vapor pressure of a liquid depends on what factor
Tài liệu HOW TO MEASURE THE IMPACT OF A CRM STRATEGY ON THE FIRM PERFORMANCE doc
... In addition, conventional methods have the advantage of being investment evaluation settings. Their major drawback of evaluation is that they focus on the estimation of cash flows and accounting ... measures and financial indicators such as profitability (Banker and Mashruwala, 2000, Banker, Potter and Srinivasan, 2001; Ittner and Larcker 199 8a and 1998b, Nagar and Rajan, 2001).3. PERFORMANCE ... financial and non-financial measures and gives the adequate importance to human relationships and intangible assets.This cross-functional approach should establish linkages among the metrics, shaping...
- 15
- 796
- 0
Diary of a Nursing Sister on the Western Front, 1914-1915 pptx
... teaching him French with a map, a 'Matin,' and a dictionary. A great deal of nodding and shaking of heads is going on. Sunday, August 23rd The same dazzling blue sky, boiling sun, and ... men andN.C.O.'s are just the same, and always awfully grateful if you can help them out with the language in any way.This was a conversation I heard in my ward to-day. Brother of Captain ... operating day and night. A great many deaths from tetanus.Seen General French's 2nd despatch (of September) to-day in 'Daily Mail.' No mail in, alas! Had a regulardebauch in cathedrals...
- 98
- 617
- 0
Báo cáo khoa học: The effects of a-secretase ADAM10 on the proteolysis of neuregulin-1 pot
... NRG-5¢_forNRG -a_ revTCTCCGGCGAGATGTCCGAGCTCCAGTGAATCCAGGTTG668b NRG-5¢_forNRG-Beta_revTCTCCGGCGAGATGTCCGAGGCAGCGATCACCAGTAAAC677GAPDH GAPDH_forGAPDH_revGAAGGGCTCATGACCACAGTCCATTCATTGTCGTACCAGGAAATGAGCTT450Fig. ... Universita¨t Darmstadt, Germany) was applied at a concentration of 2 lm . GM6001 (Calbiochem, San Diego,CA, USA) was used at a final concentration of 10 lm andphorbol 12-myristate 13-acetate (Sigma, ... II)NRG-IG_forNRG-TM_revGCCAGGGAAGTCAGAACTTCGTTTTGCAGTAGGCCACCAC543Glycosylation sites (type I) NRG-Glyc_forNRG-TM_revCCACAGAAGGAGCAAATACTTCGTTTTGCAGTAGGCCACCAC339Kringle (type II) NRG-Kringle_forNRG-Kringle_revAGGAGGAGGAGTGGTGCTGGTCCCCAGCAGCAGCAGTA239Cysteine...
- 13
- 487
- 0
Báo cáo khoa học: Effects of a tryptophanyl substitution on the structure and antimicrobial activity of C-terminally truncated gaegurin 4 doc
... were takenwith a 5-nm excitation and emission bandwidth, a 0.5-sresponse time, and a scan speed of 40 nmÆs)1. All samplescontained 8 lMpeptide or the same concentration of NATA for control ... the GGN4 analogues, including the native GGN4,showed a strong negative band near 200 nm and a weak andbroad band around 222 nm, indicating a predominantlyrandom-coil conformation with a slight ... Thedirection of view is approximately perpen-diculartothehelicalaxisinpanelsAandB,and is parallel to the helical axis in panels Cand D.Ó FEBS 2002 Structure–activity relationships of GGN4 analogues...
- 8
- 447
- 0
development of a biosensor based on laser fabricated
... laser ablationtechnique, which is a fast, clean and cost-effective processcomparing to traditional silicon microfabrication techniques.The mechanisms of UV laser ablation of polymer have beenextensively ... to machine polymers. A laser fluence of 1.6 J/cm2and a pulse repetition rate of 5 Hzare used. At this laser fluence, the ablation rate is about0.9m/pulse. The laser beam irradiates onto ... Development of a biosensor based on laser-fabricatedpolymer microcantileversX. Richard Zhang and Xianfan Xu a) School of Mechanical Engineering, Purdue University, West Lafayette, Indiana 47907(Received...
- 3
- 351
- 0
báo cáo hóa học: " Reliability and validity of a new scale on internal coherence (ICS) of cancer patients" pot
... (rotation: varimax with Kaiser normali-sation). We used the self-regulation questionnaire as a main convergence criterion because it's two dimensionalscale is measuring the adaptive capacitiy. ... controlgroup), alongside questions on autonomic regulation (aR), the Hospital Anxiety and DepressionScale (HADS), self-regulation (SRQ) and Karnofsky the Performance-Index (KPI). A retest of 65participants ... the demographic, table 2 the clinical andtreatment characteristics of the participants. Participantswith malignancies had a broad range of tumour localisa-tions (table 3). At the time of being...
