BEMFVM conjugate heat transfer analysis of a threedimensional film cooled turbine blade
BEMFVM conjugate heat transfer analysis of a threedimensional film cooled turbine blade
... and temperatures, in the case of CHT analysis, or displacement and traction, in the case of aero-elasticity analysis A different approach was taken by Li and Kassab (199 4a, b) and Ye et al (1998), ... conjugate heat analytically or numerically, and the heat conduction equation transforms to a transfer analysis Laplace equation for the transform parameter U(T ) The heat conduction equation ... prediction of fluid flow and heat transfer in turbine blades with internal cooling”, AIAA/ASME Paper 94-2933 Li, H and Kassab, A. J (1994b), A coupled FVM/BEM solution to conjugate heat transfer in turbine...
- 30
- 395
- 0
Experimental investigation and comparison of heat transfer coefficient of a two phase closed thermosyphon
... the heat transfer coefficient of condenser and evaporator and the heat transfer limits were investigated The analytical heat transfer coefficient and the heat transfer limits and the experimental ... Eq(4) and found that the condensation heat transfer increases as the filling ratio increases and the maximum condensation heat transfer coefficient takes place at φ=30° for FR=22% and 30% and at ... with vapor characteristics and inside diameter of evaporator The transfer of heat into a heat pipe produces a temperature gradient across the wall of the tube At the interface between the wall and...
- 10
- 255
- 0
Computational fluid dynamics analysis of a twisted airfoil shaped two-bladed H-Darrieus rotor made from fibreglass reinforced plastic (FRP)
... types of Darrieus rotors are mainly available, namely troop skein (Eggbeater) Darrieus rotor and H-Darrieus rotor H-Darrieus rotor was in the same patent of 1931[2] It has two to three airfoil shaped ... 0.265 at a TSR of 2.214, and the maximum Ct obtained is 0.124 at a TSR of 1.962 And the standard deviation of computational Cp from experimental Cp is 0.81% and that of computational Ct from experimental ... 23 (a) Variation of Ct with TSR, and (b) deviation of computational Ct from experimental Cp for H/D ratio 2.10 (a) (b) Figure 24 (a) Variation of Cp with TSR, and (b) deviation of computational...
- 16
- 364
- 0
Báo cáo hóa học: " Anomalous heat transfer modes of nanofluids: a review based on statistical analysis" doc
... carbide/water nanofluid Int J Heat Mass Transfer 2009, 52:3606-3612 127 Zhang Z: Radiative properties of nanomaterials and radiative heat transfer at the nanoscale Presentation at the 44th AIAA Aerospace ... Anomalous heat transfer modes of nanofluids: a statistical analysis approach review 9th HSTAM Congress on Mechanics, Limassol, Cyprus 2010, 12-14 105 Sharma NN: Radiation model for nanoparticle: ... Phonon transfer A few researchers suggested that nanofluids have an increased heat transfer rate due to specialised phonon and electron interaction and scattering at the nanoscales (ballistic heat...
- 37
- 338
- 0
Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx
... GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGCCCTTCCGGAGAAGA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGGCACTTAACCCATG ... GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTATGGAGTTGAACTAGCTGT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT Length (bp/amino acids) ... of a small heat shock /a- crystallin protein (p26) in encysted embryos of the brine shrimp, Artemia franciscana Am Zool 39, 836–847 Liang, P & MacRae, T.H (1999) The synthesis of a small heat shock /a- crystallin...
- 10
- 495
- 0
A STUDY ON ENHANCING HEAT TRANSFER EFFICIENCY OF LED lamps
... temperature of heat sink for Model heat sink configuration was the lowest It is due to the fact that Model heat sink configuration has the largest heat transfer area The 2012 International Conference on ... temperature of heat sink was measured to be 49 ºC Fig shows temperature profiles of heat sink and air for model heat sink configuration Table Accuracies and ranges of testing apparatuses Testing apparatus ... [10] Thanhtrung Dang, Ngoctan Tran and Jyh-tong Teng, Numerical and Experimental investigations on heat transfer phenomena of an aluminium microchannel heat sink, Applied Mechanics and Materials,...
- 8
- 345
- 1
Economic feasibility analysis of a wind farm in Caldas da Rainha, Portugal
... understand the behavior of the variables involved in economical and financial assessing of a wind farm as a manner of validating the indicators of attractiveness and risk of energy projects and analysis ... projects and costs evaluation The economic assessment of hypothetical wind farm installed in Caldas da Rainha, we obtained the following results: Attractiveness Table Economic and financial indicators ... considered the same parameters defined in Tables and in Software RETScreen International Clean Energy Project Analysis in order to make an analysis of economic and financial viability of wind energy...
- 14
- 416
- 1
Reliability analysis of a power system based on the multi state system theory
... V RELIABILITY ANALYSIS OF THE POWER SYSTEM The reliability of the power system is analyzed using the multi- state system theory According to (2), the universal generating function of the battery ... this paper, and is compared 97 (1) The reliability of the power system obtained by the traditional system reliability theory is always conservative [5] (2) The power system is a multi- state system ... reliability theory are always conservative For example, when the required capacity is 23.4 Ah, the reliability of the system obtained by the traditional system reliability theory is only 0.25107, but the...
- 4
- 407
- 0
Báo cáo khoa học: Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid pdf
... and Crystal structure of Staphylococcus aureus EF -G Carl Trygger’s Foundation to M Selmer and S Sanyal, the Goran Gustafsson Foundation to S Sanyal, ¨ and Magnus Bergvall’s foundation and the ... Crystal structure of a mutant elongation factor G trapped with a GTP analogue FEBS Lett 579, 449 2–4 497 Laurberg M, Kristensen O, Martemyanov K, Gudkov AT, Nagaev I, Hughes D & Liljas A (2000) Structure ... Structure 1, 3 5–5 0 Liljas A, Kristensen O, Laurberg M, Al-Karadaghi S, Gudkov A, Martemyanov K, Hughes D & Nagaev I (2000) The states, conformational dynamics, and fusidic acid- resistant mutants...
- 15
- 474
- 0
Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot
... FnBPA-2, FnBPA-3, FnBPA-4, FnBPA-5, FnBPA-6, FnBPA-7, FnBPA-8, FnBPA-9, FnBPA-10, and < /b> FnBPA-11, and < /b> FnBPB-1, FnBPB-2 ⁄ 3, FnBPB-4, FnBPB-5, FnBPB-6, FnBPB-7, FnBPB-8, FnBPB-9, FnBPB-10, and < /b> FnBPB-11, ... Fn ABP Fn ABP Fn ABP Fn ABP Fn A-< /b> 8 B Fn PA BP -9 Fn ABP 10 A < /b> -1 0.0 Fig Binding of < /b> Fn to the < /b> predicted FnBRs of < /b> FnBPB and < /b> FnBPA (A,< /b> C) ELISA Recombinant His-tagged FnBRB (A)< /b> and < /b> FnBRA (C) and < /b> their ... fnbB P1 fnbA fnbB spa Wild type spa::Kanr fnbA::Tetr fnbB::Ermr spa::Kanr fnbA::Tetr fnbB::Ermr P1 fnbA fnbB spa (pCU1 fnbA+) spa::Kanr fnbA::Tetr fnbB::Ermr (pCU1::fnbA+ Cmr) P1 fnbA fnbB spa...
- 16
- 560
- 0
Báo cáo khoa học: In situ proton NMR analysis of a-alkynoate biotransformations ppt
... compounds To get a deeper insight into such biotransformations in situ 1H -NMR analysis in 1H2O is a valuable analytical method, although the substrates themselves are often ÔinvisibleÕ Several metabolites ... characterization of the initial acetylene hydratase is inevitable In case of the other, more common enzymes, which are involved a genomic sequence analysis and a comparison to the genome of other strains ... by in situ 1H -NMR analysis (1H d: 3.06 p.p.m) in 1H2O Spectra indicated the additional presence of a small amount of 3-ketopropanoate (1H d: 3.48 p.p.m) and acetaldehyde (1H d: 1.17 p.p.m) during...
- 6
- 360
- 0
Security Analysis of a Cryptographically-Enabled RFID Device ppt
... a fraction of a second With additional use of an FPGA, an attacker can feasibly simulate a target DST after merely intercepting multiple authentication transcripts at longer range To validate ... the standpoint of an attacker, active scanning has the advantage of permitting a chosen-challenge attack Hence this type of attack permits the use of precomputed Hellman tables as touched on above ... kit contained a reader and antenna, as well as a variety of non-DST RFID devices We were able to separately purchase small quantities of DST devices in two different form factors To explain our...
- 15
- 550
- 0
Báo cáo khoa học: Isolation, characterization and expression analysis of a hypoxia-responsive glucose transporter gene from the grass carp, Ctenopharyngodon idellus potx
... 5¢-CCTGATCGACGCACGAGT-3¢ and GT1-R, 5¢-TTTTGCAAGTCATAGTAATCAGTTT-3¢ for GTcDNA1 (2150 bp); and GT2-F, 5¢-CACCAGCAACTAC CTGATCGA-3¢ and GT2-R, 5¢-CACAAAATATGCTT CCAAGTGC-3¢ for GT-cDNA2 (3043 bp) RNA isolation and ... revealed two putative polyadenylation (ATTAAA) signals: one is located 18 bp upstream from the poly (A) of GT-cDNA1 and another is located 11 bp upstream from the poly (A) of GT-cDNA2 (data not ... 5¢-RACE and the two alternate 3¢-ends of exon 12 were deduced by 3¢-RACE, and are delineated by the full-length cDNA clones, GT-cDNA1 and GT-cDNA The two putative polyadenylation sites (ATTAAA) are...
- 8
- 465
- 0
Báo cáo khoa học: "Morphological Analysis of a Large Spontaneous Speech Corpus in Japanese" pptx
... Kanji, Hiragana, Number, Katakana, Alphabet (5:5) Kanji, Hiragana, Number, Katakana, Alphabet (5:5) Kanji→Hiragana, Number→Kanji, Katakana→Kanji, (25:25) Kanji, Hiragana, Number, Katakana, ... Using Maximum Entropy Aided by a Dictionary In Proceedings of EMNLP, pages 91–99 K Uchimoto, C Nobata, A Yamada, S Sekine, and H Isahara 2002 Morphological Analysis of The Spontaneous Speech Corpus ... Extraction from Corpora and Its Part -of- Speech Estimation Using Distributional Analysis In Proceedings of COLING, pages 1119–1122 M Nagata 1999 A Part of Speech Estimation Method for Japanese...
- 10
- 398
- 0
Từ khóa: a novel theory in heat transfer analysis and optimizationmorphological analysis of a large spontaneous speechequity analysis of a project414 algebraic analysis of a logic circuit with nand and nor gates772 feedback analysis of a d latchmonte carlo analysis of a pressure sensospecialist s analysis of a series of dna samplesdesign and fe analysis of a 150 kw machinean analysis of a successful emergency telemedicine ventureanalysis of a uk portfolioanalysis of a suspectprogram windowsanalysis of a mixing processanalysis of a rd unitsolution to unsteady state heat transfer problem using a spherical object as an exampleanalysis of a differential fluid element in laminar flowMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam