a powerful method for the analysis of genome destabilizing mechanisms

QuEChERS  A Mini-Multiresidue Method for the Analysis of Pesticide Residues in Low-Fat Products

QuEChERS A Mini-Multiresidue Method for the Analysis of Pesticide Residues in Low-Fat Products

... vigorously for a few seconds The minute extraction of the entire batch can be performed in parallel after the salts have been added to all the samples Michelangelo Anastassiades, CVUA Stuttgart QuEChERS ... Co-extracted fat and waxes may negatively affect the ruggedness of the GC analysis The co-extracted fats or waxes can be separated from the extracts to a large extent by putting them in the freezer ... degraded to carbofuran within the samples as well as in the extracts at pH Thus, merely if carbofuran is present in the acidified extract an additional run of the alkaline aliquot is needed Normally...

Ngày tải lên: 06/10/2016, 09:38

12 729 0
a novel method for the synthesis of titania nanotubes using

a novel method for the synthesis of titania nanotubes using

... al for amorphous titania nanotubes [30] However, the annealed titania nanotubes are crystalline (mostly anatase) and show varied activity depending on the material preparation and annealing atmosphere ... titania nanotubular arrays were annealed in a nitrogen and oxygen atmosphere at 500 ◦ C for h in a CVD furnace at a heating rate of ◦ C/min The UAT samples annealed under these conditions are designated ... (3.3 mA/cm2 ; Fig 13) This is due to the lower band gap of carbon-doped titania nanotubes compared with N2 - and O2 annealed nanotubes The lower the band gap of the titania S.K Mohapatra et al /...

Ngày tải lên: 05/05/2014, 15:26

8 634 0
a novel method for the synthesis of cao nanoparticle

a novel method for the synthesis of cao nanoparticle

... capping CuO, AP-Fe2O3, AP-Al2O3 and AP-CaO [15­ agent was reported Then, we have focused 20] There are several methods for the synthesis our attention on the CaO nanoparticles/ of nanoscale CaO, including ... colloidal particles in water the high surface area due to smaller particle and many non-aqueous solvents by adsorbing size and the reactive sites tailored in the form onto a broad range of materials, ... (2013) GC analysis illustrated that 75% and 100% of 2-CEPS For the evaluation of the reaction of 2-CEPS in contact to the CaO NPs with weight ratio as a sulfurous pollutant on the CaO NPs/ of 1:40...

Ngày tải lên: 06/05/2014, 08:55

12 705 0
báo cáo hóa học:" A rapid method for the generation of uniform acellular bone explants: a technical note" pot

báo cáo hóa học:" A rapid method for the generation of uniform acellular bone explants: a technical note" pot

... with the planning and preparation of the manuscript PIF and AES participated in the cutting and staining of Page of the bone tissue RGR participated in the planning of the experiments, data analysis ... analysis and the preparation of the manuscript MJS supervised the study planning, data analysis and preparation of the manuscript All authors read and approved the final manuscript Acknowledgements The ... analyzed the data and prepared the manuscript VB participated in the preparation of the bone cores and exposure of the samples to the different treatments, performed the microscopic analysis and helped...

Ngày tải lên: 20/06/2014, 04:20

4 403 0
Tài liệu Báo cáo khoa học: A systems biology approach for the analysis of carbohydrate dynamics during acclimation to low temperature in Arabidopsis thaliana doc

Tài liệu Báo cáo khoa học: A systems biology approach for the analysis of carbohydrate dynamics during acclimation to low temperature in Arabidopsis thaliana doc

... slightly lower mean rates of carbon uptake before and during the first day of cold acclimation After days of cold exposure, the mean rate of carbon uptake was significantly lower for C24 than for Rsch ... T, Sawodny O, Ederer M & Heyer AG (2010) Mathematical modelling of the central carbohydrate metabolism in Arabidopsis thaliana reveals a substantial regulatory influence of vacuolar invertase ... Experimental procedures, the rate of assimilate export from photosynthetically active source organs to consuming sink organs or metabolic pathways other than carbohydrate pathways was calculated as the...

Ngày tải lên: 14/02/2014, 22:20

13 708 0
Báo cáo Y học: Modeling the three-dimensional structure of H+-ATPase of Neurospora crassa Proposal for a proton pathway from the analysis of internal cavities pptx

Báo cáo Y học: Modeling the three-dimensional structure of H+-ATPase of Neurospora crassa Proposal for a proton pathway from the analysis of internal cavities pptx

... enzymes for which structural data are available MATERIALS AND METHODS Building the 3D model of PMA1_NEUCR In our approach, the model of PMA1_NEUCR was built using the ATC1_RABIT crystal structure as ... (1994) Computer analysis of bacterial haloacid dehalogenases defines a large superfamily of hydrolases with diverse specificity Application of an iterative approach to database search J Mol Biol ... aspartate (Asp378 in PMA1_NEUCR), several cavities are also seen at the same position in ATC1_RABIT (data not shown) Aside from mutations directed against a small stretch of amino acids adjacent to the...

Ngày tải lên: 23/03/2014, 21:20

13 514 0
Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx

Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx

... GTGGTCGATTTTGCCAGCCTGTACCCGAGCATCATCCAGGCGCACAACCTGTGC GTAGTAGACTTTGCTAGCCTGTATCCTAGTATTATACAAGCTCATAATCTATGC GTGGTGGACTTTGCCAGCCTGTACCCCACCATCATCCAGGCCCACAACCTCTGC GTAGTGGACTTTGCCAGCCTGTACCCAAGCATTATTCAGGCACACAATCTGTGT GTAGTTGACTTTGCCAGCTTGTACCCCAGCATCATCCAGGCTCATAATCTATGC ... (151aa) CAB61754 (151aa) AAC55648 (55aa) AAD30141 (56aa) AAG23218 (158aa) AAC57974 (151aa) DFASA-GDTD1B AAF23082 (158aa) DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B ... GTTTTTGATTTCCAAAGTTTGTATCCAAGTATTATGATGGCTCATAATCTGTGT RhCMV GTGTTTGACTTTGCCAGCCTGTATCCGTCAATTATCATGGCACATAATCTCTGT RFHVMm GTTGTGGATTTTGCTAGCCTTTATCCCAGCATCATGCAGGCCCACAACCTATGT γ AtHV3 GTAGTAGACTTTGCTAGCCTTTACCCAAGTATTATACAAGCTCATAATCTGTGT...

Ngày tải lên: 18/06/2014, 22:20

24 605 0
báo cáo hóa học:" Mid-term results of ponseti method for the treatment of congenital idiopathic clubfoot (A study of 67 clubfeet with mean five year follow-up)" pot

báo cáo hóa học:" Mid-term results of ponseti method for the treatment of congenital idiopathic clubfoot (A study of 67 clubfeet with mean five year follow-up)" pot

... DP participate and analysis the study HC designed and coordinated and drafted the manuscript All authors read and approved the final manuscript Porecha et al Journal of Orthopaedic Surgery and ... Page of 100 points indicating a normal foot This includes a maximum score of 30 points for amount of pain; of 20 points each for level of activity and patient satisfaction; and of 10 points each ... permits and consists of gentle manipulation of the foot and the serial application of long leg plaster casts at weekly interval without the use of anesthesia, as described by Ponseti [4] In all patients,...

Ngày tải lên: 20/06/2014, 04:20

7 532 0
báo cáo hóa học:" Mid-term results of ponseti method for the treatment of congenital idiopathic clubfoot (A study of 67 clubfeet with mean five year follow-up)" docx

báo cáo hóa học:" Mid-term results of ponseti method for the treatment of congenital idiopathic clubfoot (A study of 67 clubfeet with mean five year follow-up)" docx

... DP participate and analysis the study HC designed and coordinated and drafted the manuscript All authors read and approved the final manuscript Porecha et al Journal of Orthopaedic Surgery and ... Page of 100 points indicating a normal foot This includes a maximum score of 30 points for amount of pain; of 20 points each for level of activity and patient satisfaction; and of 10 points each ... permits and consists of gentle manipulation of the foot and the serial application of long leg plaster casts at weekly interval without the use of anesthesia, as described by Ponseti [4] In all patients,...

Ngày tải lên: 20/06/2014, 07:20

7 803 0
Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt

Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt

... Capture probe 5-GAGGAGGATGAAATAGATGGTCCAGCTGG ACAAGCAGAACCGGACAGAGCCCATTACAATAT TGTAACCTTTTGTTGCAAGTGTGACTCT ACGCTTCGGT-3 Secondary probe 5-GGAGCGACCCAGAAAGTTACCACAGTTATGC ACAGAGCTGCAAACAACTA-3 ... hybridization assay method only require extraction of DNA of the samples and simple incubation as well as magnetic separation, which has a good acceptability for any average lab assistant Table Comparison ... conceived of the study, and participated in its design, performed the preparation of nanomaterials and the statistical analysis All authors read and approved the final manuscript Competing interests The...

Ngày tải lên: 21/06/2014, 01:20

9 469 0
A FUNCTIONAL-ANALYTIC METHOD FOR THE STUDY OF DIFFERENCE EQUATIONS EUGENIA N. PETROPOULOU AND potx

A FUNCTIONAL-ANALYTIC METHOD FOR THE STUDY OF DIFFERENCE EQUATIONS EUGENIA N. PETROPOULOU AND potx

... partial difference equations of three and four variables The aim of this paper is to present the generalization of this functional-analytic method for the study of linear and nonlinear partial ... details, see [11] and the references therein) Also, by assuring the existence of a solution of a difference equation in the space or , we obtain information regarding the asymptotic behavior of the ... equation under consideration into an equivalent linear or nonlinear operator equation in an abstract separable Hilbert H or Banach H1 space Then, after some manipulations, we bring the linear...

Ngày tải lên: 23/06/2014, 00:20

12 257 0
Báo cáo y học: "A standardized scoring method for the copy of cube test, developed to be suitable for use in psychiatric populations" pdf

Báo cáo y học: "A standardized scoring method for the copy of cube test, developed to be suitable for use in psychiatric populations" pdf

... concentrate enough This includes the following four series’ of letters: LTPEAOAISTDALAA, ANIABFSAMPZEOAD, PAKLATSXTOEABAA and ZYFMTSAHEOAAPAT The first and third group include five A s, while the ... Psychopathology scales), the YMRS and the MADRS are shown in Table The results of the factor analysis (varimax normalized rotation) are shown in Table The analysis (by using the Keiser-Fleish criterion of eigenvalues ... because it is an index of correlation and not an index of agreement [19-21] The calculation of means and standard deviations for each SCCT item and total score during the rating by each examiner...

Ngày tải lên: 09/08/2014, 01:21

10 475 0
Báo cáo khoa học: "A new method for the histochemical localization of laccase in Rhus verniciflua Stokes" docx

Báo cáo khoa học: "A new method for the histochemical localization of laccase in Rhus verniciflua Stokes" docx

... significant features of laccase in Rhus species The brown deposit in the sections indicates the localization of active laccase in situ Activity of laccase is also stimulated by its natural substrate ... noted that the allergic skin reaction of humans to quin-urushiol is still treated as a serious disease in China Evolutionarily, laccase and its substrates seem to be an adaptation of the lacquer ... the present paper may be used to bridge these gaps In the lacquer tree, laccase may play a role in sealing-off damaged tissue It could also be involved in a defense mechanism against pathogens by...

Ngày tải lên: 09/08/2014, 03:24

4 355 0
Báo cáo y học: "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" pptx

Báo cáo y học: "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" pptx

... positions of products that overlap at least nucleotides on the same arm of the hairpin, and the offset of overlapping products on opposite arms of the hairpin are used to evaluate the spacing and distribution ... RNA silencing Proc Natl Acad Sci USA 2008, 105:7964-7969 33 Katayama S, Tomaru Y, Kasukawa T, Waki K, Nakanishi M, Nakamura M, Nishida H, Yap CC, Suzuki M, Kawai J, Suzuki H, Carninci P, Hayashizaki ... Additional file Many quantities we consider pertain to the structure of the hairpin and positions of reads The distance between a miR and moR on the same arm of the hairpin, the offset of the 5'...

Ngày tải lên: 09/08/2014, 20:21

12 553 0
báo cáo khoa học:" Sinus lifting before Le Fort I maxillary osteotomy: a suitable method for oral rehabilitation of edentulous patients with skelettal class-III conditions: review of the literature and report of a case" doc

báo cáo khoa học:" Sinus lifting before Le Fort I maxillary osteotomy: a suitable method for oral rehabilitation of edentulous patients with skelettal class-III conditions: review of the literature and report of a case" doc

... implants were accurately positioned in the mandible and the maxilla according to the predefined planning that was made up of DVT scan and a wax up Again bone augmentation around the dental implants ... definite abutments and removing the auxililary implants final restauration was placed (figure 5) Discussion The main basic criteria for restauration of the edentulous maxilla and mandible are adequate ... bone mass and ortholalveolar form [6] This can be achieved by augmentation of the available substrate using established techniques such as vertical and lateral augmentation of the alveolar ridge,...

Ngày tải lên: 11/08/2014, 23:22

7 375 0
Báo cáo y học: "A novel human ex vivo model for the analysis of molecular events during lung cancer chemotherapy" pptx

Báo cáo y học: "A novel human ex vivo model for the analysis of molecular events during lung cancer chemotherapy" pptx

... breaks in apoptotic cells by the TUNEL labelling assay, to further validate the importance of cleaved caspase-3 as a relevant biomarker for apoptosis In an ideal setup these data would have been ... (GAPDH) (forward 5'AGAACGGGAAGCTTGTCATC; reverse 5'TGC-TGATGATCTTGAGGCTG) spanning an amplicon of 247 bp were always run in parallel for reasons of control RT-PCR products of caspase-3 were normalized ... shifting the mean value above the corresponding mean value of the untreated cultured tumor samples Therefore, the median values are also given in Table The general expression levels of caspase-3...

Ngày tải lên: 12/08/2014, 15:20

11 573 0
Báo cáo y học: " A method for the generation of standardized qualitative dynamical systems of regulatory networks" doc

Báo cáo y học: " A method for the generation of standardized qualitative dynamical systems of regulatory networks" doc

... paragraph, the equations have the same qualitative shape for any value assigned to the parameters Hence, for the sake of simplicity, it is possible to assign the same values to most of the parameters, ... that the activation of a node has the form of a sigmoid, bounded in the interval [0,1] regardless of the values of h xa xa Figure 10 Activation of a node as a function of one positive input Activation ... has a total of 58 parameters, all of which were set to the default value of 1, and one parameter (the gain of the sigmoids) with a default value of 10 This set of default values sufficed to capture...

Ngày tải lên: 13/08/2014, 23:20

18 288 0
Báo cáo y học: "The Sequence Ontology: a tool for the unification of genome annotations" potx

Báo cáo y học: "The Sequence Ontology: a tool for the unification of genome annotations" potx

... to make sure that the data adhere SO is not a database schema, nor is it a file format; it is an ontology As such, SO transcends any particular database schema or file format This means it can ... practical utility of SO as a tool for data management and analysis, we have used SO to name and enumerate the parts of every protein-coding annotation in the D melanogaster genome Doing so has allowed ... terms are shown in bold The terms are always depicted exactly as they appear in the ontology The names of EM operators are underlined SO, SOFA, and the feature table To facilitate the use of SO for...

Ngày tải lên: 14/08/2014, 14:21

12 299 0
Báo cáo y học: "ChIPOTle: a user-friendly tool for the analysis of ChIP-chip data" docx

Báo cáo y học: "ChIPOTle: a user-friendly tool for the analysis of ChIP-chip data" docx

... for each peak, highest raw log2 ratio for any element within the peak, start coordinate of the peak, the width of portion of the peak above the significance cutoff, 'array density' of the peak, ... peak, and the P value for that peak The array density value is defined as the average number of arrayed elements used to calculate the window values for all windows that comprise the peak Therefore, ... identically distributed, and random variables, having a Gaussian distribution with a mean of zero The variance of the observations is estimated by the average sum of the squared negative log ratios...

Ngày tải lên: 14/08/2014, 15:20

8 334 0
w