Effects of a chair yoga exercises on stress hormone levels, daily life activities, falls and physical fitness in institutionalized older adults

... was able to maintain the and physical fitness and levels of stress hormonals (sCOR and sAA) protecting against stress and infection; • This study revealed that hormonal levels of stress are a promising ... ACCEPTED MANUSCRIPT SC RI PT Effects of a chair- yoga exercises on stress hormone levels, daily life activities, falls and physical fitness in institutionalized older adults Furtado, GE1, *, Uba-Chupel, ... was to evaluate the effects of a chair- based yoga exercise program on stress hormone levels, ADL, fear of falling and PF in institutionalized older adults EP Methods 2.1 Initial Procedures AC...

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

... CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA GAACCTTTATTCGCTATTGGTACCGGTAAA GAACCTTTATTCGCTATTGGTACCGGTAAA TCACCGGTCCATGATCCATT NcoI KpnI KpnI HaeIII 4178 FEBS Journal 276 (2009) 41694183 ê 2009 The Authors ... maintain the unusual Ramachandran angles for the K12 residue, and a Ramachandran scatter plot for the K12 residues in 21 TIM structures from various sources (available from the Protein Data Bank and ... W, Thanki N, Jaenicke R & Wierenga RK (1997) A double mutation at the tip of the dimer interface loop of triosephosphate isomerase generates active Effect of mutation on the dimer interface of...

báo cáo khoa học: " Short- and long-term effects of a quality improvement collaborative on diabetes management" pptx

... multifaceted implementation approach emphasizing collaborative learning and exchange of insights and support among a set of healthcare organizations, like a quality improvement collaborative ... albumin, and BMI per patient per year were performed Data about annually foot and eye examinations, consultations with dieticians and podiatrists, and counseling (advice and instruction to monitor ... package of ideas (change concepts) for closing the gap between best and actual practice The package was based on national and international diabetes guidelines, field surveys, personal experience, and...

báo cáo khoa học:" Histological analysis of the effects of a static magnetic field on bone healing process in rat femurs" pptx

... contributions The comparison of test and control groups indicates that bone healing was accelerated by the effect of magnetic fields in all the conditions analyzed; The marked configuration of a bone ... surface On the external surface, its predominantly horizontal and flat direction maintained continuity and shape of the remaining cortical levels Trabecular proliferation was also apparent in a ... outlining the borders of the surgical bone cavity A distance of 1.3 mm separates the washers over the surgical cavity, corresponding to the area where the magnetic field operates P and D mark,...

Báo cáo y học: "Effects of a multi-herbal extract on type 2 diabete" pptx

... Shin TY, Kim HM: Antianaphylactic activity of Poncirus trifoliata fruit extract J Ethnopharmacol 1996, 54:77-84 11 Yamahara J, Yamada T, Kitani T, Naitoh Y, Fujimura H: Antianoxic action and active ... Salicylate-based antiinflammatory drugs inhibit the early lesion of diabetic retinopathy Diabetes 20 07, 56:337-345 26 Kaneto H, Matsuoka TA, Nakatani Y, Kawamori D, Miyatsuka T, Matsuhisa M, Yamasaki ... fractions Conclusion The aqueous extract of these seven hypoglycemic herbs demonstrated anti-diabetic effects on type diabetes Abbreviations ACS: acyl-CoA synthetase; AICAR: aminoimidazole carboxamide...

Tài liệu Time trends in leisure time physical activity and physical fitness in elderly people: 20 year followup of the Spanish population national health survey (1987-2006) docx

... al.: Time trends in leisure time physical activity and physical fitness in elderly people: 20 year followup of the Spanish population national health survey (1987 -200 6) BMC Public Health 201 1 ... prevent physical inactivity and improve the health status of older people in Spain List of abbreviations PA: Physical activity; LTPA: Leisure time physical activity; SNHS: The Spanish National Health ... population residing in main family dwellings (households) of Spain and is mainly performed by the Ministry of Health and Consumer Affairs and the National Statistics Institute (Instituto Nacional...

Tài liệu Báo cáo khoa học: Inhibitory effects of nontoxic protein volvatoxin A1 on pore-forming cardiotoxic protein volvatoxin A2 by interaction with amphipathic a-helix doc

... membrane Interactions between VVA1 and VVA2 B Fig Effects of volvatoxin A1 (VVA1) on the hemolytic and cytotoxic activity of volvatoxin A2 (VVA2) (A) The hemolytic activity of VVA2 regulated by VVA1 ... VVA2 can use VVA1 as a basis for the formation of VVA2 oligomers Interaction of VVA1 and VVA2 by amphipathic a-helix To identify the binding sites in VVA1 responsible for direct interaction with ... competition assay (A) Schematic representation of peptide competitors (B) Binding of volvatoxin A2 (VVA2) to volvatoxin A1 (VVA1) was inhibited by the amphipathic a-helices of VVA1 The VVA2 and VVA1...

Báo cáo khoa học: Effects of a novel arginine methyltransferase inhibitor on T-helper cell cytokine production pot

... [pii] Purandare AV, Chen Z, Huynh T, Pang S, Geng J, Vaccaro W, Poss MA, Oconnell J, Nowak K & Jayaraman L (2008) Pyrazole inhibitors of coactivator associated arginine methyltransferase (CARM1) ... were all effective methyltransferase inhibitors Only AMI-1 and AMI-6 demonstrated selectivity for the PRMTs, although AMI-6 was minimally active against a cellular PRMT substrate [8] Computational ... K Bonham et al 11 Clarke SG (2006) Inhibition of mammalian protein methyltransferases by 5¢-methylthioadenosine (MTA): a mechanism of action of dietary SAMe? In The Enzymes: Protein Methyltransferases...

Báo cáo khoa học: The effects of a-secretase ADAM10 on the proteolysis of neuregulin-1 pot

... ADAM10 For further conﬁrmation of these ﬁndings, we examined the myelination of peripheral nerves in ADAM10 transgenic mice and mice overexpressing dominant negative ADAM10 Because myelination ... Reconstitution experiments with transfection of ADAM10 in ADAM17) ⁄ ) embryonic mouse ﬁbroblasts [55] suggested only a minor inﬂuence of ADAM10 on neuregulin-1 shedding, but any positive proof ... For ADAM10 (detection by HA-antibody), one exemplary blot from the brain membrane fraction of four individuals is shown The proform of the proteinase is indicated by a black arrow head and the...

Báo cáo khoa học: Effects of a tryptophanyl substitution on the structure and antimicrobial activity of C-terminally truncated gaegurin 4 doc

... a GGN4 analogue with both the C-terminal 14 residue truncation and the substitution of the aspartic acid at position 16 by tryptophan, showed antimicrobial activity comparable to that of native ... the GGN4 analogues, including the native GGN4, showed a strong negative band near 200 nm and a weak and broad band around 222 nm, indicating a predominantly random-coil conformation with a slight ... perpendicular to the helical axis in panels A and B, and is parallel to the helical axis in panels C and D rapid exchange of the Hz amino protons This observation indicates that the lysine side-chains are...

báo cáo hóa học: " The effects of a graduated aerobic exercise programme on cardiovascular disease risk factors in the NHS workplace: a randomised controlled trial" pdf

... 93(2):221-5 Pearson TA, Mensah GA, Alexander RW, Anderson JL, Cannon RO, Criqui M: Markers of inflammation and cardiovascular disease: application to clinical and public health practice: A statement ... benefit of an increase in VO2 max future research should evaluate the implication of a higher intensity workplace exercise training programme on the modification of cardiovascular risk profile, ... time-line of the aerobic exercise training intervention programme Schematic Schematic experimental time-line of the aerobic exercise training intervention programme or afternoon breaks, to avoid...

