vapor pressure of a pure liquid depends on

Báo cáo y học: "Gain of a 500-fold sensitivity on an intravital MR Contrast Agent based on an endohedral Gadolinium-Cluster-Fullerene-Conjugate: A new chance in cancer diagnostics"

Báo cáo y học: "Gain of a 500-fold sensitivity on an intravital MR Contrast Agent based on an endohedral Gadolinium-Cluster-Fullerene-Conjugate: A new chance in cancer diagnostics"

... outw ustrates a dem axation times [ ster@-BioShut g concentration g tomographic cal concentra graphical sign @C 80n as a carg a conjugate 4 consisting the transfe r cell membran an address ... Publisher. All rights reserved Research Paper Gain of a 500-fold sensitivity on an intravital MR Contrast Agent based on an endohedral Gadolinium-Cluster-Fullerene-Conjugate: A new chance in cancer ... prop tem of sp2-hy ase, π-electron tron shift alon ward-facing o monstration of msec], the axis ttle 14. As a r n at which a b signals in colle ations sufficie nals.[33]. Aft go to the carr e...

Ngày tải lên: 26/10/2012, 09:07

11 656 0
Reliability analysis of a power system based on the multi state system theory

Reliability analysis of a power system based on the multi state system theory

... Reliability Analysis of a Power System Based on the Multi-State System Theory Chunyang LI College of Mechatronics Engineering and Automation National University of Defense Technology Changsha, ... is above 22.8 Ah, the system is reliable, though the capacity of a battery is lower than 5700 mAh. Suppose the capacity of the first branch is 5600 mAh and the capacity of other branches are ... b inary, but they are all multi-state actually. The performance of the batteries can degrade, which results in performance degradation of the power system. So there can be several states of...

Ngày tải lên: 03/01/2014, 19:38

4 408 0
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

... CA CCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoI W168F WT W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI WT* W11F W11F ⁄ W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI Y74W* WT* W11F ⁄ W168F ⁄ Y74W TCA CCGGTCCATGATCCATT ... mutations Mousumi Banerjee 1 , Hemalatha Balaram 2 and Padmanabhan Balaram 1 1 Molecular Biophysics Unit, Indian Institute of Science, Bangalore, India 2 Molecular Biology and Genetics Unit, Jawaharlal ... Ravindra G & Balaram P (2005) Plasmodium falciparum triosephosphate isomerase: new insights into an old enzyme. Pure Appl Chem 77, 281–289. 20 Parthasarathy S, Ravindra G, Balaram H, Balaram...

Ngày tải lên: 18/02/2014, 11:20

15 635 0
Tài liệu Báo cáo Y học: Targeting of malate synthase 1 to the peroxisomes of Saccharomyces cerevisiae cells depends on growth on oleic acid medium pptx

Tài liệu Báo cáo Y học: Targeting of malate synthase 1 to the peroxisomes of Saccharomyces cerevisiae cells depends on growth on oleic acid medium pptx

... (Fig. 4A) . To examine whether a cytosolic malate synthase was as efđcient as a peroxisomal one for m aintaining a functional glyoxylate cycle on oleic acid, liquid growth assays were conducted. ... compart- mentalization of malate synthase was not strictly essential, it was advantageous for cells to grow on oleic acid (Fig. 4C). The greater sensitivity of liquid growth assays on oleic acid compared ... extra- peroxisomal Aco1p. As mentioned previously, malate synthase catalyses the formation of malate from glyoxylate and acetyl-CoA, the source of the latter being either peroxisomal when breaking down...

Ngày tải lên: 22/02/2014, 04:20

8 445 0
Báo cáo khoa học: N-Terminal segment of potato virus X coat protein subunits is glycosylated and mediates formation of a bound water shell on the virion surface docx

Báo cáo khoa học: N-Terminal segment of potato virus X coat protein subunits is glycosylated and mediates formation of a bound water shell on the virion surface docx

... peptide. Monosaccharides were analyzed as AMC derivatives. (A) Analysis of a blank sample ( eluate fraction between peaks in chromatograp hic profile shown in Fig. 3). (B) Analysis of a stan dard mixture containing ... virion surface Lyudmila A. Baratova 1 , Nataliya V. Fedorova 1 , Eugenie N. Dobrov 1 , Elena V. Lukashina 1 , Andrey N. Kharlanov 2 , Vitaly V. Nasonov 3 , Marina V. Serebryakova 4 , Stanislav ... was recently demonstrated by fiber X-ray diffraction analysis [33], an d, a s shown by Falconi et al. [31], water hydration sites are mainly located around protein cavities and clefts. Raman optical activity...

Ngày tải lên: 23/03/2014, 13:20

10 399 0
báo cáo hóa học: " Approximate entropy detects the effect of a secondary cognitive task on postural control in healthy young adults: a methodological report" docx

báo cáo hóa học: " Approximate entropy detects the effect of a secondary cognitive task on postural control in healthy young adults: a methodological report" docx

... produced not by a reallo- cation of attention but by mechanical destabilization, albeit along a temporal rather than a spatial dimension, brought about by articulation and respiratory patterns during ... that per- formance of the secondary cognitive task produced a change in the allocation of attention that uniquely affected ApEn values. How such reallocation is thought to occur remains a matter ... 2 Department of Allied Health Sciences, The University of North Carolina at Chapel Hill, Chapel Hill, NC, USA and 3 HPER Biomechanics Laboratory, University of Nebraska at Omaha, Omaha, NE, USA Email:...

Ngày tải lên: 19/06/2014, 10:20

7 603 0
báo cáo hóa học:" The influence of a weight-bearing platform on the mechanical behavior of two Ilizarov ring fixators: tensioned wires vs. half-pins" pdf

báo cáo hóa học:" The influence of a weight-bearing platform on the mechanical behavior of two Ilizarov ring fixators: tensioned wires vs. half-pins" pdf

... the sagittal plane. J Bone Joint Surg Br 2005, 87:868-872. 12. Khurana A, Byrne C, Evans S, Tanaka H, Haraharan K: Comparison of transverse wires and half pins in Taylor Spatial Frame: a biomechanical ... effect was more apparent in the case of indirect loading. Conclusions: A weight-bearing platform has substantial influence on the biomechanical performance of an Ilizarov external fixator. Half-pins ... experiments and data analysis. BJ helped with the experimental set up and data analysis. MC participated in data analysis and helped to draft the mauscript. TAS participated in study design and coordination...

Ngày tải lên: 20/06/2014, 07:20

23 857 0
Báo cáo hóa học: " On the solvability of a boundary value problem on the real line" pdf

Báo cáo hóa học: " On the solvability of a boundary value problem on the real line" pdf

... required assumptions. Similar considerations can be done for the p-Laplacian operator too, using Theorem 2.5. Author details 1 Dipartimento di Matematica - Università di Bologna, Piazza di Porta S.Donato 5, 40126 ... of author information is available at the end of the article Abstract We investigate the existence of heteroclinic solutions to a class of nonlinear differential equations ( a ( x )  ( x  ( t )))  = ... 2011:26 http://www.boundaryvalueproblems.com/content/2011/1/26 Page 16 of 17 RESEARCH Open Access On the solvability of a boundary value problem on the real line Giovanni Cupini 1 , Cristina Marcelli 2 and Francesca...

Ngày tải lên: 20/06/2014, 22:20

17 409 0
Báo cáo hóa học: " Research Article The Effect of a Voice Activity Detector on the Speech Enhancement Performance of the Binaural Multichannel Wiener Filter" ppt

Báo cáo hóa học: " Research Article The Effect of a Voice Activity Detector on the Speech Enhancement Performance of the Binaural Multichannel Wiener Filter" ppt

... concluded that the performance was as good as or better than that achieved with an adaptive directional microphone (ADM), a standard directional processing often implemented in hearing aids. The algorithm ... microphone array processing. While an adequate amount of noise reduction can be obtained for the case of stationary directional interferer, the noise recorded in a restaurant is a more realistic condition ... and nonstationary diffuse noise. The nonstationary noise is derived from recordings in a restaurant to approach a real world situation. Section 5 provides a discussion of the potential use of this...

Ngày tải lên: 21/06/2014, 08:20

12 506 0
Báo cáo hóa học: " Research Article Design and Experimental Evaluation of a Vehicular Network Based on NEMO and MANET" pdf

Báo cáo hóa học: " Research Article Design and Experimental Evaluation of a Vehicular Network Based on NEMO and MANET" pdf

... for Operational Use in Aeronautics and Space Exploration Mobile Networks,” RFC 5522 (Informational), October 2009. [22] R. Wakikawa, K. Okada, R. Koodli, A. Nilsson, and J. Murai, “Design of vehicle ... NEMO and MANET, are also introduced, such as Multihoming, Route Optimization, and MANEMO. 2.1. VANET. Vehicular Ad hoc Networks (VANET ) are a particular case of MANET, but they are characterized ... there is an important lack of real evaluation analysis. Many VANET solutions and protocols could be considered as nonpractical designs if they were tested in real scenarios, as it has been proved...

