the vapor pressure of a given liquid depends on

The Marketing Strategy of a multinational join stock company.doc

The Marketing Strategy of a multinational join stock company.doc

Ngày tải lên : 27/10/2012, 16:51
... adaptation Adapt promotion Communication adaptation Dual adaptation Product invention Table 1.1: Five international product and promotion strategies. Product adaptation involves changing the ... later based on to research. The definition, the goals of marketing , the contents of marketing as well as implementation and control are main parts of chapter one. Gaining an insight into the theory ... trademark, and the package of product. Each of the products of a multinational join stock company has a separate trademark and color. Besides, a multinational join stock company has always tried...
  • 25
  • 623
  • 8
Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx

Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx

Ngày tải lên : 24/12/2013, 01:17
... you change the DataColumn in the parent DataTable on which the ForeignKeyConstraint was created, then the same change is also made in any corresponding DataRow objects in the child DataTable. ... in the child DataTable. This is the default. None Indicates that no action takes place. SetDefault Indicates that the DataColumn values in the child DataTable are to be set to the value in the ... UpdateRule is set to None. ã The CommandText of the Command object in the UpdateCommand of the DataAdapter is the same as in the second case. The following code sets the UpdateRule of the...
  • 6
  • 428
  • 0
Reliability analysis of a power system based on the multi state system theory

Reliability analysis of a power system based on the multi state system theory

Ngày tải lên : 03/01/2014, 19:38
... 22.8 ss RG=≥ } Equation (1) indicates that when the capacity of the system is above 22.8 Ah, the system is reliable, though the capacity of a battery is lower than 5700 mAh. Suppose the capacity of the first ... G is the capacity of the battery. 2 150 () 2 ~ 6000,150GN To analyze the reliability of the system by the traditional system reliability theory, we must gain the reliability of the battery ... reliability theory defines the power system and the batteries are b inary, but they are all multi-state actually. The performance of the batteries can degrade, which results in performance degradation...
  • 4
  • 407
  • 0
Tài liệu Freedom of Expression on the Internet - A study of legal provisions and practices related to freedom of expression, the free flow of information and media pluralism on the Internet in OSCE participating States ppt

Tài liệu Freedom of Expression on the Internet - A study of legal provisions and practices related to freedom of expression, the free flow of information and media pluralism on the Internet in OSCE participating States ppt

Ngày tải lên : 18/02/2014, 00:20
... draconian measures such as the confiscation of particular issues of publications, including newspapers or restrictions on the publication of specific articles. 73 Arguably, the practice of banning ... Document of the Moscow Meeting of the Conference on the Human Dimension of the CSCE and in breach of Article 19 of the International Covenant on Civil and Political Rights and Article 10 of the ... the other participating States”, “make it their aim to facilitate the freer and wider dissemination of information of all kinds” and “encourage co- operation in the field of information and the...
  • 238
  • 2.7K
  • 0
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

Ngày tải lên : 18/02/2014, 11:20
... Restriction site W11F WT W11F CA CCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoI W168F WT W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI WT* W11F W11F ⁄ W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI Y74W* ... calibration standards provided by the manu- facturer. Data processing was performed using the deconvo- lution module of the data analysis software to detect the multiple charge states and obtain ... maintaining the geometry of the active site. The availability of crystal structures of TIMs from 21 sources and the large database of TIM sequences from various sources facilitate an analysis of mutational...
  • 15
  • 635
  • 0
Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc

Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc

Ngày tải lên : 19/02/2014, 16:20
... chloroplast spinach GAPDH [35] w ere examined t o AthalianaB PativumB SoleraceaB NtabacumB A. thalianaA PsativumA SoleraceaA Chlamy Synechocystis Synechococcus AthalianaB PativumB SoleraceaB NtabacumB A. thalianaA PsativumA SoleraceaA Chlamy Synechocystis Synechococcus AthalianaB PativumB SoleraceaB NtabacumB A. thalianaA PsativumA SoleraceaA Chlamy Synechocystis Synechococcus 119 119 119 119 119 120 119 121 118 119 159 159 159 159 157 158 157 160 158 159 199 199 199 199 197 198 197 200 198 199 VI ... o AthalianaB PativumB SoleraceaB NtabacumB A. thalianaA PsativumA SoleraceaA Chlamy Synechocystis Synechococcus AthalianaB PativumB SoleraceaB NtabacumB A. thalianaA PsativumA SoleraceaA Chlamy Synechocystis Synechococcus AthalianaB PativumB SoleraceaB NtabacumB A. thalianaA PsativumA SoleraceaA Chlamy Synechocystis Synechococcus 119 119 119 119 119 120 119 121 118 119 159 159 159 159 157 158 157 160 158 159 199 199 199 199 197 198 197 200 198 199 VI ... global fitting assuming a 1 : 1 interaction with BIAEVALUATION 3.1. Table 5. Dissociation c onstants and quantification of the destabilizing effect of the mutations on the interaction between m utant...
  • 8
  • 494
  • 0
Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Definition" pptx

Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Definition" pptx

Ngày tải lên : 19/02/2014, 19:20
... tuned models on other three data sets. Data: The sense inventory is WN3.0 for the four WSD data sets. WMF and LDA are built on the cor- pus of sense definitions of two dictionaries: WN and Wiktionary [Wik]. 2 We ... example, the jcn similarity measure (Jiang and Conrath, 1997) computes the sense pair similarity score based on the information content of three senses: the two senses and their least common ... link the senses across dictionaries, hence Wik is only used as augmented data for WMF to better learn the semantics of words. All data is tokenized, POS tagged (Toutanova et al., 2003) and lemmatized,...
  • 5
  • 585
  • 0
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf

Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf

Ngày tải lên : 21/02/2014, 01:21
... mutagenesis reactions together with oligonucleo- tides ECF-Q69G d(5Â-AACAACGCAGCT GGGCTCTG GAACCAT), ECF -A1 41Q d(5Â-TCAACCTCTAAC CAG GCTACTCCGCTG) ECM-G77Q d(5Â-AACAACGCTGG C CAGCACGCTAACCAC) and ... simultaneously after inoculation of media with cultures grown to exponential phase in the absence of paraquat and IPTG (Materials and methods [24]). The final concentration of paraquat and IPTG ... V b (equal to 1 unit of SOD activity under standard conditions). After incubation of aliquots at the required temperature or after addition of sodium azide at the required concentration, V s was meas- ured...
  • 12
  • 740
  • 0
Tài liệu Báo cáo Y học: Targeting of malate synthase 1 to the peroxisomes of Saccharomyces cerevisiae cells depends on growth on oleic acid medium pptx

Tài liệu Báo cáo Y học: Targeting of malate synthase 1 to the peroxisomes of Saccharomyces cerevisiae cells depends on growth on oleic acid medium pptx

Ngày tải lên : 22/02/2014, 04:20
... extra- peroxisomal Aco1p. As mentioned previously, malate synthase catalyses the formation of malate from glyoxylate and acetyl-CoA, the source of the latter being either peroxisomal when breaking down ... (Fig. 4A) . To examine whether a cytosolic malate synthase was as efđcient as a peroxisomal one for m aintaining a functional glyoxylate cycle on oleic acid, liquid growth assays were conducted. The ... compart- mentalization of malate synthase was not strictly essential, it was advantageous for cells to grow on oleic acid (Fig. 4C). The greater sensitivity of liquid growth assays on oleic acid compared...
  • 8
  • 444
  • 0
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx

Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx

Ngày tải lên : 07/03/2014, 14:20
... 5–8). The pK a of Asp140 is much lower than that of Asp142 and Glu144 in all situations where all three residues are present and the one proton shared by Asp140 and Asp142 appears to remain on Asp142 ... with partial charges being formed, and covalent bonds being formed and broken). Thus, the calculated effect of rotation of Asp142 on the pK a of Glu144 only gives an indication of what may happen ... depending on the position of Asp142 and the calculation used. Interestingly, the calculations also suggest that the magni- tude of this effect is in part due to the presence of the negatively charged Asp215...
  • 10
  • 651
  • 0
Báo cáo khoa học: "Techniques to incorporate the benefits of a Hierarchy in a modified hidden Markov model" pptx

Báo cáo khoa học: "Techniques to incorporate the benefits of a Hierarchy in a modified hidden Markov model" pptx

Ngày tải lên : 08/03/2014, 02:21
... of data. The first is a selection of data from CoNLL- 2004 and contains 8936 sentences. The second dataset is part of the Lancaster Treebank corpus and contains 1473 sentences. Each sentence con- tains ... Grammar Parsing Creation of a parse tree involves describing lan- guage grammar in a tree representation, where each path of the tree represents a grammar rule. Consider a sentence from the Lancaster ... structure of an HHMM The models discussed here are evaluated by applying them to natural language tasks based on CoNLL-2004 1 and a sub-corpus of the Lancaster Treebank 2 . Keywords: information extraction,...
  • 8
  • 528
  • 0
Báo cáo Y học: Subsite mapping of the binding region of a-amylases with a computer program ppt

Báo cáo Y học: Subsite mapping of the binding region of a-amylases with a computer program ppt

Ngày tải lên : 08/03/2014, 09:20
... and barley a- amylases are thus also presented. MATERIALS AND METHODS SUMA software: subsite mapping of amylases This software calculates the apparent binding energies on the basis of the measured ... product analysis. The Suganuma method is based on the calculation of the kinetic parameter (k 0 /K m ) and the BCF data at sufficiently low substrate concentra- tion, where secondary attacks on the ... Mapping of a- Amylases) is freely available for research and educational purposes via the Internet (E-mail: gyemant@tigris.klte.hu). The advantages of this program are demonstrated through a- amylases...
  • 6
  • 387
  • 0
Báo cáo Y học: Crystal structure of the catalytic domain of a human thioredoxin-like protein pdf

Báo cáo Y học: Crystal structure of the catalytic domain of a human thioredoxin-like protein pdf

Ngày tải lên : 08/03/2014, 22:20
... Murakawa, M., Takahashi, S., Tsubuki, S., Kawashima, S., Sakamaki, K. & Yonehara, S. (1998) Purification, molecular cloning, and characterization of TRP32, a novel thioredoxin-related mammalian ... hTRXL, the functional identification of the gene product and the structure determination of its N-terminal catalytic domain. MATERIALS AND METHODS DDRT-PCR and full-length cDNA isolation Total RNA ... negative) than the latter. As the C-terminal region is rich in acidic amino acids, if it does have some interaction with the N-terminal domain, the mechanism of regulating the catalytic activity may be...
  • 9
  • 533
  • 0
Báo cáo Y học: Kinetic and biochemical analyses on the reaction mechanism of a bacterial ATP-citrate lyase ppt

Báo cáo Y học: Kinetic and biochemical analyses on the reaction mechanism of a bacterial ATP-citrate lyase ppt

Ngày tải lên : 08/03/2014, 22:20
... the reaction mechanism of a bacterial ATP-citrate lyase Tadayoshi Kanao, Toshiaki Fukui, Haruyuki Atomi and Tadayuki Imanaka Department of Synthetic Chemistry and Biological Chemistry, Graduate ... case of Ec-SCS [21], although the phos- phorylation of the a- subunit alone (80% of the subunit after 24 h) was much slower than AclA alone (90 min). A major contribution of AclB, as well as the ... products, AclA (a subunit) and AclB (b subunit). By comparing the primary structures of AclA and AclB with that of the mammalian enzyme, we found that AclA and AclB Correspondence to T. Imanaka, Department...
  • 8
  • 551
  • 0

Xem thêm