block coding systems over general fading channels
... variables, each with a deterministic mean Mmn and variance 2σmn Since the channels are non-identical, each channel can have a different mean and a different variance We assume the channel matrix ... three cases above show that the imbalance of different channel parameters can have different effects on the performance of STBC, and our analytical BEP results (2.28) and (2.30) can easily be applied ... cooperative STBC avr avr avr avr with full, partial and no CSI ESD = ERD and ESR /No = ESD − 10 dB.122 x Abbreviations AF amplify -and- forward AWGN additive white Gaussian noise BEP bit error porbability...
- 162
- 272
- 0
Identification, characterization and expression analysis of a novel TPA (12 0 tetradecanoylphorbol 13 acetate) induced gene
... (20-22) A molecular and pathological analysis of evolving pancreatic adenocarcinoma has revealed a characteristic pattern of genetic lesions The challenge now is to understand how these signature ... that the activation of telomerase is a late event (58-60) BRCA2 Inherited BRCA2 mutations are typically associated with familial breast and ovarian cancer syndrome, but also carry a significant ... differentiation and proliferation Other growth factors such IGF-I and PDGF play a role in pancreatic development (1-5) 1.1.2 Cancer of the Pancreas The vast majority of cases of pancreatic cancer...
- 118
- 501
- 0
NATIONAL REPORT OF MALAYSIA ON THE FORMULATION OF A TRANSBOUNDARY DIAGNOSTIC ANALYSIS AND PRELIMINARY FRAMEWORK OF A STRATEGIC ACTION PROGRAMME FOR THE BAY OF BENGAL potx
... Peninsular Malaysia and the states of Sabah and Sarawak in the north of Kalimantan Kuala Lumpur, the national capital, Labuan UNEP/SCS – National Report Malaysia and Putra Jaya form the Federal territories ... Straits of Malacca and the adjacent waters of the Andaman Sea and the Indian Ocean In the process, an attempt is made to identify, examine, and rank those threats that have transboundary effects ... meters and with a tidal stream of over knots The West Coast of Peninsular Malaysia has an equatorial climate, with an average annual rainfall of more than 2500mm and a daily temperature that ranges...
- 88
- 581
- 0
Báo cáo khoa học: Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid pdf
... displayed as side chains and located in domain III, domain V and the interface of domains G, III and V (B) Mutation sites in domain III that may affect the FA-binding pocket Mutation sites are ... helices AV and BV at the surface of domain V Gly621 and Gly617 are in the area of contact with the 1095 and 2473 regions of 23S RNA The two helices are facing the ribosome, and the four-stranded ... Helgstrand M, Mandava CS, Mulder FA, Liljas A, Sanyal S & Akke M (2007) The ribosomal stalk binds to translation factors IF2, EF-Tu, EF-G and RF3 via a conserved region of the L12 C-terminal domain...
- 15
- 474
- 0
Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot
... aureus, one of the most important Gram-positive pathogens of humans and animals, is a highly versatile bacterium capable of causing a wide spectrum of diseases, ranging from superficial skin infections ... produces a variety of cell surface-associated and extracellular factors that enable bacteria to colonize and multiply within the host to evade host defences and to destroy host tissues [11] Attachment ... region of FnBPA Finally, we selected and characterized a mAb produced against the recombinant repetitive region of FnBPB that recognizes an epitope shared by repeats of FnBPA and FnBPB, and inhibits...
- 16
- 560
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25