Báo cáo khoa học: Cross-species divergence of the major recognition pathways of ubiquitylated substrates for ubiquitin⁄26S proteasome-mediated proteolysis potx

Cross-species divergence of the major recognition pathways of ubiquitylated substrates for ubiquitin⁄26S proteasome-mediated proteolysis Antony S Fatimababy1, Ya-Ling Lin1,2,3, Raju Usharani1, Ramalingam Radjacommare1, Hsing-Ting Wang1, Hwang-Long Tsai1, Yenfen Lee1 and Hongyong Fu1,2,3 Institute of Plant and Microbial Biology, Academia Sinica, Taipei, Taiwan Molecular and Biological Agricultural Sciences Program, Taiwan International Graduate Program, National Chung-Hsing University and Academia Sinica, Taipei, Taiwan Graduate Institute of Biotechnology and Department of Life Sciences, National Chung-Hsing University, Taichung, Taiwan Keywords RPN10; RPN13; ubiquitin receptor; ubiquitin recognition; UBL–UBA factors Correspondence H Fu, Institute of Plant and Microbial Biology, Academia Sinica, 128, Sec 2, Academia Road, Nankang, Taipei 115, Taiwan Fax/Tel: +886 2787 1183 E-mail: hongyong@gate.sinica.edu.tw (Received 23 October 2009, revised 24 November 2009, accepted December 2009) doi:10.1111/j.1742-4658.2009.07531.x The recognition of ubiquitylated substrates is an essential element of ubiquitin ⁄ 26S proteasome-mediated proteolysis (UPP), which is mediated directly by the proteasome subunit RPN10 and ⁄ or RPN13, or indirectly by ubiquitin receptors containing ubiquitin-like and ubiquitin-associated domains By pull-down and mutagenesis assays, we detected cross-species divergence of the major recognition pathways RPN10 plays a major role in direct recognition in Arabidopsis and yeast based on the strong affinity for the long and K48-linked ubiquitin chains In contrast, both the RPN10 and RPN13 homologs play major roles in humans For indirect recognition, the RAD23 and DSK2 homologs (except for the human DSK2 homolog) are major receptors The human RAD23 homolog is targeted to the 26S proteasome by the RPN10 and RPN13 homologs In comparison, Arabidopsis uses UIM1 and UIM3 of RPN10 to bind DSK2 and RAD23, respectively Yeast uses UIM in RPN10 and LRR in RPN1 Overall, multiple proteasome subunits are responsible for the direct and ⁄ or indirect recognition of ubiquitylated substrates in yeast and humans In contrast, a single proteasome subunit, RPN10, is critical for both the direct and indirect recognition pathways in Arabidopsis In agreement with these results, the accumulation of ubiquitylated substrates and severe pleiotropic phenotypes of vegetative and reproductive growth are associated with the loss of RPN10 function in an Arabidopsis T-DNA insertion mutant This implies that the targeting and proteolysis of the critical regulators involved are affected These results support a cross-species mechanistic and functional divergence of the major recognition pathways for ubiquitylated substrates of UPP Structured digital abstract l A list of the large number of protein-protein interactions described in this article is available via the MINT article ID MINT-7307429 Abbreviations GST, glutathione S-transferase; LRR, leucine-rich repeat; PRU, Pleckstrin-like receptor of ubiquitin; RP, regulatory particle; UBA, ubiquitinassociated domain; UBL, ubiquitin-like domain; UIM, ubiquitin-interacting motif; UPP, ubiquitin ⁄ 26S proteasome-mediated proteolysis; Y2H, yeast two-hybrid analysis 796 FEBS Journal 277 (2010) 796–816 ª 2010 The Authors Journal compilation ª 2010 FEBS A S Fatimababy et al Cross-species divergence of ubiquitin receptors Introduction Ubiquitin ⁄ 26S proteasome-mediated proteolysis (UPP) controls the half-life of numerous critical regulatory proteins and is an intimate regulatory component of many cellular processes, including cell division, transcription, DNA repair and signal transduction [1] The proteasomal recognition of ubiquitylated substrates is an important mechanistic and regulatory component of UPP that connects the substrate of the conjugation machinery to the 26S proteasome Although the predominant step(s) in controlling substrate specificity are regulated by post-translational modification or conformational changes in the substrates and by the association between the substrates and their conjugation enzymes [2,3], accumulating evidence indicates that an additional layer of substrate selectivity can be mediated by various ubiquitin receptors during the proteasomal recognition of ubiquitylated substrates [4,5] However, limited information is available on how this substrate specificity is determined by the ubiquitin receptors The predominant targeting signal for 26S proteasome-mediated proteolysis appears to be the K48-linked ubiquitin chain, which has a minimum length of four ubiquitin units [6] The hydrophobic patch comprised of L8, I44 and V70 in ubiquitin is the primary contact surface for ubiquitin receptors that mediate proteasomal degradation [7] Like other types of linkage, the exact structural elements in the K48-linked chain that determine the selectivity by various ubiquitin receptors remain largely undefined However, they are probably associated with the L8–I44–V70 hydrophobic surface Although the K48-linked ubiquitin chain is the predominant signal for the recognition of ubiquitylated substrates in UPP, structural variants probably exist because there are abundant receptors in different species Furthermore, ubiquitin chains that are linked at other positions, such as K11, K29 and K63, are competent signals for proteasomal degradation [8–10] Three major classes of ubiquitin receptors for UPP that appear to be conserved among different species have been described The first class includes intrinsic 26S proteasome base subunits, such as RPN10 [11], RPN13 [12,13] and RPT5 [14], which directly recognize ubiquitylated substrates The second class includes shuttle factors that contain ubiquitin-like (UBL) and ubiquitin-associated (UBA) domains, such as RAD23, DSK2 and DDI1, which require an additional proteasomal docking step to target the ubiquitylated substrates to the 26S proteasome The UBL–UBA factors contain one UBL and one or two UBAs in the N- and C-termini that are capable of binding the 26S protea- some and ubiquitylated substrates, respectively [4,15– 17] It appears that multiple docking sites for various UBL–UBA factors are located on the base subcomplex of the regulatory particle, including RPN1 and the ubiquitin receptors, RPN10 and RPN13 [12,18] The third class includes CDC48-based complexes, which are involved primarily in endoplasmic reticulum-associated degradation [19,20] Distinct ubiquitin-binding motifs ⁄ domains are used by the various ubiquitin receptors [13,21,22] The ubiquitin-interacting motif (UIM), the Pleckstrin-like receptor of ubiquitin (PRU) and UBA are utilized by RPN10, RPN13 and UBL–UBA factors, respectively Multiple ubiquitin-binding sites are associated with different subunits of the CDC48 complexes, including the NPL4-zinc finger [23] and UBA [24] in NPL4 and p47, respectively, and the CDC48 ⁄ p97 N-domain fold in CDC48 and UFD1 [25] To resolve the mechanistic details of the distinct proteasomal recognition pathways for the ubiquitylated substrates of UPP, the structural determinants for several critical interfaces need to be resolved These include interactions between various ubiquitin receptors and ubiquitin chains of various linkage types, proteasomal recognition of the UBL–UBA factors, interactions among the major ubiquitin receptors, and interactions between ubiquitin receptors and their associated regulators or specific substrates Moreover, little is known regarding the biochemical properties of the major ubiquitin receptors from different species, in terms of their selectivity for linkage types and the lengths of the ubiquitin chains and their associated structural elements An extensive survey of UBA-containing factors including several mammalian and yeast UBL–UBA factors revealed significant differences with regard to the selectivity of the linkage type However, these results were primarily acquired using isolated domains ⁄ motifs and could be substantially different if examined in the context of the full-length proteins [26] Furthermore, the potential cross-species divergence of proteasomal docking and the associated structural determinants for the UBL–UBA factors have not yet been thoroughly examined Using a cross-species comparison approach, we observed distinct ubiquitin chain binding properties and associated structural elements for the major Arabdopsis, human and yeast ubiquitin receptors Moreover, we also identified distinct proteasomal docking sites and divergent interfaces for the RAD23 and DSK2 homologs Interestingly, whereas multiple proteasome subunits are involved in the direct and ⁄ or FEBS Journal 277 (2010) 796–816 ª 2010 The Authors Journal compilation ª 2010 FEBS 797 Cross-species divergence of ubiquitin receptors A S Fatimababy et al indirect proteasomal recognition of ubiquitylated substrates in yeast and humans, a single proteasome subunit (RPN10) is most critical in Arabdopsis In agreement with these results, the accumulation of ubiquitylated substrates and severe pleiotropic phenotypes were observed in an Arabdopsis RPN10 knockout mutant This implies that targeting and proteolysis of the relevant critical regulators are affected Our results support a cross-species mechanistic and functional divergence of the major recognition pathways for the ubiquitylated substrates of UPP dominant targeting signal for UPP [6], the K63-linked ubiquitin chain is the predominant signal for DNA repair, endocytosis and signal transduction [27–29] The major ubiquitin receptors were expressed and purified as glutathione S-transferase (GST)-tagged wildtype or mutated variants (Table S1) The preferences of various ubiquitin receptors for particular chain types and lengths were examined using GST pull-down analysis, in which the profiles of the pulled-down and input chains were compared by immunoblotting Whereas Arabdopsis and yeast RPN10 had significantly stronger affinities for long and K48-linked ubiquitin chains rather than the K63-linked chains, the human RPN10 homolog (S5a) showed strong affinities for long ubiquitin chains of both linkage types (Table and Fig S1) The distinct chain-type preferences of RPN10 from different species were confirmed by competitively pulling-down mixtures of tetra-ubiquitin chains containing an equal amount of both linkage types, which could be distinguished by their distinct electrophoretic mobilities (data not shown) A similar, strong affinity for either the K48- or K63-linked tetra-ubiquitin chain was also reported previously for S5a [26] The novel base subunit RPN13 was found to be a new proteasomal ubiquitin receptor [12,13] Distinct ubiquitin chain binding properties were observed for the Arabdopsis, human and yeast RPN13 homologs As shown in Table and Fig S2A, Arabdopsis RPN13 Results Divergence of the ubiquitin binding properties of the major ubiquitin receptors To examine potential differences in the substrate selectivity and structural divergence of the major ubiquitin receptors of UPP across species, we determined their ubiquitin chain binding properties and associated structural elements ⁄ residues We first compared binding properties among Arabdopsis, human and yeast homologs of the major ubiquitin receptors RPN10, RPN13, RAD23, DSK2 and DDI1, with either K48- or K63linked ubiquitin chains consisting of two to seven ubiquitin units (Table 1) Whereas a K48-linked ubiquitin chain of more than four ubiquitin units is the pre- Table Ubiquitin chain binding properties and associated structural domains of the major ubiquitin receptors from Arabidopsis, humans and yeast DN, data not shown; NA, not applicable; ND, a potential novel domain is involved; PRU, Pleckstrin-like receptor of ubiquitin; TS, this study; UBA, ubiquitin-associated domain; UIM, ubiquitin-interacting motif Arabidopsis Human b Ubiquitin binding K63 Domainc Yeast b Ubiquitin bindingb Ubiquitin binding Moded Ref D TS [20,31] +++ + +++ + TS [30] +++ +++ UIM1 + UIM2 PRU d TS +++ +++ PRU UBA1 I (N10) TS +++ + UBA1 & UBA2 & UBA2 UBA I (N10) DN + ++ UBA + UBA Namea K48 RPN10 +++ + RPN13 RAD23 (hHR23) DSK2 (PLIC1) DDI1 + + +++ + + UIM1 Moded Ref K48 K63 Domainc D i? DN + + ND K48 K63 Domainc Moded Ref UIM D TS [30] TS [12] TS D TS, [12] I (N10,N13) TS, [20] ) ) +++ + NA UBA1 d? I (N1) i TS +++ ++ UBA I (N10) TS [20] i? TS + UBA* i? + TS [20] a The names in parentheses are those for the human homologs b The approximate binding affinity for either the K48- or K63-linked ubiquitin chains is designated qualitatively by +++, ++, + and ) for strong, moderate and weak binding, and the absence of binding, respectively c For those situations in which multiple domains are involved in the binding, & indicates that the involved domains contribute additively to the binding, and + indicates that both domains act cooperatively Human UIM2 is more critical to the binding and is underlined UBA of yeast DDI1 (marked with an asterisk) was determined by mutagenesis to have diverged residues at the interaction interface d D ⁄ d and I ⁄ i indicate a direct or indirect role, respectively, in the recognition of ubiquitylated substrates The upper/bold and lower cases indicate a major and a minor role, respectively, based on the binding affinity for the K48-linked ubiquitin chains N1, N10 and ⁄ or N13 (for RPN1, -10 and -13, respectively) in bold and parentheses are the docking subunits for either the RAD23 or DSK2 homologs from different species A ? is added for yeast RPN13 and all DDI1 homologs as chain binding activity was not detected using yeast RPN13 and the docking site for DDI1 was not identified Therefore, their roles in the recognition of ubiquitylated substrates are not clear 798 FEBS Journal 277 (2010) 796–816 ª 2010 The Authors Journal compilation ª 2010 FEBS A S Fatimababy et al exhibited a weak affinity for K48-linked chains of three and four ubiquitin units and for K63-linked chains of various lengths By contrast, human RPN13 had a strong and approximately equivalent affinity for both K48- and K63-linked chains, revealing that the binding is similar to that of human S5a (RPN10) It appears that human RPN13 prefers chains of more than three and four ubiquitin units for the K48- and K63-linked chains, respectively (compare the input and eluted chain profiles in Fig S2A) Moreover, yeast RPN13 did not interact with either K48- or K63-linked chains A significant