Ngày tải lên: 02/06/2014, 15:10
Ngày tải lên: 09/08/2014, 07:21
Báo cáo y học: "What does the marriage of Open Access with online publication bring" docx
Ngày tải lên: 10/08/2014, 05:20
Báo cáo y học: "What does the structure-function relationship of the HIV-1 Tat protein teach us about developing an AIDS vaccine?" ppsx
Ngày tải lên: 12/08/2014, 23:21
Báo cáo y học: "Where does the lactate come from? A rare cause of reversible inhibition of mitochondrial respiration" pdf
Ngày tải lên: 13/08/2014, 20:21
The Marketing Strategy of a multinational join stock company.doc
... adaptation Adapt promotion Communication adaptation Dual adaptation Product invention Table 1.1: Five international product and promotion strategies. Product adaptation involves changing the ... later based on to research. The definition, the goals of marketing , the contents of marketing as well as implementation and control are main parts of chapter one. Gaining an insight into the theory ... trademark, and the package of product. Each of the products of a multinational join stock company has a separate trademark and color. Besides, a multinational join stock company has always tried...
Ngày tải lên: 27/10/2012, 16:51
Safeguarding Public and Environmental Health: What are the Necessary Requirements of UV Reactor Validation Protocols?
Ngày tải lên: 05/09/2013, 09:08
Optimization of injection timing and injection pressure of a DI diesel engine fueled with preheated rice bran oil
Ngày tải lên: 05/09/2013, 16:11
What does the woman mean?
... local district. It used to be that members of congress had a relatively a small staff of people working for them. and all of these was are in a primary importance. And now there are thousands ... discussing? 32, What is the man doing? 33, What does the woman suggest the man do? 34, How did the woman learn about painting? 35, What does the woman plan to do next? 36-39 listen to a conversation between ... about Penular legislation and just keep their local congress representatives up to date and inform what s going on in other parts of Congress. Now another thing that congressional aids do is...
Ngày tải lên: 23/10/2013, 02:15
Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx
... you change the DataColumn in the parent DataTable on which the ForeignKeyConstraint was created, then the same change is also made in any corresponding DataRow objects in the child DataTable. ... in the child DataTable. This is the default. None Indicates that no action takes place. SetDefault Indicates that the DataColumn values in the child DataTable are to be set to the value in the ... UpdateRule is set to None. ã The CommandText of the Command object in the UpdateCommand of the DataAdapter is the same as in the second case. The following code sets the UpdateRule of the...
Ngày tải lên: 24/12/2013, 01:17
Reliability analysis of a power system based on the multi state system theory
... 22.8 ss RG=≥ } Equation (1) indicates that when the capacity of the system is above 22.8 Ah, the system is reliable, though the capacity of a battery is lower than 5700 mAh. Suppose the capacity of the first ... G is the capacity of the battery. 2 150 () 2 ~ 6000,150GN To analyze the reliability of the system by the traditional system reliability theory, we must gain the reliability of the battery ... reliability theory defines the power system and the batteries are b inary, but they are all multi-state actually. The performance of the batteries can degrade, which results in performance degradation...
Ngày tải lên: 03/01/2014, 19:38
Tài liệu THE VAPRO PRESSURE OF ENVIRONMENTALLY SIGNIFICANT ORGANIC CHEMICALS: AREVIEW OF METHODS AND DATA AT AMBIENT TEPERATURE ppt
...
Ngày tải lên: 14/02/2014, 03:20
Tài liệu Freedom of Expression on the Internet - A study of legal provisions and practices related to freedom of expression, the free flow of information and media pluralism on the Internet in OSCE participating States ppt
... draconian measures such as the confiscation of particular issues of publications, including newspapers or restrictions on the publication of specific articles. 73 Arguably, the practice of banning ... Document of the Moscow Meeting of the Conference on the Human Dimension of the CSCE and in breach of Article 19 of the International Covenant on Civil and Political Rights and Article 10 of the ... the other participating States”, “make it their aim to facilitate the freer and wider dissemination of information of all kinds” and “encourage co- operation in the field of information and the...
Ngày tải lên: 18/02/2014, 00:20
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... Restriction site W11F WT W11F CA CCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoI W168F WT W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI WT* W11F W11F ⁄ W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI Y74W* ... calibration standards provided by the manu- facturer. Data processing was performed using the deconvo- lution module of the data analysis software to detect the multiple charge states and obtain ... maintaining the geometry of the active site. The availability of crystal structures of TIMs from 21 sources and the large database of TIM sequences from various sources facilitate an analysis of mutational...
