A numerical method for choice of weighting matrices in active controlled structures (p 55 72)

A numerical method for choice of weighting matrices in active controlled structures (p 55 72)

A numerical method for choice of weighting matrices in active controlled structures (p 55 72)

... earthquake First an ideal optimization has been performed A real earthquake record was used as an input signal After the parameters of the performance index have been obtained, the same earthquake ... it was assumed that the noised accelerations of all storeys are available and the control actuators are located at each storey of the structure The dynamics of the measuring instrument...
Ngày tải lên : 17/06/2016, 14:09
  • 18
  • 361
  • 0
a rapid method for estiminating of noise expouse workplace

a rapid method for estiminating of noise expouse workplace

... Golmohammadi R et al: A Rapid Method for Classification of workplaces based on noise pollution is one of the necessaries for macro programming view of monitoring and controlling of noise According ... in a workplace contain follows: The quality of wall sound absorption The quality of ceiling sound absorption The quality of roof sound absorption Mean of noise...
Ngày tải lên : 05/09/2013, 13:23
  • 7
  • 418
  • 0
Báo cáo khoa học: "A Nonparametric Method for Extraction of Candidate Phrasal Terms" docx

Báo cáo khoa học: "A Nonparametric Method for Extraction of Candidate Phrasal Terms" docx

... new method for measuring strength of lexical association for candidate phrasal terms based upon the use of Zipfian ranks over a frequency distribution combining n-grams of varying length The method ... study examined the performance of various association metrics on a corpus of 6.7 million words with a cutoff of N=10 The resulting n-gram set had a maximum recall of 2...
Ngày tải lên : 08/03/2014, 04:22
  • 9
  • 507
  • 1
báo cáo hóa học:" A promising method for identifying cross-cultural differences in patient perspective: the use of Internet-based focus groups for content validation of new Patient Reported Outcome assessments" potx

báo cáo hóa học:" A promising method for identifying cross-cultural differences in patient perspective: the use of Internet-based focus groups for content validation of new Patient Reported Outcome assessments" potx

... Stoop AP, Berg M: Integrating quantitative and qualitative methods in patient care information system evaluation: guidance for the organizational decision maker Methods of Information in Medicine ... that qualitative methods are used to validate conceptual meaning using phenomenological data (an inductive approach) and quantitative validation activities focus on measurement an...
Ngày tải lên : 20/06/2014, 15:20
  • 14
  • 441
  • 0
Báo cáo khoa hoc:" Quantitative competitive reverse transcription polymerase chain reaction is not a useful method for quantification of CD4 and CD8 cell status during HIV infection" pptx

Báo cáo khoa hoc:" Quantitative competitive reverse transcription polymerase chain reaction is not a useful method for quantification of CD4 and CD8 cell status during HIV infection" pptx

... Island, NY), 0.25 µg of each primer, mM MgC12 in each CD4 reaction and mM MgC12 for CD8 reactions, mM total dNTP's, and 0.5 U of Taq Polymerase For CD4 and CD8 reaction conditions were : 94° for ... or GAPDH The success of the RNA extraction and reverse transcription is determined by quantification of GAPDH mRNA by QC-RT-PCR Each value for quantit...
Ngày tải lên : 11/08/2014, 08:20
  • 4
  • 319
  • 0
báo cáo khoa học: " Surface electromyography as a screening method for evaluation of dysphagia and odynophagia" ppt

báo cáo khoa học: " Surface electromyography as a screening method for evaluation of dysphagia and odynophagia" ppt

... be a very timely addition to our evaluation techniques 16 Summary 17 Surface SEMG of swallowing is a simple and reliable method for screening and initial evaluation of dysphagia and odynophagia ... normative database and standard analysis Table 2: Quick reference simplified set of normative data for electric activity obtained by surface EMG for masseter...
Ngày tải lên : 11/08/2014, 20:20
  • 11
  • 315
  • 0
Báo cáo khoa học: " A simple and rapid method for detection of Goose Parvovirus in the field by loop-mediated isothermal amplification" pps

Báo cáo khoa học: " A simple and rapid method for detection of Goose Parvovirus in the field by loop-mediated isothermal amplification" pps

... laboratory and field settings Materials and methods Goslings, tissues, virus, DNA, and standard plasmid DNA templates preparation Goslings, tissues, virus, and standard plasmid DNA templates ... Sichuan Province, China 3Key Laboratory of Animal Diseases and Human Health of Sichuan Province, Yaan 625014, Sichuan Province, China 4College of Animal Sciences, Henan Institute of...
Ngày tải lên : 12/08/2014, 04:21
  • 7
  • 382
  • 0
ASTM D5453 Standard Test Method for Determination of Total Sulfur in Light Hydrocarbons, Spark Ignition Engine Fuel, Diesel Engine Fuel, and Engine Oil by Ultraviolet Fluorescence