amount of high molecular mass ubiquitylated proteins from crude Arabdopsis extracts can be pulled-down readily by GST-fused Arabdopsis or human RPN13 (Fig S2B, left), indicating a role for ubiquitylated substrate recognition In agreement with the stronger ubiquitin chain binding activity, a relatively higher level of ubiquitylated proteins was associated with human RPN13 By contrast, no ubiquitylated proteins can be precipitated using yeast RPN13 As shown in Table and Fig S3, distinct ubiquitin chain binding properties were also detected with the Arabdopsis, human and yeast UBL–UBA ubiquitin receptors examined, except with the RAD23 homologs Similar to Arabdopsis RPN10 (Fig S1), RAD23 homologs from Arabdopsis, humans (hHR23b) and yeast had significantly stronger affinities for longer K48linked chains than for K63-linked chains (Fig S3A,B) However, the human DSK2 homolog (PLIC-1) had moderate affinity but a clear preference for K63-linked chains (Fig S3A) This contrasts to the preference for longer, K48-linked ubiquitin chains displayed by the Arabdopsis DSK2 homologs (Table and data not shown) Furthermore, yeast DSK2 showed strong and nearly equivalent affinities for the K48- and K63linked ubiquitin chains (Fig S3B) A similar preference for either K48- or K63-linked tetra-ubiquitin chains was observed previously for the isolated UBA of yeast DSK2 [26] This was confirmed by comparing the pulldown of tetra-ubiquitin chains of either linkage type (data not shown) In the case of DDI1 homologs, we observed weak affinities for both K48- and K63-linked chains when using the human and yeast homologs (Table and Fig S3A,B) These results are similar to those obtained with Arabdopsis DDI1 (Table and data not shown) The divergent structural requirements of the major ubiquitin receptors for ubiquitin chain binding To examine the cross-species divergence of the structural requirements for the recognition of ubiquitylated Cross-species divergence of ubiquitin receptors substrates, we determined the involved structural elements ⁄ residues of the major ubiquitin receptors (Table 1) RPN10 homologs from Arabdopsis, humans and yeast contain three, two and one UIMs, respectively, of which Arabdopsis uses the first UIM (UIM1) for binding ubiquitin chains [30,31] (Table 1, and data not shown) Involvement of the UIMs of the human and yeast RPN10 homologs in binding to K48- and K63-linked ubiquitin chains was determined using single or double UIM mutations Five critical hydrophobic residues within UIM1 (216–220; LALAL) and ⁄ or UIM2 (287–291; IAYAM) of the human RPN10 homolog (S5a) and UIM of yeast RPN10 (228–232; LAMAL) were replaced by asparagines Mutation of UIM abolished the binding activity of yeast RPN10 to the ubiquitin chains of both linkage types (Fig S1B, GST–Scrpn10–uim), indicating that UIM plays a critical role in ubiquitin chain binding Mutation of UIM2 of the human RPN10 homolog S5a abolished binding to the K48- and K63-linked chains almost completely, whereas mutation of UIM1 reduced binding to both chain types significantly (Fig S1A, GST–S5a–uim2 and GST–S5a–uim1) Double-site mutation abrogated the binding activity completely (GST–S5a–uim1_2), indicating that the two UIM sites of S5a are the primary structural motifs for ubiquitin chain binding The association of a stronger binding defect with the UIM2 mutation suggests a more critical role for UIM2 It is apparent that the amount of precipitation of the K48- and K63-linked ubiquitin chains associated with wild-type S5a cannot simply be attributed to an additive effect of the two single UIM-containing variants (Fig S1A), and this observation supports a cooperative binding mode for the two UIMs of the human RPN10 homolog (S5a) The residues of human RPN13 that are critically involved in ubiquitin binding have been identified by molecular docking, based primarily on the crystal structure of mammalian RPN13, and these residues are located within a novel ubiquitin-binding domain PRU [13] In general, the corresponding residues are conserved in Arabdopsis RPN13, but they diverge significantly in yeast RPN13 (Fig S4) These findings are in agreement with the observation that yeast RPN13 is unable to bind both ubiquitin chains and conjugates Several critical residues of mammalian RPN13, including L56, F76, D79 and F98, have been shown to be essential for ubiquitin binding using mutagenesis and in vitro pull-down assays [13] Binding to both the K48- and K63-linked ubiquitin chains was affected drastically when the corresponding residues of Arabdopsis and human RPN13 were mutated individually to A, R, Q (or N) and R, respectively (Figs S4–S5), FEBS Journal 277 (2010) 796–816 ª 2010 The Authors Journal compilation ª 2010 FEBS 799 Cross-species divergence of ubiquitin receptors A S Fatimababy et al indicating that the same interfaces in Arabdopsis and human RPN13 appear to be critical for ubiquitin chain binding (Table 1) RAD23 homologs from Arabdopsis, humans or yeast contain two UBA domains (UBA1 and -2), in which each of the UBAs of Arabdopsis RAD23 contributes additively to the binding of K48-linked ubiquitin chains (Table and data not shown) The roles of the UBAs in ubiquitin chain binding of human and yeast RAD23 homologs were determined using single- or double UBA mutations (Table and Fig S6A,B) Three conserved residues implicated in ubiquitin binding within each UBA were replaced with alanines; these residues were 200–202 (MGY) and 376–378 (LGF) in the human homolog hHR23b and 158–160 (MGY) and 367–369 (LGF) in yeast RAD23 As shown in Fig S6A, mutation of UBA1 or UBA2 of human hHR23b reduced the binding activity of K48or K63-linked ubiquitin chains significantly, indicating that both UBAs are critical for the binding of ubiquitin chains of both linkage types It appears that the amount of K48-linked ubiquitin chain pulled-down by the wild-type protein is approximately the additive contribution of the two single UBA site-containing mutants Mutation of both sites completely abrogated the chain binding activity (uba1_2) of both linkage types, indicating that the two UBA sites of human hHR23b are the primary structural motifs responsible for ubiquitin chain binding For yeast RAD23, the mutation of UBA1, but not of UBA2, abrogated the binding activity to ubiquitin chains of either linkage type almost completely, indicating that UBA1 plays a major role in binding of the ubiquitin chain (Fig S6B) Mutation of both sites also abrogated the binding activity for both linkage types completely (Fig S6B, uba1_2) The human DSK2 homolog (PLIC1) and yeast DSK2 and DDI1 each contain a single UBA; the role of these UBAs in ubiquitin chain binding was determined (Table and Fig S6C) No sequence similar to the UBA was identified in human DDI1, suggesting that a potentially novel structural motif is involved in ubiquitin binding Two conserved residues believed to mediate the interaction with ubiquitin within the various UBAs were replaced by alanines; these are 557–558 (MG) of the human DSK2 homolog (PLIC1), 342–343 (MG) of yeast DSK2 and 401– 402 (LG) of yeast DDI1 Mutation of the UBA of human and yeast DSK2 homologs abolished binding to ubiquitin chains of both linkage types, as did the equivalent UBA mutants of the Arabdopsis DSK2 homologs (Table and Fig S6C) The UBA mutation of yeast DDI1 also abolished binding to K63-linked 800 ubiquitin chains However, although it was significantly reduced, we clearly detected binding of the UBA-mutated yeast DDI1 to K48-linked ubiquitin chains This contrasts with the complete abrogation of binding associated with a similar UBA mutation of Arabdopsis DDI (Table and data not shown) This indicates a possible variation in the chainbinding interface in yeast DDI1 Structural divergence of proteasomal recognition of the RAD23 and DSK2 homologs by RPN10 With respect to the indirect recognition of ubiquitylated substrates by UBL–UBA factors, it is not known whether the same proteasomal docking sites are used in a given species and whether the docking sites and associated interfaces are conserved across species Arabdopsis uses RPN10, but not RPN1 and RPT5, to receive RAD23 and DSK2 through separate sites (UIM3 and UIM1, respectively) (see below and Table 2) We determined the potential role and associated domains ⁄ residues of the human and yeast RPN10 homologs in the recognition of UBL–UBA factors using pull-down assays (Table and Figs 1–2) Human and yeast RPN10 homologs were expressed and purified as T7-tagged wild-type or mutated variants; the UBL–UBA factors, including the RAD23, DSK2 and DDI1 homologs, were expressed and purified as GST-tagged wild-type or mutated variants (Table S1) As shown in Fig 1A, the human RPN10 homolog (S5a) was pulled-down readily by the GST-fused RAD23 (hHR23b) or DSK2 (PLIC1) homolog, but not by DDI1 By contrast, yeast RPN10 was pulleddown by GST-fused DSK2, but not RAD23 and DDI1 (Fig 1B) These results indicate that, as for Arabdopsis RPN10, the human RPN10 homolog (S5a) can function as a potential docking subunit for both the RAD23 and DSK2 homologs However, yeast RPN10 can serve as a docking subunit for DSK2 but not for RAD23 (Table 2) The involvement of the UIM in the human and yeast RPN10 homologs in recognition of the RAD23 and ⁄ or DSK2 homologs was determined (Table 2) using single and double UIM mutations similar to those used in the chain-binding analyses Compared with wild-type human S5a, recovery of the UIM1 or UIM2 mutant by GST-fused hHR23b or PLIC1 was significantly reduced or completely abolished, respectively (Fig 1A, uim1 and uim2) This indicates that UIM1 and, in particular, UIM2 of S5a play a critical role in the recognition of hHR23b and PLIC1 The amount of wild-type S5a precipitated using GST-fused FEBS Journal 277 (2010) 796–816 ª 2010 The Authors Journal compilation ª 2010 FEBS TS TS UBL UBL (V87) UIM1 PRU Names in parentheses are those for the corresponding human homologs b Potential docking subunits that are underlined and in bold are those that are involved in the association with the RAD23 or DSK2 homologs for the major indirect recognition pathways c For docking subunits that involve multiple motifs ⁄ domains, & indicates that the involved motifs contribute independently to the interaction, and + indicates that both motifs act cooperatively Motifs that are underlined and in bold are more critical for the interaction S5a in parentheses is the designated name for the human RPN10 homolog d IF, the interface regions on the UBL–UBA factors that are involved in binding with the docking subunit The abbreviated amino acids that are indicated in parentheses are those that are potentially divergent residues, as determined using mutagenesis a TS [18] TS UBL (L44,I45,L70,V71) UBL UBL (L44,L70,V71) ND UBL UBL RPN10 RPN13 DSK2 (PLIC1) ND UIM1 + UIM2 PRU TS TS TS RPN10 RPN1 RPN13 UIM LRR PRU TS [18] UBL LRR UBL (I47) TS, UP UBL UIM2 & UIM3 IF on UBL–UBAd Sitec RPN10 (S5a) RPN13 RPN10 RPN13 RPN10 RAD23 (hHR23b) UIM1 + UIM2 TS RPN1 IF on UBL–UBAd Docking subunitb IF on UBL–UBAd Docking subunitb Docking subunitb Namea Ref Human Sitec Ref Yeast Sitec Ref Cross-species divergence of ubiquitin receptors Arabidopsis Table Distinct proteasomal docking site(s) of the RAD23 and DSK2 homologs from Arabidopsis, humans and yeast LRR, leucine-rich repeat; ND, a potential novel domain is involved; PRU, Pleckstrin-like receptor of ubiquitin; TS, this study; UBA, ubiquitin-associated domain; UBL, ubiquitin-like domain; UIM, ubiquitin-interacting motif; UP, YL, Lin and H Fu, unpublished results A S Fatimababy et al A B Fig Interaction analyses of the human and yeast RAD23, DSK2 and DDI1 homologs with the proteasome subunit RPN10 (A) Association of human hHR23b and PLIC1, but not DDI1, with the proteasome subunit S5a Wild-type and UIM variants of human S5a were pulled-down using GST-fused hHR23b, PLIC-1 or DDI1 (B) The association of yeast DSK2, but not RAD23 or DDI1, with RPN10 Wild-type and UIM variants of yeast RPN10 were pulleddown using GST-fused RAD23, DSK2 or DDI1 The pulled-down products derived from GST alone were analyzed as a negative control One-fiftieth of the input prey (Inp) and the pulled-down products were immunoblotted against an anti-T7 IgG (a-T7) Onetwentieth of the various prey (Prey 2.5·) and one-fifth of a set of eluted products (Baits 10·) were examined by staining with Brilliant Blue R to confirm equivalent prey input and bait immobilization, respectively hHR23b or PLIC1 did not reflect additive contributions from the two single UIM mutants This indicates possible cooperation between UIM1 and UIM2 in S5a in the interaction with hHR23b and PLIC1 (Fig 1A), in a way that is similar to their roles in ubiquitin chain binding (Fig S1A) As expected, recovery of the double UIM mutant by either GST-fused hHR23b or PLIC1 was also abrogated completely (uim1_2) For yeast RPN10, the UIM mutation abolished its recovery by GST-fused DSK2 This indicates that it is critical for DSK2 recognition, in addition to its role in ubiquitin chain binding (Fig 1B, uim) Because the UIMs of RPN10 homologs are involved in recognition of the RAD23 and ⁄ or DSK2 homologs, it is rational to suggest that the potential hydrophobic patches in the UBLs of the RAD23 and DSK2 homologs, which are equivalent to the hydrophobic patch containing L8, I44 and V70 in ubiquitin, are involved in the association with the RPN10 homologs In general, residues that correspond to L8, I44 and V70 of ubiquitin in the UBLs of the RAD23 and DSK2 homologs from Arabdopsis, humans and yeast are conserved However, we observed a clear divergence in the corresponding residues in the UBLs of the yeast RAD23 and DDI1 homologs (Fig S7), supporting their inability to associate with the RPN10 homolog We examined the role and poten- FEBS Journal 277 (2010) 796–816 ª 2010 The Authors Journal compilation ª 2010 FEBS 801 Cross-species divergence of ubiquitin receptors A S Fatimababy et al A B Fig The UBLs of human and yeast RAD23 and ⁄ or DSK2 homologs are critical for association with the proteasomal subunit RPN10 The association with the RPN10 homolog from humans (S5a) or yeast (ScRPN10) was analyzed by pull-down using various GST-fused UBL variants of human hHR23b, PLIC1 (A) or yeast DSK2 (B) One-hundredth of the input RPN10 homolog (Inp) from humans or yeast and the pulled-down products were analyzed by immunoblotting against a-T7 One-tenth of the pulled-down products (Baits 10·) was examined by staining with Brilliant Blue R to confirm that the baits