BEMFVM conjugate heat transfer analysis of a threedimensional film cooled turbine blade

... and temperatures, in the case of CHT analysis, or displacement and traction, in the case of aero-elasticity analysis A different approach was taken by Li and Kassab (199 4a, b) and Ye et al (1998), ... conjugate heat analytically or numerically, and the heat conduction equation transforms to a transfer analysis Laplace equation for the transform parameter U(T ) The heat...

Ngày tải lên: 16/06/2016, 01:11

... the heat transfer coefficient of condenser and evaporator and the heat transfer limits were investigated The analytical heat transfer coefficient and the heat transfer limits and the experimental ... Eq(4) and found that the condensation heat transfer increases as the filling ratio increases and the maximum condensation heat transfer coefficient t...

Ngày tải lên: 09/09/2015, 10:32

... types of Darrieus rotors are mainly available, namely troop skein (Eggbeater) Darrieus rotor and H-Darrieus rotor H-Darrieus rotor was in the same patent of 1931[2] It has two to three airfoil shaped ... 0.265 at a TSR of 2.214, and the maximum Ct obtained is 0.124 at a TSR of 1.962 And the standard deviation of computational Cp from experimental Cp is 0.81% an...

Ngày tải lên: 05/09/2013, 15:28

... carbide/water nanofluid Int J Heat Mass Transfer 2009, 52:3606-3612 127 Zhang Z: Radiative properties of nanomaterials and radiative heat transfer at the nanoscale Presentation at the 44th AIAA Aerospace ... Anomalous heat transfer modes of nanofluids: a statistical analysis approach review 9th HSTAM Congress on Mechanics, Limassol, Cyprus 2010, 12-14 105 Sharma...

Ngày tải lên: 21/06/2014, 03:20

... GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGCCCTTCCGGAGAAGA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGGCACTTAACCCATG ... GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTATGGAGTTGAACTAGCTGT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCC...

Ngày tải lên: 22/02/2014, 04:20

... temperature of heat sink for Model heat sink configuration was the lowest It is due to the fact that Model heat sink configuration has the largest heat transfer area The 2012 International Conference on ... temperature of heat sink was measured to be 49 ºC Fig shows temperature profiles of heat sink and air for model heat sink configuration Table Accuracies and ranges...

Ngày tải lên: 26/05/2014, 21:29

... understand the behavior of the variables involved in economical and financial assessing of a wind farm as a manner of validating the indicators of attractiveness and risk of energy projects and analysis ... projects and costs evaluation The economic assessment of hypothetical wind farm installed in Caldas da Rainha, we obtained the following results: Attr...

Ngày tải lên: 05/09/2013, 14:59

... V RELIABILITY ANALYSIS OF THE POWER SYSTEM The reliability of the power system is analyzed using the multi- state system theory According to (2), the universal generating function of the battery ... this paper, and is compared 97 (1) The reliability of the power system obtained by the traditional system reliability theory is always co...

Ngày tải lên: 03/01/2014, 19:38

... and Crystal structure of Staphylococcus aureus EF -G Carl Trygger’s Foundation to M Selmer and S Sanyal, the Goran Gustafsson Foundation to S Sanyal, ¨ and Magnus Bergvall’s foundation and the ... Crystal structure of a mutant elongation factor G trapped with a GTP analogue FEBS Lett 579, 449 2–4 497 Laurberg M, Kristensen O, Martemyanov K, Gudkov AT, Nagaev I...

Ngày tải lên: 06/03/2014, 22:21

... FnBPA-2, FnBPA-3, FnBPA-4, FnBPA-5, FnBPA-6, FnBPA-7, FnBPA-8, FnBPA-9, FnBPA-10, and < /b> FnBPA-11, and < /b> FnBPB-1, FnBPB-2 ⁄ 3, FnBPB-4, FnBPB-5, FnBPB-6, FnBPB-7, FnBPB-8, FnBPB-9, FnBPB-10, and < /b> FnBPB-11, ... Fn ABP Fn ABP Fn ABP Fn ABP Fn A-< /b> 8 B Fn PA BP -9 Fn ABP 10 A < /b> -1 0.0 Fig Binding of < /b> Fn to the < /b> predicted FnBRs of < /b> FnBPB and < /b> FnBP...

Ngày tải lên: 06/03/2014, 22:21

... compounds To get a deeper insight into such biotransformations in situ 1H -NMR analysis in 1H2O is a valuable analytical method, although the substrates themselves are often ÔinvisibleÕ Several metabolites ... characterization of the initial acetylene hydratase is inevitable In case of the other, more common enzymes, which are involved a genomic sequence analysis and a comp...

Ngày tải lên: 08/03/2014, 08:20

... a fraction of a second With additional use of an FPGA, an attacker can feasibly simulate a target DST after merely intercepting multiple authentication transcripts at longer range To validate ... the standpoint of an attacker, active scanning has the advantage of permitting a chosen-challenge attack Hence this type of attack permits the use of precomputed Hellman tables as...

Ngày tải lên: 16/03/2014, 19:20

... 5¢-CCTGATCGACGCACGAGT-3¢ and GT1-R, 5¢-TTTTGCAAGTCATAGTAATCAGTTT-3¢ for GTcDNA1 (2150 bp); and GT2-F, 5¢-CACCAGCAACTAC CTGATCGA-3¢ and GT2-R, 5¢-CACAAAATATGCTT CCAAGTGC-3¢ for GT-cDNA2 (3043 bp) RNA isolation and ... revealed two putative polyadenylation (ATTAAA) signals: one is located 18 bp upstream from the poly (A) of GT-cDNA1 and another is located 11 bp upstream from...

Ngày tải lên: 17/03/2014, 03:20

... Kanji, Hiragana, Number, Katakana, Alphabet (5:5) Kanji, Hiragana, Number, Katakana, Alphabet (5:5) Kanji→Hiragana, Number→Kanji, Katakana→Kanji, (25:25) Kanji, Hiragana, Number, Katakana, ... Using Maximum Entropy Aided by a Dictionary In Proceedings of EMNLP, pages 91–99 K Uchimoto, C Nobata, A Yamada, S Sekine, and H Isahara 2002 Morphological Analysis of The Spontaneous Spe...

Ngày tải lên: 17/03/2014, 06:20