- 11
- 622
- 0
Báo cáo hóa học: " A fixed-point approach to the stability of a functional equation on quadratic forms" doc
... this article as: Bae and Park: A fixed-point approach to the stability of a functional equation on quadraticforms. Journal of Inequalities and Applications 2011 2011:82.Bae and Park Journal of ... a functional equation on quadratic formsJae-Hyeong Bae1and Won-Gil Park2** Correspondence:wgpark@mokwon.ac.kr2Department of MathematicsEducation, College of Education,Mokwon University, Daejeon, ... n variables. Nonlinear Anal TMA. 64, 856–868 (2006).doi:10.1016/j.na.2005.06.0284. Bae, J-H, Park, W-G: On a cubic equation and a Jensen-quadratic equation. Abstr Appl Anal 2007 (2007). Article...
- 7
- 429
- 0
Báo cáo hóa học: " The Influence of a Continuum Background on Carrier Relaxation in InAs/InGaAs Quantum Dot" ppt
... NANO EXPRESSThe Influence of a Continuum Background on Carrier Relaxationin InAs/InGaAs Quantum DotGabriele Raino`Æ Giuseppe Visimberga Æ Abdelmajid Salhi Æ Maria T. Todaro ÆMassimo ... telecommunication devices, has already beenachieved by means of InAs QDs capped with an InGaAsquantum well (QW) in a GaAs barrier, providing low-threshold, high modal gain and high characteristic ... a quartz wafer with a photolitho-graphically defined Ti/Au layer containing an array of widely spaced holes of 200 lm which could be placedmetal layer down on sample. Than we pump through onehole...
- 3
- 290
- 0
Báo cáo khoa học: Suppression of a cold-sensitive mutant initiation factor 1 by alterations in the 23S rRNA maturation region pdf
... GTCGGATCCGCGGATCAGGTGGGGATGTATTA; rnc5¢I comp,GGCAGTGGATGATGGGGTTCATGCGATACC; rnc3¢OSalI, TGCGTCGACATTTGCCGCAATAGTGTCAACA;and rnc3¢I comp, TGAACCCCATCATCCACTGCCAGGTCAGCG. The deletion was constructed ... follows: era_F_NcoI, CGACCATGGCGAACAGGCGTTGAAAAAAC; and era_R_SalI, CGAGTCGACAGCCTTCCATCGGAGTTACT. The resulting vectorwas termed pTrc9 9a: :era. Protein overexpression wasassayed by SDS ⁄ PAGE.Selection ... RNA chaperone and that translation initiation iscoupled to ribosomal maturation.AbbreviationsAmp, ampicillin; Cm, chloramphenicol; IF1, initiation factor 1; Kan, kanamycin; Tet, tetracycline;...
- 12
- 439
- 0
Báo cáo khoa học: Physiological truncation and domain organization of a novel uracil-DNA-degrading factor pdf
... loaded on agarose gel.Analytical gel filtration analysisAnalytical gel filtration was conducted on Superdex 200HRcolumn calibrated with BSA, ovalbumin, chymotrypsin,and RNase (molecular masses ... somewhat larger than the full-length mono-mer calculated molecular mass of 41.446 kDa. Thisalteration may indicate partial rapid equilibriumdimerization and ⁄ or the anomalous gel permeationbehavior ... fragments are only approximately symmetrical, as the model is of lowresolution and the local conformation of the backbone is uncertain. (B, C) Sequence conservation mapped onto the ribbon diagram...
- 15
- 413
- 0
Báo cáo Y học: Functional studies of the Synechocystis phycobilisomes organization by high performance liquid chromatography on line with a mass spectrometer docx
... ch as UVradiation and physiological stress such as starvation mayaffect this supraorganization are also presented.MATERIALS AND METHODSChemicalsReagent-grade phosphoric acid, magnesium chloride,sodium ... with an electrospray ionsource (ESI-MS). An advantage of this approach is thatinformation can be collected on the initial events, which takeplace as this organism adapts to environmental ch anges.Ultracentrifugation ... phycobilisomes beforeand after illumination reve aled the d isappearance of theb-phycocyanin already after 1 h of illumination (Fig. 4). Incontrast, SDS/PAGE analysis of the total mixture of phycobilisomes...
- 9
- 477
- 0
Báo cáo khoa học: What’s in a covalent bond? On the role and formation of covalently bound flavin cofactors doc
... (1994) Characterisation of d-arabinono-14-lactone oxidase from Candida albicans ATCC 10231.Eur J Biochem 225, 1073–1079.149 Hiraga K, Kitazawa M, Kaneko N & Oda K (1997)Isolation and some ... microenvironmentaround the isoalloxazine moiety of the FAD analogcofactor was dramatically affected [89]. This showsthat even though, in many cases, covalent flavinylationappears to be advantageous ... MAO A [158] – Animal AMO 2BXRMAO B [159] – Animal AMO 1GOSAmadoriase I [54] – Fungus DAAO 3DJDMSOX [36] – Bacteria DAAO 2GB0Pipecolate oxidase [36] – Animal DAAO –N-methyltryptophan oxidase...
- 23
- 564
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25