had been immobilized equally The pulleddown products that were derived from GST alone were analyzed as a negative control The asterisks indicate degradation products of the GST-fused yeast DSK2 variants WT, wild-type tial divergence of hydrophobic patches in the UBLs of the RAD23 and ⁄ or DSK2 homologs from Arabdopsis, humans and yeast in binding to RPN10 Two conserved residues that were equivalent to L8, I44 or V70 of ubiquitin in the UBLs of the RAD23 and DSK2 homologs from Arabdopsis and humans were replaced separately by alanine (Fig S7) Replacement of the residue corresponding to L8 or I44 of ubiquitin in Arabdopsis RAD23 and I44 or V70 of ubiquitin in Arabdopsis DSK2 abrogated the RPN10 interaction (Table and data not shown) Whereas similar replacements in the human RAD23 homolog (hHR23b; L8A) and the DSK2 homolog (PLIC1; I79A and V105A) abrogated the interaction with the human RPN10 homolog (S5a), replacement of the residue corresponding to I44 of ubiquitin in human hHR23b (I47A) did not (Fig 2A) In yeast DSK2, replacement of the residue that corresponds to I44 or V70 of ubiquitin (I45 and V71, respectively) or their adjacent residue (L44 or L70, respectively) did not affect the association with RPN10 (Fig 2B) Only the double-alanine mutation at positions 44–45 (LI) or 70–71 (LV) and a UBL deletion mutant (UBLD; residues 1–73 deleted) of yeast DSK2 abolished the association with RPN10 (Fig 2B) These results indicate that the UBLs of the human RAD23 and DSK2 802 homologs and yeast DSK2 play a role in the association with the RPN10 homolog Furthermore, we detected a clear structural divergence in the UBL interfaces of human hHR23B and yeast DSK2, compared with the corresponding homologs in Arabdopsis (Table 2) We further examined the overall structural conservation of the interfaces between RPN10 and RAD23 or DSK2 homologs using cross-species interaction analyses Wild-type and single or double UIM variants of the RPN10 homolog from one species were tested using GST pull-down assays to assess their ability to interact with the RAD23 (Fig 3A–C) or DSK2 homologs (Fig 3D–F) from different species As shown in Fig 3A, the single-site mutation of UIM3 (uim3), but not of UIM1 or -2 (uim1 or uim2), abolished the association of RPN10 with the RAD23 homolog from humans or Arabdopsis Furthermore, the double UIM mutant (uim1_2) containing an intact UIM3 motif associated with the Arabdopsis and human RAD23 homologs, but the double UIM mutants (uim2_3 and uim1_3) containing intact UIM1 or UIM2 motifs, respectively, did not Similarly, as shown in Fig 3B, human S5a was capable of interacting in a cooperative manner with the RAD23 homolog from humans or Arabdopsis through UIM2 and, to a lesser extent, UIM1 Interestingly, whereas the Arabdopsis and human RAD23 homologs were capable of interacting with yeast RPN10 through UIM (Fig 3C), yeast RAD23 did not bind to yeast RPN10 or to the Arabdopsis and human RPN10 homologs (Fig 3A–C, upper) These results indicate that the interfaces of the RPN10–RAD23 interaction are conserved in Arabdopsis and humans, and that UIM3 of Arabdopsis RPN10 and both UIM sites of human S5a play critical roles However, whereas the UIM motif of yeast RPN10 is conserved through evolution for association with the RAD23 homologs from Arabdopsis and humans, the UBL of yeast RAD23 has diverged Using single and double UIM mutations, we found that RPN10s from Arabdopsis and yeast were capable of interacting with DSK2 homologs from other species through UIM1 and UIM, respectively, as seen with DSK2 from their own species (Fig 3D,F) For the human RPN10 homolog (S5a), both UIM1 and UIM2 facilitated association with the Arabdopsis and yeast DSK2 homolog (Fig 3E) Whereas UIM2 played a more critical role in the interaction with the DSK2 homolog of both humans and Arabdopsis, UIM1 played a more critical role in the interaction with yeast DSK2 (Fig 3E) The latter probably evolved to cope with the divergent UBL interface detected in yeast DSK2 (Fig 2B) FEBS Journal 277 (2010) 796–816 ª 2010 The Authors Journal compilation ª 2010 FEBS A S Fatimababy et al Cross-species divergence of ubiquitin receptors A B Fig Cross-species interaction analyses between the homologs of RPN10 and RAD23 or DSK2 Wild-type and single or double UIM mutants of the Arabdopsis (A,D), human (B,E), or yeast (C,F) RPN10 homologs were analyzed separately by pulldown using various GST-fused Arabdopsis, human and yeast RAD23 (A–C) or DSK2 (D–F) homologs The various UIM mutations for Arabdopsis RPN10 are located at residues 226–230 for uim1 (LALAL fi DDDDD), 286–290 for uim2 (LLDQA fi NNDND) and 310–314 for uim3 (LALAL fi NNNDN) One-fiftieth of the prey (Input) and pulled-down products were analyzed by immunoblotting against a-T7 One-fifth of a set of eluted products (Baits 10·) was examined by staining with Brilliant Blue R to confirm that the baits had been immobilized equally D E C F Structural divergence of the RPN13-mediated proteasomal recognition of the RAD23 and DSK2 homologs As reported recently, the base subunit RPN13 is also capable of binding to UBL–UBA factors [13] We determined the roles and associated interfaces of Arabdopsis, human and yeast RPN13 homologs in the recognition of UBL–UBA factors (Table 2) Arabdopsis, human and yeast RPN13 and RPN10 (for comparison) homologs were purified as T7-tagged proteins (Fig 4A), and the UBL–UBA factors, including the FEBS Journal 277 (2010) 796–816 ª 2010 The Authors Journal compilation ª 2010 FEBS 803 Cross-species divergence of ubiquitin receptors A S Fatimababy et al A B C D Fig Interaction analyses of the RAD23, DSK2 and DDI1 homologs from Arabdopsis, humans and yeast with the proteasome subunit RPN13 (A) The input prey of the T7-tagged RPN13 and RPN10 homologs One-fifth of the input Arabdopsis, human and yeast RPN10 and RPN13 homologs (1 lg each) were visualized by staining with Brilliant Blue R Purified recombinant yeast RPN13 was mobilized as a doublet, which is probably derived from different translational initiation sites (B–D) The RPN10 and RPN13 homologs from Arabdopsis (B), humans (C) or yeast (D) were analyzed separately by pull-down using GST-fused RAD23, DSK2 or DDI1 homolog(s) from the respective species The Arabdopsis RAD23 homologs examined include RAD23b–d One-hundredth of the input RPN10 or RPN13 homologs (Input) and the pulled-down products were analyzed by immunoblotting against a-T7 One-tenth of the eluted products (Baits 10·) was examined by staining with Brilliant Blue R to confirm that the baits had been immobilized equally The pulled-down products that were derived from GST alone were analyzed as a negative control, and the RPN10 pull-down analyses were analyzed for comparison RAD23, DSK2 and DDI1 homologs, were purified as GST-tagged proteins As shown in Fig 4B,D, Arabdopsis (AtRPN13) and yeast (ScRPN13) RPN13 homologs were recovered using GST-fused DSK2, but not RAD23 and DDI1, homologs from their respective species However, recovery occurred at a significantly lower level compared with the RPN10 homolog pulled-down using GST-fused Arabdopsis RAD23 homologs or DSK2a (Fig 4B), or using GST-fused yeast DSK2 (Fig 4D) Human RPN13 was recovered using GST-fused human hHR23b or PLIC1, but not DDI1, at