Virus diversity and cross species transmission of viruses from the straw coloured fruit bat eidolon helvum
... for the establishment of a zoonotic virus The host must be susceptible to the virus, the environmental conditions must provide stability and viability of the virus and the host, and the virus ... bats and the virus was isolated from bats in 2012, linking Menangle virus to fruit bats [91, 94, 95] In Ghana, two Rubulaviruses, Achimota and 2, were iso...
Ngày tải lên: 25/11/2015, 15:24
... Mouinga-Ondémé et al.: Two distinct variants of simian foamy virus in naturally infected mandrills (Mandrillus sphinx) and cross-species transmission to humans Retrovirology 2010 7:105 Submit your ... monkey species living in central Africa, is naturally infected with SFV We evaluated the natural history of the virus in a free-ranging colony of...
Ngày tải lên: 13/08/2014, 01:20
... suppressing the silencing of their RNA The Rice yellow mottle virus, belonging to the Sobemovirus genus, is endemic to Africa and is the major pathogen of irrigated rice [15,16] Its genome and particle ... representative of the diversity of P1 with a divergence up to 17.8% were selected These isolates are representative of the diversity of the ot...
Ngày tải lên: 20/06/2014, 01:20
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx
... GTGATTCATGGTGGAAATACGCCCCCATCAGGGGGCTGG TTTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGCAGCCTCCAGGA CCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTTTT AAAAACCGGTTCCGCAGACCACTATGGCTCTCCCGGGAGGGGGGG TCCTGGAGGCTGCGCCCCCATCAGGGGGCTGGCGCGGCCGCAAAA ... GCCAGCCCCCTGATGGGGGCGA TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT GCCAGACACTCCACCATGAATCACTCCCCTGTGAGGAACTACTGTCTTCACG TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT TTTGCGGCCGCG...
Ngày tải lên: 20/02/2014, 01:20
Báo cáo khoa học: Cross-species divergence of the major recognition pathways of ubiquitylated substrates for ubiquitin⁄26S proteasome-mediated proteolysis potx
... results support a cross-species mechanistic and functional divergence of the major recognition pathways for the ubiquitylated substrates of UPP dominant targeting signal for UPP [6], the K63-linked ... The divergent structural requirements of the major ubiquitin receptors for ubiquitin chain binding To examine the cross-species divergence of the...
Ngày tải lên: 15/03/2014, 09:20
Báo cáo hóa học: " Research Article Development of Long-Range and High-Speed Wireless LAN for the Transmission of Telemedicine from Disaster Areas" pdf
... Nagano) The wireless networks made up of these wireless LAN units are shown in Figure The wireless LAN in 2.4 GHz band should be operated in line of sight The area between the main drill site and ... high-speed wireless LAN to establish an emergency network for the disaster prevention and the postdisaster communications supported by the Fire and Di...
Ngày tải lên: 22/06/2014, 06:20
Báo cáo khoa học: " Photosynthesis and shoot water status of seedlings from different oak species submitted to waterlogging" pdf
... related to the degree of tolerance? to or are The aims of this study were: 1), to establish the nature and intensity of the reactions of A and g of oak seedlings to root hypoxia; 2), to test ... long term flooding, and shoot photosynthesis, leaf conductance to CO and water status; 3), to analyze the differences in the behavior of oak species wit...
Ngày tải lên: 08/08/2014, 23:21
Báo cáo khoa hoc:"Microsatellite loci in Japanese quail and cross-species amplification in chicken and guinea fowl" pps
... 3.3 Cross-species amplification of Japanese quail markers in chicken and guinea fowl Table I also shows the results of cross-species amplification of all 100 quail markers in chicken and guinea ... of chicken and guinea fowl loci amplified by Japanese quail markers The sequence information of 10 chicken loci amplified by cross-species PCR is summari...
Ngày tải lên: 09/08/2014, 18:21
Cross-species comparison of genome-wide expression patterns pptx
... pathways and neuronal functions [9] Cross-species comparison of specific biological processes Besides the global expression modules, comparison of the expression patterns of genes involved in particular ... of genes, both in metagene co -expression networks [9] and in the expression networks of different organisms [10] Certain features of gene -expression networks...
Ngày tải lên: 09/08/2014, 20:20
báo cáo khoa học:" Performance and cross-cultural comparison of the short-form version of the CPQ11-14 in New Zealand, Brunei and Brazil" pps
... al.: Performance and cross-cultural comparison of the short-form version of the CPQ11-14 in New Zealand, Brunei and Brazil Health and Quality of Life Outcomes 2011 9:40 Competing interests The ... experience, there were distinct CPQ differences (in both the overall and the domain scores) between those who were in the highest quartile for DMFS...
Ngày tải lên: 12/08/2014, 01:22
Báo cáo y học: "Estimation of the diameter and cross-sectional area of the internal jugular veins in adult patients" ppsx
... Medical Systems, Milwaukee, WI, USA) during the study period The primary goal of this study was to validate the hypothesis that the diameter of the right IJV is greater than the left one, and secondary ... angiography analysis method have been previously evaluated both for diameter and area, and were 0.89 and 0.90, and 0.90 and 0.91, respectively [7] The IJV...
Ngày tải lên: 13/08/2014, 20:21
Seawater Purification Experiment and Consideration about Photoreactivation of Coliforms in the Inside of Seawater
... to the profile of fecal coliforms, the number of fecal coliforms clearly increased after the rain due to the influence of CSO The influence of CSO occurred predominantly after the rain rather ... (44% of total days) outside against the 67days (64% of the total days) inside the purification zone The ranked days were 20 point higher inside rather than ou...
Ngày tải lên: 05/09/2013, 09:08
Tài liệu Fertility, Family Planning, and Women’s Health: New Data From the 1995 National Survey of Family Growth pptx
... 20402-9328 Vital and Health Statistics Fertility, Family Planning, and Women’s Health: New Data From the 1995 National Survey of Family Growth Series 23: Data From the National Survey of Family Growth ... Cataloging-in-Publication Data Fertility, family planning, and women’s health : new data from the 1995 national sur...
Ngày tải lên: 12/02/2014, 23:20
Tài liệu Environmental impacts of petroleum production: Fate of inorganic and organic chemicals in produced water from the Osage-Skiatook Petroleum Environmental Research sites, Osage County, Oklahoma doc
... "Environmental impacts of petroleum production: The fate of petroleum and other organics associated with produced water from the Osage- Skiatook petroleum environmental research site, Osage county, ... ‘A’ and ‘B’ sites, respectively The impacts include salt scarring, soil salinization and oil contamination, and brine and petroleum conta...
Ngày tải lên: 14/02/2014, 03:20
Adolescent Sexual and Reproductive Health in Malawi: Results from the 2004 National Survey of Adolescents pdf
... all from ORC Macro, for input into all facets of the survey design and coordinating the pretest, sample selection, training, fielding, and data editing and cleaning; colleagues from the National ... implementing the survey and for their roles in the design of survey instruments and/ or data collection and processing; and Susheela Singh, Akinrinola Bank...
Ngày tải lên: 05/03/2014, 16:20