ASTM D5453 Standard Test Method for Determination of Total Sulfur in Light Hydrocarbons, Spark Ignition Engine Fuel, Diesel Engine Fuel, and Engine Oil by Ultraviolet Fluorescence

... any item mentioned in this standard Users of this standard are expressly advised that determination of the validity of any such patent rights, and the risk of infringement of such rights, are ... 15.2 Bias—The bias of this test method was determined in a 1992 research report (RR:D02-1307)4 by analysis of standard reference materials (SRMs) containing known le...
Ngày tải lên : 20/10/2014, 17:16
  • 11
  • 1.7K
  • 2
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

... 5¢-GTTCACCACCAGAAGCT GGTGTTCTTCGCTGAAGACGTGGGTTCTAACAAG GGTGCT-3¢; Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢; Abstart, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢; Abstop, ... 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢ The PCR solution was prepared in the buffer supplied with the enzyme, and contained Aba, Abb and Abc at 40 nm each, and the start and...
Ngày tải lên : 18/02/2014, 13:20
  • 16
  • 691
  • 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

... GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products ... functions and intracellular signaling Thus, our system provides an accessible method to examine the endothelial cell biology of the mouse, and will accelerat...
Ngày tải lên : 18/02/2014, 17:20
  • 11
  • 873
  • 0
Báo cáo khoa học: A new and efficient method for inhibition of RNA viruses by DNA interference pptx

Báo cáo khoa học: A new and efficient method for inhibition of RNA viruses by DNA interference pptx

... and antisense strand (5¢-ATGAGTTTTCCAGAGCAACTT-3¢), and siRNA was synthesized using DNA templates (sense strand, 5¢-AAATGAGTTTTCCAGAGCAACCCTGTCTC-3¢; antisense strand, 5¢-AAGTTGCTCTGGAAAACTCATCCTG ... TTCTGGCCTTC-3¢, and that of s -DNA is 5¢-ATAGGCG GGAATTTTGCATC-3¢ Anti-TMV siRNA was synthesized using the DNA templates 5¢-AAGGGACGAGCA TATGTACACCCTGTCTC-3¢ and 5¢-AAGTGTACATAT G...
Ngày tải lên : 16/03/2014, 02:20
  • 9
  • 448
  • 0
Báo cáo khoa học: Kinetic hybrid models composed of mechanistic and simplified enzymatic rate laws – a promising method for speeding up the kinetic modelling of complex metabolic networks pptx

Báo cáo khoa học: Kinetic hybrid models composed of mechanistic and simplified enzymatic rate laws – a promising method for speeding up the kinetic modelling of complex metabolic networks pptx

... simplied rate laws for the construction of the Jacobian matrix used for the analysis of stability Enzymatic rate laws and other details of the full kinetic model are given in Appendix S1 Comparing ... and detailed rate laws (hybrid model, values in bold) The heading designates the type of load parameter varied and the range of variation relat...
Ngày tải lên : 23/03/2014, 06:20
  • 15
  • 456
  • 0
USAID Supported a Wide Range of Child and Maternal Health Activities, but Lacked Detailed Spending Data and a Proven Method for Sharing Best Practices pptx

USAID Supported a Wide Range of Child and Maternal Health Activities, but Lacked Detailed Spending Data and a Proven Method for Sharing Best Practices pptx

... expertise for child survival and maternal health within USAID Bureau for Asia and the Near East Bureau for Africa Bureau for Latin America and the Caribbean Oversee all country and regional missions ... the Child Survival and Maternal Health account in fiscal years 2004 and 2005 helped fund wide- ranging efforts to lower maternal and child mortality in...
Ngày tải lên : 28/03/2014, 09:20
  • 64
  • 379
  • 0
Báo cáo " A numerical model for the simulation of wave dynamics in the surf zone and near coastal structures " pot

Báo cáo " A numerical model for the simulation of wave dynamics in the surf zone and near coastal structures " pot

... the wave dynamics in the near shore  area  and in the vicinity  of coastal structures.   It  has  been  found  that  the numerical model can  satisfactorily  simulate  the wave transformation,  ... to  wave breaking  on  a natural  beach  To  verify  the accuracy  of the numerical model on  the simulation of the wave transformation  on  a natural  beach,  existin...
Ngày tải lên : 28/03/2014, 15:20
  • 11
  • 460
  • 0
Báo cáo khoa học: "A Bayesian Method for Robust Estimation of Distributional Similarities" pot

Báo cáo khoa học: "A Bayesian Method for Robust Estimation of Distributional Similarities" pot

... calculation of distributional similarity The method is straightforward: Instead of using the point estimation of v(wi ), we first estimate the distribution of the context profile, p(v(wi )), by Bayesian estimation ... Conclusion ′ This will give: We proposed a Bayesian method for robust distributional word similarities Our method uses a distribution of context pr...
Ngày tải lên : 30/03/2014, 21:20
  • 10
  • 472
  • 0