a level slightly lower than that of S5a recovered using the respective GST-fusion (Fig 4C) The data indicate that Arabdopsis or yeast RPN13, which has a minor role compared with RPN10, is capable of functioning as a recognition subunit for DSK2, and that human RPN13 is capable of serving as the recognition subunit for both hHR23b and PLIC1 It is logical to propose that the interfaces ⁄ residues in the PRU domains of Arabdopsis and human RPN13 responsible for ubiquitin chain binding (Fig S5) are also involved in recognition of the UBL–UBA factors 804 The same single-residue mutants of RPN13 from Arabdopsis or humans as constructed for the ubiquitinbinding experiments were used to determine their role in the recognition of RAD23 and ⁄ or DSK2 homologs A few residues, including E72 and F91 (corresponding to D79 and F98 in mammalian RPN13), are also conserved in the potential PRU domain in yeast RPN13 (Fig S4) Therefore, we mutated E72 and F91 to Q72 and R91, respectively, and tested their role in the recognition of yeast DSK2 In addition, we mutated L43 in yeast RPN13 at a position one residue away from F45 (corresponding to L56 of mammalian RPN13) to alanine, and tested this mutant also All the tested residues appear to be critical for the interaction between the RPN13 and DSK2 homologs from Arabdopsis, yeast and humans When compared with wild-type proteins from Arabdopsis (Fig 5A), yeast (Fig 5B) and humans (Fig 5C), the levels of the RPN13 variants recovered using the GST-fused DSK2 homologs from the respective species were reduced drastically However, apart from a slight reduction in the recovery of human RPN13 variant A56 using GST-fused FEBS Journal 277 (2010) 796–816 ª 2010 The Authors Journal compilation ª 2010 FEBS A S Fatimababy et al Cross-species divergence of ubiquitin receptors A Fig Cross-species interaction analyses between the RPN13 variants and the DSK2 or RAD23 homologs The Arabdopsis (A), yeast (B) or human (C) RPN13 variants were analyzed by pull-down using GST-fused Arabdopsis, human or yeast DSK2 homologs Human RPN13 variants were also analyzed using GST-fused Arabdopsis (RAD23b–d), human or yeast RAD23 homologs (D) The RPN13 variants that were examined include the wild-type and singleresidue mutants L47A, F67R, E70Q and F88R for Arabdopsis (A); L43A, E72Q and F91R for yeast (B); and L56A, F76R, D79N and F98R for humans (C,D) The mutagenized residues correspond to L56, F76, D79 or F98 in the PRU domain of mammalian RPN13 [13] (Fig S4) One-hundredth of the input RPN13 variants (Input) and one-hundredth (1·) or one-tenth (10·) of the pulled-down products were analyzed by immunoblotting against a-T7 One-tenth of the eluted products (Baits 10·) was examined by staining with Brilliant Blue R to confirm that the baits had been immobilized equally The pulled-down products that were derived from GST alone were analyzed as a negative control The asterisks in (C) indicate an unspecific pull-down product B D C hHR23b, human RPN13 variants were recovered at a level equivalent to wild-type RPN13 (Fig 5D, Human) These observations indicate that Arabdopsis, human and yeast DSK2 homologs might be recognized by RPN13 homologs from the respective species using the conserved interfaces in the PRU domains [12,13], which are also critical for ubiquitin binding Interestingly, the interface of the PRU of human RPN13, which is critical for the interaction with ubiquitin and PLIC1, is not required to bind hHR23b Because the conserved residues of the PRU domain of Arabdopsis, human and yeast RPN13 homologs have roles in the interaction with the DSK2 homolog from the respective species, we decided to test the hydrophobic patches within the UBLs of the DSK2 homologs for their involvement in the interaction with RPN13 The potential involvement of the hydrophobic patch in the UBL of hHR23b was also examined The UBL variants constructed for analysis of the association of RPN10 with human hHR23b and the DSK2 homologs from Arabdopsis, humans and yeast were examined for their association with RPN13 Whereas the recovery of human RPN13 was abrogated when the GST-fused I79A or V105A PLIC1 variant was used (Fig 6B), recovery of Arabdopsis RPN13 was abrogated using the GST-fused Arabdopsis I61A DSK2a variant, but not the V87A variant (Fig 6A) All the residues tested in yeast DSK2 affected RPN13 recognition However, I45 and L44 appear to be more critical for the interaction with RPN13 than V71 and L70 (Fig 6C) Recovery of yeast RPN13 was abolished when the GST-fused I45A or L44A DSK2 single FEBS Journal 277 (2010) 796–816 ª 2010 The Authors Journal compilation ª 2010 FEBS 805 Cross-species divergence of ubiquitin receptors A S Fatimababy et al A B C Fig The role of the hydrophobic patches in the UBLs of the DSK2 homologs and human hHR23b in association with RPN13 The Arabdopsis (AtRPN13), human (HsRPN13) or yeast (ScRPN13) RPN13 were analyzed by pull-down using various GST-fused UBL variants of Arabdopsis DSK2 (A), human hHR23b or PLIC1 (B) or yeast DSK2 (C) The UBL variants of human hHR23b and PLIC1, and yeast DSK2, are the same as those used for association with the RPN10 homologs (Fig 2) For the UBL variants of Arabdopsis DSK2, two of the conserved residues, which were equivalent to I44 and V70 of ubiquitin, were individually mutagenized to alanine (I61A and V87A) One-hundredth of the input Arabdopsis, human or yeast RPN13 homologs (Input) and the pulled-down products were analyzed by immunoblotting against a-T7 One-tenth of the pulleddown products (Baits 10·) was examined by staining with Brilliant Blue R to confirm that the baits had been immobilized equally The pulled-down products that were derived from GST alone were analyzed as a negative control mutant, or the LI–AA (44–45) double mutant, was used The recovery of yeast RPN13 was reduced significantly when using GST-fused V71A, L70A or LV–AA (70–71) DSK2 mutants As expected, the recovery of yeast RPN13 was abolished using the GST-fused DSK2 UBL deletion mutant (Fig 6C, UBLD) These results indicate clearly that structural divergence exists at the interfaces of the UBLs of Arabdopsis, human and yeast DSK2 homologs for RPN13 association Human RPN13 was recovered at a similar level using the GST-fused hHR23b or hHR23b variants (Fig 6B; L8A and I47A), indicating that the hydrophobic patch in the UBL of hHR23b is nonessential for RPN13 association This corroborates the aforementioned observation that the ubiquitin-binding 806 interface in the human RPN13 PRU is not critical for association with hHR23b (Fig 5D), and that novel interfaces are probably involved We examined the overall structural conservation of the interfaces between the RPN13 and DSK2 homologs further using cross-species interaction analyses Arabdopsis RPN13 was recovered at a reduced efficiency using the GST-fused human and yeast DSK2 homologs when compared with the level that was recovered using GST-fused Arabdopsis DSK2a (Fig 5A) Mutation of critical residues in the Arabdopsis RPN13 PRU disrupted this interaction (Fig 5A) Human RPN13 was recovered at a similar level using GST-fused human or yeast DSK2 homologs (Fig 5C) The mutation of critical residues in the PRU of human RPN13 also disrupted the interaction (Fig 5C) Yeast RPN13 was recovered only when using GST-fused yeast DSK2, and not when using GST-fused Arabdopsis or human DSK2 homologs (Fig 5B) Our results suggest that the overall structure of the RPN13–DSK2 interface is conserved across species However, the lack of cross-species interaction between yeast RPN13 and either the human or Arabdopsis DSK2 homologs is in agreement with the observation of a greater divergence at critical positions on the PRU interface for yeast RPN13 (Fig S4) Interestingly, human RPN13 and its single-mutation variants were recovered using GST-fused Arabdopsis or yeast RAD23 homologs at a level similar to the recovery level observed when using GST-fused hHR23b (Fig 5D) This suggests that the interface of hHR23b responsible for its interaction with human RPN13 is conserved in the Arabdopsis and yeast RAD23 homologs It also suggests that the interfaces of the Arabdopsis and yeast RPN13s, which correspond to the interface of human RPN13 that mediates the interaction with the RAD23 homologs, are divergent or have been deleted In agreement with this suggestion, neither the Arabdopsis nor yeast RPN13 homolog was recovered when using GST-fused hHR23b (data not shown) Yeast RAD23 is recognized by the base subunit RPN1 As reported previously, RPN1 is the primary docking subunit for RAD23 in yeast [18] Yeast DSK2 also competes slightly for the interaction between RAD23 and the 26S proteasome, indicating that DSK2 can also be recognized by RPN1 [18] However, a direct interaction between Arabdopsis RPN1 and UBL–UBA factors, including the RAD23 and DSK2 homologs and DDI1, was not detected (data not shown) To confirm the pos- FEBS Journal 277 (2010) 796–816 ª 2010 The Authors Journal compilation ª 2010 FEBS A S Fatimababy et al Cross-species divergence of ubiquitin receptors sible role of yeast RPN1 and RPN10 in the recognition of RAD23 and DSK2, respectively, and to explore whether other potential proteasome subunits are important for the recognition of RAD23, DSK2 and DDI1, we searched for direct binding partners from the subunits of the regulatory particle (RP) of the 26S proteasome using yeast two-hybrid (Y2H) analyses As shown in Fig S8A, yeast RAD23, DSK2 and 17 RP subunits, including RPT1–6, RPN1–3 and RPN5–12, were analyzed as C-terminal GAL4-BD fusions and as Cand N-terminal GAL4–AD fusions DDI1 was tested as N- and C-terminal GAL4–AD fusions After analyzing all possible BD ⁄ AD fusion combinations between the RP subunits and UBL–UBA factors (Fig S8A), we detected interactions between DSK2 and RPN10, and between RAD23 and RPN1 (Fig S8D) An interaction between RAD23 and RPT6 was also detected However, the interactions between RAD23 and RPN1 and RAD23 and RPT6 were weak, and only one of the two Y2H reporters (HIS3) was activated These results support the observation that the recognition of RAD23 is mediated by RPN1 in yeast [18] In addition, the stronger Y2H interaction also suggests that the recognition of DSK2 could potentially be mediated by RPN10 RPN10 is critical for both vegetative and reproductive growth in Arabdopsis Based on in vitro interaction analyses, Arabdopsis RPN10 appears to play a critical role in both the A B C D Fig RPN10 is essential for Arabdopsis growth and development A T-DNA insertion knockout Arabdopsis mutant, rpn10-2, was characterized (A) The T-DNA insertion site in the fourth intron of RPN10 (At4g38630) for rpn10-2 is indicated schematically (large triangle, not to scale) Exons and introns are indicated using boxes and lines, respectively The positions of the primers that were used to detect the T-DNA insert, the endogenous RPN10 gene and the transcript are indicated The primers that were used include GABI-LB4, RPN10-5¢b (5¢b), RPN10-3¢B (3¢B), cRPN10–Sma (cN10-Sma) and cRPN10–Sst (cN10-Sst) (see Experimental procedures) (B) Transgene genotyping and transcript expression of the rpn10-2 and complementation lines (Left) The presence of endogenous RPN10 (eN10), T-DNA insertion (tDNA) and the complemented RPN10 (cN10) coding region were examined by PCR using genomic DNA that was isolated from Col-0, rpn10-2 and rpn10-2 expressing the RPN10 coding region driven by the CaMV 35S promoter (two lines, line-1 and -2), respectively (Right) RT-PCR shows that the RPN10 transcripts were not detected in rpn10-2 (C) The expression of RPN10 was knocked-out and ubiquitylated proteins accumulated in rpn10-2 The expression of RPN10 and the accumulation of ubiquitylated proteins and free di-ubiquitin (diUB) were examined by immunoblotting against Arabdopsis RPN10 (aRPN10) or human ubiquitin antibodies (aUB) in crude protein extracts that were prepared from Col-0 (Col), rpn10-2 and two complementation lines The expression of CSN5 was examined using the Arabdopsis CSN5 antibody (aCSN5) to confirm equal loading (D) The growth of Col-0, rpn10-2 and two complementation lines was followed at different stages (21, 50 and 80 days after germination) FEBS Journal 277 (2010) 796–816 ª 2010 The Authors Journal compilation ª 2010 FEBS 807 Cross-species divergence of ubiquitin receptors A S Fatimababy et al direct and indirect recognition of ubiquitylated substrates of UPP In agreement with this idea, rpn10-1, a reported T-DNA insertion mutant, has been shown to have pleiotropic phenotypes including a reduction in germination, growth rate, stamen number, genetic transmission through the male gametes, hormoneinduced cell division and seed set, as well as increased sensitivity to abscisic acid [32] A slight accumulation of ubiquitylated substrates and a specific and drastic stabilization of ABI5 were observed with rpn10-1, indicating a defect in substrate targeting [32] The RPN10 protein in rpn10-1 was expressed as a NPT-II fusion, in which a C-terminal fragment containing UIMs was truncated This fusion protein was expressed at a very low level compared with that of RPN10 in wild-type However, the chimeric RPN10 was assembled into the 26S proteasome in rpn10-1 at near wild-type levels [32] We predicted that more severe phenotypes would be associated with a complete loss of RPN10 function A new T-DNA insertion mutant line of RPN10 in a Col-0 background was obtained, and is designated here as rpn10-2 In this line, the T-DNA insertion was located in the fourth intron (Fig 7A) A homozygous T-DNA insertion line was obtained by segregating T2 plants (Fig 7B, left); neither the wildtype RPN10 transcript (Fig 7B, right) nor its protein (Fig 7C, upper) was detected, indicating that rpn10-2 is a null mutant As expected, rpn10-2 showed more severe pleiotropic phenotypes than rpn10-1 Phenotypes included: reduced growth rate; larger, thicker, lanceolar, serrated rosette and cauline leaves; delayed flowering time; reduced axillary inflorescences; longer internodes; increased length of pedicels; increased accumulation of anthocyanin; abnormal flower organ number; larger flower organs; larger petal cells; prolonged life cycle; delayed leaf senescence; increased plant height; defective male and female gametophytes; and infertility (Fig 7D and data not shown) We also detected the accumulation of ubiquitylated substrates and free di-ubiquitin (Fig 7C, middle) Except for the gametophyte phenotypes, all the phenotypes (including conjugate accumulation) can be complemented