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc
... chloroplast spinach GAPDH [35] w ere examined t o AthalianaB PativumB SoleraceaB NtabacumB A. thalianaA PsativumA SoleraceaA Chlamy Synechocystis Synechococcus AthalianaB PativumB SoleraceaB NtabacumB A. thalianaA PsativumA SoleraceaA Chlamy Synechocystis Synechococcus AthalianaB PativumB SoleraceaB NtabacumB A. thalianaA PsativumA SoleraceaA Chlamy Synechocystis Synechococcus 119 119 119 119 119 120 119 121 118 119 159 159 159 159 157 158 157 160 158 159 199 199 199 199 197 198 197 200 198 199 VI ... o AthalianaB PativumB SoleraceaB NtabacumB A. thalianaA PsativumA SoleraceaA Chlamy Synechocystis Synechococcus AthalianaB PativumB SoleraceaB NtabacumB A. thalianaA PsativumA SoleraceaA Chlamy Synechocystis Synechococcus AthalianaB PativumB SoleraceaB NtabacumB A. thalianaA PsativumA SoleraceaA Chlamy Synechocystis Synechococcus 119 119 119 119 119 120 119 121 118 119 159 159 159 159 157 158 157 160 158 159 199 199 199 199 197 198 197 200 198 199 VI ... global fitting assuming a 1 : 1 interaction with BIAEVALUATION 3.1. Table 5. Dissociation c onstants and quantification of the destabilizing effect of the mutations on the interaction between m utant...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Definition" pptx
... tuned models on other three data sets. Data: The sense inventory is WN3.0 for the four WSD data sets. WMF and LDA are built on the cor- pus of sense definitions of two dictionaries: WN and Wiktionary [Wik]. 2 We ... example, the jcn similarity measure (Jiang and Conrath, 1997) computes the sense pair similarity score based on the information content of three senses: the two senses and their least common ... link the senses across dictionaries, hence Wik is only used as augmented data for WMF to better learn the semantics of words. All data is tokenized, POS tagged (Toutanova et al., 2003) and lemmatized,...
Ngày tải lên: 19/02/2014, 19:20
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf
... mutagenesis reactions together with oligonucleo- tides ECF-Q69G d(5Â-AACAACGCAGCT GGGCTCTG GAACCAT), ECF -A1 41Q d(5Â-TCAACCTCTAAC CAG GCTACTCCGCTG) ECM-G77Q d(5Â-AACAACGCTGG C CAGCACGCTAACCAC) and ... simultaneously after inoculation of media with cultures grown to exponential phase in the absence of paraquat and IPTG (Materials and methods [24]). The final concentration of paraquat and IPTG ... V b (equal to 1 unit of SOD activity under standard conditions). After incubation of aliquots at the required temperature or after addition of sodium azide at the required concentration, V s was meas- ured...
Ngày tải lên: 21/02/2014, 01:21
What Was the Interest Rate Then? A Data Study pot
... call-loan rates, the rate on new loans (the “new rate”) and the rate on renewal of existing loans (the “renewal rate”). The renewal rate was by far the more important. As Macaulay (1938, p. A3 39) ... from the Bank of England—involves four decimal places and LCES three. Excluded from the table is the series of the International Monetary Fund, available on the organization’s International Financial ... for the commercial-paper rate—is selected. The Macaulay series also has the advantage of beginning in the year 1857, earlier than any other series. The series is annualized by averaging monthly...
Ngày tải lên: 06/03/2014, 14:20
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx
... with partial charges being formed, and covalent bonds being formed and broken). Thus, the calculated effect of rotation of Asp142 on the pK a of Glu144 only gives an indication of what may happen ... 5–8). The pK a of Asp140 is much lower than that of Asp142 and Glu144 in all situations where all three residues are present and the one proton shared by Asp140 and Asp142 appears to remain on Asp142 ... as such analysis does not rely on absolute pK a values and may be based on comparisons of almost identical structures. The calculations strongly suggest that the Asp140- Asp142 pair in the wildtype...
Ngày tải lên: 07/03/2014, 14:20
Bạn có muốn tìm thêm với từ khóa: