vapor pressure of a liquid depends on what factor

Tài liệu HOW TO MEASURE THE IMPACT OF A CRM STRATEGY ON THE FIRM PERFORMANCE doc

Tài liệu HOW TO MEASURE THE IMPACT OF A CRM STRATEGY ON THE FIRM PERFORMANCE doc

... In addition, conventional methods have the advantage of being investment evaluation settings. Their major drawback of evaluation is that they focus on the estimation of cash flows and accounting ... measures and financial indicators such as profitability (Banker and Mashruwala, 2000, Banker, Potter and Srinivasan, 2001; Ittner and Larcker 199 8a and 1998b, Nagar and Rajan, 2001). 3. PERFORMANCE ... financial and non- financial measures and gives the adequate importance to human relationships and intangible assets. This cross-functional approach should establish linkages among the metrics, shaping...

Ngày tải lên: 20/12/2013, 17:15

15 797 0
Diary of a Nursing Sister on the Western Front, 1914-1915 pptx

Diary of a Nursing Sister on the Western Front, 1914-1915 pptx

... teaching him French with a map, a 'Matin,' and a dictionary. A great deal of nodding and shaking of heads is going on. Sunday, August 23rd The same dazzling blue sky, boiling sun, and ... men and N.C.O.'s are just the same, and always awfully grateful if you can help them out with the language in any way. This was a conversation I heard in my ward to-day. Brother of Captain ... operating day and night. A great many deaths from tetanus. Seen General French's 2nd despatch (of September) to-day in 'Daily Mail.' No mail in, alas! Had a regular debauch in cathedrals...

Ngày tải lên: 07/03/2014, 01:20

98 617 0
Báo cáo khoa học: The effects of a-secretase ADAM10 on the proteolysis of neuregulin-1 pot

Báo cáo khoa học: The effects of a-secretase ADAM10 on the proteolysis of neuregulin-1 pot

... NRG-5¢_for NRG -a_ rev TCTCCGGCGAGATGTCCGA GCTCCAGTGAATCCAGGTTG 668 b NRG-5¢_for NRG-Beta_rev TCTCCGGCGAGATGTCCGA GGCAGCGATCACCAGTAAAC 677 GAPDH GAPDH_for GAPDH_rev GAAGGGCTCATGACCACAGTCCAT TCATTGTCGTACCAGGAAATGAGCTT 450 Fig. ... Universita ¨ t Darmstadt, Germany) was applied at a concentration of 2 lm . GM6001 (Calbiochem, San Diego, CA, USA) was used at a final concentration of 10 lm and phorbol 12-myristate 13-acetate (Sigma, ... II) NRG-IG_for NRG-TM_rev GCCAGGGAAGTCAGAACTTC GTTTTGCAGTAGGCCACCAC 543 Glycosylation sites (type I) NRG-Glyc_for NRG-TM_rev CCACAGAAGGAGCAAATACTTC GTTTTGCAGTAGGCCACCAC 339 Kringle (type II) NRG-Kringle_for NRG-Kringle_rev AGGAGGAGGAGTGGTGCTG GTCCCCAGCAGCAGCAGTA 239 Cysteine...

Ngày tải lên: 16/03/2014, 04:20

13 488 0
Báo cáo khoa học: Effects of a tryptophanyl substitution on the structure and antimicrobial activity of C-terminally truncated gaegurin 4 doc

Báo cáo khoa học: Effects of a tryptophanyl substitution on the structure and antimicrobial activity of C-terminally truncated gaegurin 4 doc

... were taken with a 5-nm excitation and emission bandwidth, a 0.5-s response time, and a scan speed of 40 nmÆs )1 . All samples contained 8 l M peptide or the same concentration of NATA for control ... the GGN4 analogues, including the native GGN4, showed a strong negative band near 200 nm and a weak and broad band around 222 nm, indicating a predominantly random-coil conformation with a slight ... The direction of view is approximately perpen- diculartothehelicalaxisinpanelsAandB, and is parallel to the helical axis in panels C and D. Ó FEBS 2002 Structure–activity relationships of GGN4 analogues...

Ngày tải lên: 31/03/2014, 09:20

8 448 0
development of a biosensor based on laser fabricated

development of a biosensor based on laser fabricated

... laser ablation technique, which is a fast, clean and cost-effective process comparing to traditional silicon microfabrication techniques. The mechanisms of UV laser ablation of polymer have been extensively ... to machine polymers. A laser fluence of 1.6 J/cm 2 and a pulse repetition rate of 5 Hz are used. At this laser fluence, the ablation rate is about 0.9 ␮ m/pulse. The laser beam irradiates onto ... Development of a biosensor based on laser-fabricated polymer microcantilevers X. Richard Zhang and Xianfan Xu a) School of Mechanical Engineering, Purdue University, West Lafayette, Indiana 47907 (Received...

Ngày tải lên: 06/05/2014, 08:55

3 351 0
báo cáo hóa học: " Reliability and validity of a new scale on internal coherence (ICS) of cancer patients" pot

báo cáo hóa học: " Reliability and validity of a new scale on internal coherence (ICS) of cancer patients" pot

... (rotation: varimax with Kaiser normali- sation). We used the self-regulation questionnaire as a main convergence criterion because it's two dimensional scale is measuring the adaptive capacitiy. ... control group), alongside questions on autonomic regulation (aR), the Hospital Anxiety and Depression Scale (HADS), self-regulation (SRQ) and Karnofsky the Performance-Index (KPI). A retest of 65 participants ... the demographic, table 2 the clinical and treatment characteristics of the participants. Participants with malignancies had a broad range of tumour localisa- tions (table 3). At the time of being...

Ngày tải lên: 18/06/2014, 18:20

11 622 0
Báo cáo hóa học: " A fixed-point approach to the stability of a functional equation on quadratic forms" doc

Báo cáo hóa học: " A fixed-point approach to the stability of a functional equation on quadratic forms" doc

... this article as: Bae and Park: A fixed-point approach to the stability of a functional equation on quadratic forms. Journal of Inequalities and Applications 2011 2011:82. Bae and Park Journal of ... a functional equation on quadratic forms Jae-Hyeong Bae 1 and Won-Gil Park 2* * Correspondence: wgpark@mokwon.ac.kr 2 Department of Mathematics Education, College of Education, Mokwon University, Daejeon, ... n variables. Nonlinear Anal TMA. 64, 856–868 (2006). doi:10.1016/j.na.2005.06.028 4. Bae, J-H, Park, W-G: On a cubic equation and a Jensen-quadratic equation. Abstr Appl Anal 2007 (2007). Article...

Ngày tải lên: 20/06/2014, 22:20

7 429 0
Báo cáo hóa học: " The Influence of a Continuum Background on Carrier Relaxation in InAs/InGaAs Quantum Dot" ppt

Báo cáo hóa học: " The Influence of a Continuum Background on Carrier Relaxation in InAs/InGaAs Quantum Dot" ppt

... NANO EXPRESS The Influence of a Continuum Background on Carrier Relaxation in InAs/InGaAs Quantum Dot Gabriele Raino ` Æ Giuseppe Visimberga Æ Abdelmajid Salhi Æ Maria T. Todaro Æ Massimo ... telecommunication devices, has already been achieved by means of InAs QDs capped with an InGaAs quantum well (QW) in a GaAs barrier, providing low- threshold, high modal gain and high characteristic ... a quartz wafer with a photolitho- graphically defined Ti/Au layer containing an array of widely spaced holes of 200 lm which could be placed metal layer down on sample. Than we pump through one hole...

Ngày tải lên: 22/06/2014, 18:20

3 290 0
Báo cáo khoa học: Suppression of a cold-sensitive mutant initiation factor 1 by alterations in the 23S rRNA maturation region pdf

Báo cáo khoa học: Suppression of a cold-sensitive mutant initiation factor 1 by alterations in the 23S rRNA maturation region pdf

... GTCGGATC CGCGGATCAGGTGGGGATGTATTA; rnc5¢I comp, GGCAGTGGATGATGGGGTTCATGCGATACC; rnc3¢O SalI, TGCGTCGACATTTGCCGCAATAGTGTCAACA; and rnc3¢I comp, TGAACCCCATCATCCACTGCCAG GTCAGCG. The deletion was constructed ... follows: era_F_NcoI, CGACCATGGCGAAC AGGCGTTGAAAAAAC; and era_R_SalI, CGAGTCGA CAGCCTTCCATCGGAGTTACT. The resulting vector was termed pTrc9 9a: :era. Protein overexpression was assayed by SDS ⁄ PAGE. Selection ... RNA chaperone and that translation initiation is coupled to ribosomal maturation. Abbreviations Amp, ampicillin; Cm, chloramphenicol; IF1, initiation factor 1; Kan, kanamycin; Tet, tetracycline;...

Ngày tải lên: 06/03/2014, 00:21

12 439 0
Báo cáo khoa học: Physiological truncation and domain organization of a novel uracil-DNA-degrading factor pdf

Báo cáo khoa học: Physiological truncation and domain organization of a novel uracil-DNA-degrading factor pdf

... loaded on agarose gel. Analytical gel filtration analysis Analytical gel filtration was conducted on Superdex 200HR column calibrated with BSA, ovalbumin, chymotrypsin, and RNase (molecular masses ... somewhat larger than the full-length mono- mer calculated molecular mass of 41.446 kDa. This alteration may indicate partial rapid equilibrium dimerization and ⁄ or the anomalous gel permeation behavior ... fragments are only approximately symmetrical, as the model is of low resolution and the local conformation of the backbone is uncertain. (B, C) Sequence conservation mapped onto the ribbon diagram...

Ngày tải lên: 29/03/2014, 08:20

15 413 0
Báo cáo Y học: Functional studies of the Synechocystis phycobilisomes organization by high performance liquid chromatography on line with a mass spectrometer docx

Báo cáo Y học: Functional studies of the Synechocystis phycobilisomes organization by high performance liquid chromatography on line with a mass spectrometer docx

... ch as UV radiation and physiological stress such as starvation may affect this supraorganization are also presented. MATERIALS AND METHODS Chemicals Reagent-grade phosphoric acid, magnesium chloride, sodium ... with an electrospray ion source (ESI-MS). An advantage of this approach is that information can be collected on the initial events, which take place as this organism adapts to environmental ch anges. Ultracentrifugation ... phycobilisomes before and after illumination reve aled the d isappearance of the b-phycocyanin already after 1 h of illumination (Fig. 4). In contrast, SDS/PAGE analysis of the total mixture of phycobilisomes...

Ngày tải lên: 08/03/2014, 16:20

9 478 0
Báo cáo khoa học: What’s in a covalent bond? On the role and formation of covalently bound flavin cofactors doc

Báo cáo khoa học: What’s in a covalent bond? On the role and formation of covalently bound flavin cofactors doc

... (1994) Characterisation of d-arabinono-14- lactone oxidase from Candida albicans ATCC 10231. Eur J Biochem 225, 1073–1079. 149 Hiraga K, Kitazawa M, Kaneko N & Oda K (1997) Isolation and some ... microenvironment around the isoalloxazine moiety of the FAD analog cofactor was dramatically affected [89]. This shows that even though, in many cases, covalent flavinylation appears to be advantageous ... MAO A [158] – Animal AMO 2BXR MAO B [159] – Animal AMO 1GOS Amadoriase I [54] – Fungus DAAO 3DJD MSOX [36] – Bacteria DAAO 2GB0 Pipecolate oxidase [36] – Animal DAAO – N-methyltryptophan oxidase...

Ngày tải lên: 16/03/2014, 01:20

23 565 0
w