... 5'-GAATTAGGGAACAGCCACGA-3' for CO, 5'-CTGGAACAACCTTTGGCA AT-3' and 5'-TACACTGTTTGCCTGCCAAG-3' for FT, 5'-CGAAAGCTTCCTCCTGGTTA-3' and 5'-GAGTTTTGCCCCTCACCATA-3' for SOC1, 5'-GATTCCACGAGTTTGGGAGA-3' ... 5'-GATTCCACGAGTTTGGGAGA-3' and 5'-CCTTAGCCATTGGGAGATCA-3' for TOC1, 5'-GCGTTGCCTCCTAATGGTAA-3' and 5'ACCCTCCAACTCCCTGTACC-3' for HAP 3A, 5'TGCTTTTTCATCGACACTGC-3' and 5'-CCATATGTGTCCGC...
Ngày tải lên: 12/08/2014, 03:21
... the biomass of the giant reed and maintain the wetland potential is proposed as shown in Fig 10 In this method, the above-ground part of the giant reeds that will remain the following year are ... rhizomes remaining for the next year Thereafter, the giant reeds grow with the rhizome extension, and the giant reed community in the wetland is r...
Ngày tải lên: 05/09/2013, 09:38
Economic feasibility analysis of a wind farm in Caldas da Rainha, Portugal
... understand the behavior of the variables involved in economical and financial assessing of a wind farm as a manner of validating the indicators of attractiveness and risk of energy projects and analysis ... projects and costs evaluation The economic assessment of hypothetical wind farm installed in Caldas da Rainha, we obtained the following results: Attr...
Ngày tải lên: 05/09/2013, 14:59
Computational fluid dynamics analysis of a twisted airfoil shaped two-bladed H-Darrieus rotor made from fibreglass reinforced plastic (FRP)
... types of Darrieus rotors are mainly available, namely troop skein (Eggbeater) Darrieus rotor and H-Darrieus rotor H-Darrieus rotor was in the same patent of 1931[2] It has two to three airfoil shaped ... 0.265 at a TSR of 2.214, and the maximum Ct obtained is 0.124 at a TSR of 1.962 And the standard deviation of computational Cp from experimental Cp is 0.81% an...
Ngày tải lên: 05/09/2013, 15:28
Parametric analysis of geothermal residential heating and cooling application
... reads the annual TRNSYS heating and cooling load profile so as to determine the values of the peak heating and cooling loads for each month of the year (see Table 2) and their durations Moreover, ... current study as part of parametric analysis Sizing software calculates borehole length considering the heating and cooling demands In the current study the values...
Ngày tải lên: 05/09/2013, 16:10
Reliability analysis of a power system based on the multi state system theory
... V RELIABILITY ANALYSIS OF THE POWER SYSTEM The reliability of the power system is analyzed using the multi- state system theory According to (2), the universal generating function of the battery ... this paper, and is compared 97 (1) The reliability of the power system obtained by the traditional system reliability theory is always co...
Ngày tải lên: 03/01/2014, 19:38
A critical discourse analysis of president bush’s speech outlining strategy for victory in iraq
... B - - : 78 A # M * # ! B - A * * % 73 , ) $ %6 &&4 ) A # A # # B - A A B , -% 73 $ @ ) # A % &'') ! # ? # / ; 5 * * / * * + , - A / A A / / ( % ) , - # - / < # * # % ) # # # # $ A 26 * I+ ... * ) +D % # - ' A +D # # # # * # # * # ; # A 7< # %A # 4FF ) ;< ;< ;< * ;< < # J J ! H ;< # # # M M "* / , ;< * ! ;< A ; A : ) /< % # A # 5 "*" # * % # ) # - # /B - ! - & - A...
Ngày tải lên: 29/01/2014, 00:23
Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx
... GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGCCCTTCCGGAGAAGA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGGCACTTAACCCATG ... GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTATGGAGTTGAACTAGCTGT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCC...
Ngày tải lên: 22/02/2014, 04:20
Báo cáo khoa học: Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid pdf
... and Crystal structure of Staphylococcus aureus EF -G Carl Trygger’s Foundation to M Selmer and S Sanyal, the Goran Gustafsson Foundation to S Sanyal, ¨ and Magnus Bergvall’s foundation and the ... Crystal structure of a mutant elongation factor G trapped with a GTP analogue FEBS Lett 579, 449 2–4 497 Laurberg M, Kristensen O, Martemyanov K, Gudkov AT, Nagaev I...
Ngày tải lên: 06/03/2014, 22:21
Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot
... FnBPA-2, FnBPA-3, FnBPA-4, FnBPA-5, FnBPA-6, FnBPA-7, FnBPA-8, FnBPA-9, FnBPA-10, and < /b> FnBPA-11, and < /b> FnBPB-1, FnBPB-2 ⁄ 3, FnBPB-4, FnBPB-5, FnBPB-6, FnBPB-7, FnBPB-8, FnBPB-9, FnBPB-10, and < /b> FnBPB-11, ... Fn ABP Fn ABP Fn ABP Fn ABP Fn A-< /b> 8 B Fn PA BP -9 Fn ABP 10 A < /b> -1 0.0 Fig Binding of < /b> Fn to the < /b> predicted FnBRs of < /b> FnBPB and < /b> FnBP...
Ngày tải lên: 06/03/2014, 22:21
Báo cáo khoa học: In situ proton NMR analysis of a-alkynoate biotransformations ppt
... compounds To get a deeper insight into such biotransformations in situ 1H -NMR analysis in 1H2O is a valuable analytical method, although the substrates themselves are often ÔinvisibleÕ Several metabolites ... characterization of the initial acetylene hydratase is inevitable In case of the other, more common enzymes, which are involved a genomic sequence analysis and a comp...
Ngày tải lên: 08/03/2014, 08:20
Security Analysis of a Cryptographically-Enabled RFID Device ppt
... a fraction of a second With additional use of an FPGA, an attacker can feasibly simulate a target DST after merely intercepting multiple authentication transcripts at longer range To validate ... the standpoint of an attacker, active scanning has the advantage of permitting a chosen-challenge attack Hence this type of attack permits the use of precomputed Hellman tables as...
Ngày tải lên: 16/03/2014, 19:20
Báo cáo khoa học: Isolation, characterization and expression analysis of a hypoxia-responsive glucose transporter gene from the grass carp, Ctenopharyngodon idellus potx
... 5¢-CCTGATCGACGCACGAGT-3¢ and GT1-R, 5¢-TTTTGCAAGTCATAGTAATCAGTTT-3¢ for GTcDNA1 (2150 bp); and GT2-F, 5¢-CACCAGCAACTAC CTGATCGA-3¢ and GT2-R, 5¢-CACAAAATATGCTT CCAAGTGC-3¢ for GT-cDNA2 (3043 bp) RNA isolation and ... revealed two putative polyadenylation (ATTAAA) signals: one is located 18 bp upstream from the poly (A) of GT-cDNA1 and another is located 11 bp upstream from...
Ngày tải lên: 17/03/2014, 03:20
Báo cáo khoa học: "Morphological Analysis of a Large Spontaneous Speech Corpus in Japanese" pptx
... Kanji, Hiragana, Number, Katakana, Alphabet (5:5) Kanji, Hiragana, Number, Katakana, Alphabet (5:5) Kanji→Hiragana, Number→Kanji, Katakana→Kanji, (25:25) Kanji, Hiragana, Number, Katakana, ... Using Maximum Entropy Aided by a Dictionary In Proceedings of EMNLP, pages 91–99 K Uchimoto, C Nobata, A Yamada, S Sekine, and H Isahara 2002 Morphological Analysis of The Spontaneous Spe...
Ngày tải lên: 17/03/2014, 06:20
14 point web copy analysis of a winning site pptx
... 'Peel Away' Outrageously Profitable Websites, and Learn Their Inside Secrets You Can Use to Turn YOURS Into a Profit-Pushing Powerhouse That Rams Streams of Cash Into Your Bank Account TODAY!" ... the planet, experts like Jonathan Mizel, Marlon Sanders, Joe Vitale, Yanik Silver and others, as they take you on a guided tour of their most profitable web sites Each online pro painstaki...
Ngày tải lên: 19/03/2014, 20:20