báo cáo hóa học:" Effects of low power laser irradiation on bone healing in animals: a meta-analysis" pptx

... evaluation of bone healing after laser irradiation [25] They did not find any positive changes in biomechanical bone properties after laser irradiation, and concluded that low power laser irradiation did ... MA, Mayayo E: Bone fracture consolidate faster with low power laser Lasers Surgical Medicine 1987, 7(1):36-45 19 Yamada K: Biological effects of low power laser irradiation on clonal osteoblastic ... K, Takaoka K: Experimental evaluation on bone repairing activation effect of lasers based on bone morphologic protein Nippon Reza Igakkai Shi (The Journal of Japan Society for Laser Medicine)...

The effects of a RMB devaluation on ASEAN economies

... that the inclusion of Hong Kong with the PRC implies that the renminbi devaluation is also accompanied by a devaluation of the Hong Kong dollar by the same amount Now the likelihood of Hong Kong ... significant market share in textiles and apparel and other manufactures TABLE Market Share of ASEAN and China in Selected Markets (Asian Crisis Simulation Result) SECTORS USA EU JAPAN ASEAN China ASEAN ... Korea have been much lower In the case of ASEAN the computed average rate of real devaluation is only about 14.3% while it is only 8.8% for Korea TABLE Nominal Devaluation and Rates of Inflation...

Báo cáo lâm nghiệp: "Effects of a clear-cut on the in situ nitrogen mineralisation and the nitrogen cycle in a 67-year-old Douglas-fir (Pseudotsuga menziesii (Mirb.) Franco) plantation" potx

... lower than mineralisation Mineralisation and root uptake were generally lower during the winter season, but the dormant season is probably shorter than months, and a part of the calculated fluxes ... Pietikọinen and Fritze [63] measured no increase in nitrification in non-nitrifying soil, although mineralisation increased Finally, Barg and Edmonds [4] found no change in mineralisation and nitrification ... Throughfall and seepage water containers and the two winter stemflow containers were placed in closed pits and protected against freezing, light and variations in temperature [54] Containers were sampled...

Báo cáo lâm nghiệp: "Effects of a calcium deficiency on stomatal conductance and photosynthetic activity of Quercus robur seedlings grown on nutrient solution" pdf

... after stabilisation of stomatal conductance, the shoot was transferred to a tube containing an aqueous solution of ABA (10 M) Stomatal conductance was fol-3 lowed with a porometer (Delta-T Device, ... maintenance of CO concentrations in the sub2 stomatal spaces (c and a decrease of CO ) i at the carboxylation sites (c In contrast, ) c the activation state of Rubisco was reduced to 80% We may ... (Schroeder and Hagiwara, 1989) The calcium deficiency in oak leaves resulted in an uncomplete stomatal closure under darkness Thus, we may state that decreased availability of calcium at leaf level...

Xem thêm

Từ khóa: dynamic effects of a temporary increase in liquidity in the rest of the world on a small open oil exporter effects of a single low and high dose cyc on 5t2mm progression what does the vapor pressure of a pure liquid depend on the vapor pressure of a given liquid depends on vapor pressure of a pure liquid depends on robust nonlinear control of a hypersonic aircraft based on sliding mode control the vapor pressure of a pure liquid depends on which of the following the vapor pressure of a pure liquid depends on regression effects of u s monetary surprises on exchange rates regression effects of u k monetary surprises on exchange rates regression effects of u s monetary surprises on long term interest rates bylsap round tên bài báo the moisturizing effects of glycolipid biosurfactants mannosylerythritol lipids on human skin effects of pentacyclic triterpenes from olives on colon cancer effects of goi land administration policies on the development prospects of area c felthoven r g 2002 effects of the american fisheries act on capacity utilization and technical efficiency marine resource economics 17 3 181 205 Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Thơ nôm tứ tuyệt trào phúng hồ xuân hương Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