Ngày tải lên: 21/06/2014, 08:20

18 597 0
báo cáo hóa học:" Research Article Efficient Processing of a Rainfall Simulation Watershed on an FPGA-Based Architecture with Fast Access to Neighbourhood Pixels" pptx

báo cáo hóa học:" Research Article Efficient Processing of a Rainfall Simulation Watershed on an FPGA-Based Architecture with Fast Access to Neighbourhood Pixels" pptx

... If the image has regions where the pixels have the same value and are not a regional minimum, they are called nonminima plateaus. The nonminima plateaus are a group of pixels which can be divided ... based on the rainfall simulation method described in [7–9]. There is an imple- mentation of a rainfall-based watershed algorithm on hard- ware proposed in [10], using a combination of a DSP and ... FPGA. Section 9 summarizes this paper. 2. The Watershed Algorithm Based on Rainfall Simulation The watershed transformation is based on visualizing an image in three dimensions: two spatial coordinates...

Ngày tải lên: 21/06/2014, 20:20

19 306 0
Báo cáo hóa học: " Influences of H on the Adsorption of a Single Ag Atom on Si(111)-7 3 7 Surface" doc

Báo cáo hóa học: " Influences of H on the Adsorption of a Single Ag Atom on Si(111)-7 3 7 Surface" doc

... adsorption of Ag on the Si(111)- 7 9 7 surface using the Vienna ab initio simulation pack- age (VASP) [31]. Ab initio density functional calculations of surfaces and interfaces play a critical role ... different. After passivat- ing the Si surface by H atoms, the adsorbed Ag will form covalent bonds with H atoms at the Si adatom, and Fig. 3 Calculated total valence charge density plots of: a Ag reacted ... charge accumulates around the Ag atom, and strongly depletes around the Si adatom, rest atom and the third adjacent Si atom at the second layer (not in the plane) when Ag adsorbs at H 3 sites on...

Ngày tải lên: 22/06/2014, 00:20

6 368 0
Báo cáo y học: "Differential recovery of glycosaminoglycan after IL-1-induced degradation of bovine articular cartilage depends on degree of degradation" pot

Báo cáo y học: "Differential recovery of glycosaminoglycan after IL-1-induced degradation of bovine articular cartilage depends on degree of degradation" pot

... (especially proteoglycan), and alteration of the normal balance of catabolic and anabolic processes that regulate cartilage ECM composition. With regard to the repair phase, following IL-1-induced cartilage damage, ... weeks and then remained relatively constant. Collectively, those studies and the present one illustrate spatial and temporal variations in GAG accumulation in native, treated, and Available online ... T1 and cartilage [GAG] was previously validated and reported [12,13,22]. The mean [GAG] for a sample at a given time point was computed as the mean [GAG] calculated across all carti- lage-containing...

Ngày tải lên: 09/08/2014, 01:21

9 347 0
báo cáo khoa học: " Short- and long-term effects of a quality improvement collaborative on diabetes management" pptx

báo cáo khoa học: " Short- and long-term effects of a quality improvement collaborative on diabetes management" pptx

... range of health, personal, and social services and initiatives to improve the organization, management, and integration or coordination of primary generalist care and secondary specialist care services ... ) and organization (size, learning affiliation, and culture), but our study lacks the statistical power to justify a site-by-site analysis and only facilitates an evalua- tion of the QIC as a ... this multi-institutional QIC by me asuring patient outcomes, professional performance measures, and structural aspects of chronic care management. Because little is known about the impact and sustainability of...

Ngày tải lên: 10/08/2014, 10:23

10 295 0
báo cáo khoa học: " Simultaneous measurement of sensor-protein dynamics and motility of a single cell by on-chip microcultivation system" pps

báo cáo khoa học: " Simultaneous measurement of sensor-protein dynamics and motility of a single cell by on-chip microcultivation system" pps

... generation of cell (135 min after microcultivation). After adding the attractant, tumbling-frequency was decreased immediately com- pared to the previous generation. Localization of the aspartate ... localization of the aspartate receptor pro- tein (Tar) for several cell generations. We also report cel- lular responses caused by the addition and removal of the aspartate during cultivation. Figure 1A ... medium-buffer-exchange region. We measured tumbling frequency and Tar-localization ratio of isolated E. coli in M9 minimal medium containing non-attractor amino acid (Asn, Arg, Cys, Ile, Gln, Thr, Thy, Trp, Val,...

Ngày tải lên: 11/08/2014, 00:22

4 166 0

Bạn có muốn tìm thêm với từ khóa:

w