when a wild-type RPN10 coding region that is driven by the CaMV 35S promoter was reintroduced into rpn10-2 (Fig 7C,D and data not shown) Part of the reason for the lack of complementation of the gametophyte phenotypes is probably because of an absence of 35S promoter expression in the anthers [33] The detailed phenotypes of the rpn10-2 plants and the complementation analyses are described in a separate study (Y.L Lin and H Fu, unpublished results) 808 Discussion Using a cross-species comparison approach, we observed distinct ubiquitin chain binding properties and associated structural requirements among the major Arabdopsis, human and yeast ubiquitin receptors (Table and Fig 8) Moreover, we also observed distinct proteasomal docking sites and interfaces for homologs of the major UBL–UBA factors (Table and Fig 8) in different species Our results support the mechanistic divergence across species of the major recognition pathways for ubiquitylated substrates of UPP Interestingly, Arabdopsis RPN10 plays a major role in both the direct and indirect recognition of ubiquitylated substrates, and this is in agreement with the accumulation of ubiquitylated conjugates in T-DNA-inserted Arabdopsis RPN10 mutant lines and the associated pleiotropic phenotypes for both vegetative and reproductive growth reported here and previously [32] Arabdopsis RPN10 plays a major role in both the direct and indirect recognition of ubiquitylated substrates of UPP As determined by the strong affinity for long K48linked ubiquitin chains, which is the primary signal for targeting to the 26S proteasome [6], humans use RPN10 (S5a) and RPN13 as major receptors for the direct recognition of ubiquitylated substrates, whereas both yeast and Arabdopsis use RPN10 as the major receptor (Fig 8) Weak or absent binding affinity for either K48- or K63-linked ubiquitin chains suggests that RPN13 in Arabdopsis and yeast is likely to play a minor role in direct substrate recognition Although it is possible that the recombinant Arabdopsis or yeast RPN13 was not folded properly, their interaction with the DSK2 homologs through PRU makes this less likely (Fig 5A,B) Alternatively, the conformation and chain-binding properties of RPN13 in Arabdopsis and yeast may be altered when they are assembled into the 26S proteasome, or the RPN13 homologs may be regulated by association with additional regulatory factor(s) Other subunits of the 26S proteasome RP are not likely to participate as major receptors in direct substrate recognition, because an extensive yeast twohybrid analysis (Y2H) between yeast ubiquitin and RP subunits did not detect any novel interaction Furthermore, Arabdopsis RPT5 and RPN1 did not bind to ubiquitin chains (data not shown) although these subunits have been suggested as candidates for substrate recognition because ubiquitin- or UBL-binding activity was observed in other species [14,18] FEBS Journal 277 (2010) 796–816 ª 2010 The Authors Journal compilation ª 2010 FEBS A S Fatimababy et al Cross-species divergence of ubiquitin receptors A B C Fig The major recognition pathways for the ubiquitylated substrates of UPP are divergent across species Schematic diagrams show the direct and indirect recognition pathways of ubiquitylated substrates in humans (A), yeast (B) and Arabdopsis (C) For the direct recognition of ubiquitylated substrates (CONJUGATES), humans use RPN10 (N10 ⁄ S5a) and RPN13 (N13) as the major receptors, whereas yeast and Arabdopsis use RPN10 (N10) as the major receptor (indicated by the wide, red double-arrowhead lines) Arabdopsis RPN13 (N13) plays a minor role (the thin, red double-arrowhead line) Whereas a single UIM motif of Arabdopsis (UIM1 ⁄ U1) or yeast RPN10 (UIM ⁄ U) is required for substrate recognition, UIM1 (U1) and UIM2 (U2) of human S5a act cooperatively (bracketed) Of the two, UIM2 is more critical for substrate binding (colored in red and yellow for UIM2 and UIM1, respectively) For the human and Arabdopsis RPN13 homologs, the PRU domains are required Except for the human DSK2 homolog (DSK) (indicated by the thin, black double-arrowhead lines), both the RAD23 (RAD) and DSK2 homologs could serve as major receptors for indirect recognition (as indicated by the wide, black double-arrowhead lines) (A) The docking of the human RAD23 and DSK2 homologs is mediated by both RPN10 (S5a) and RPN13 Docking by RPN10 (S5a) is mediated by UIM1 (U1) and UIM2 (U2) in a mode that is similar to substrate binding By contrast, the docking of the human RAD23 and DSK2 homologs by RPN13 is mediated by a novel domain that has not yet been defined (DN) and by PRU, respectively Although both UBLs (the red subregions) of the RAD23 and DSK2 homologs are involved in binding RPN10 (S5a), the UBL of the DSK2 homolog and a novel unidentified domain (the green-colored subregion, DN) of the RAD23 homolog are involved in RPN13 binding The role of human RPN1 (N1) in the recognition of UBL–UBA factors has not been determined (marked ? in the figure) (B) Docking of the yeast RAD23 and DSK2 homologs is mediated primarily by RPN1 and RPN10, respectively RPN1 and RPN13 also play a minor role in DSK2 docking (the thin, black double-arrowhead lines) The interaction of RPN1 and RAD23 or DSK2 is mediated by LRR in RPN1 and by the UBLs in RAD23 ⁄ DSK2; residues that are critically involved in the UBLs of RAD23 ⁄ DSK2 have not been determined (marked by asterisks in the figure) The interaction between DSK2 and RPN10 ⁄ RPN13 is mediated by the UBL in DSK2, and by UIM and PRU, respectively, in RPN10 and RPN13 (C) Docking of the Arabdopsis RAD23 and DSK2 homologs is mediated primarily by UIM3 and UIM1, respectively, in the same base subunit, RPN10 UIM2 (shown in yellow) also plays a minor role in binding submembers of the RAD23 family (data not shown; the thin, black double-arrowhead lines) Via PRU, Arabdopsis RPN13 also plays a minor role in docking DSK2 (the thin, black double-arrowhead lines) Arabdopsis RPN1 (depicted in gray) is not involved in the recognition and is marked with an X For the involvement of the UBLs in proteasomal docking, the conserved residues (corresponding to those located in the hydrophobic patch of ubiquitin) are generally critical However, divergent interfaces have been detected The residues with altered importance are designated with the corresponding binding proteasome subunit indicated in parentheses Based on the strong affinity for long K48-linked ubiquitin chains, the RAD23 and DSK2 homologs may be used as major receptors for indirect recognition in the species examined (Fig 8) The exception is the human DSK2 homolog, which probably plays a minor role because of its weak affinity for K48-linked ubiquitin chains Other UBL–UBA factors such as DDI1 and NUB1 also probably play a minor role, or FEBS Journal 277 (2010) 796–816 ª 2010 The Authors Journal compilation ª 2010 FEBS 809 Cross-species divergence of ubiquitin receptors A S Fatimababy et al they act beyond UPP because they have weak or absent affinity for K48-linked ubiquitin chains (Fig S3 and data not shown) Based on the strength of the interaction, multiple RP base subunits play a major role in proteasomal docking of the RAD23 and DSK2 homologs in yeast (RPN1 and RPN10) and humans (RPN10 and RPN13), whereas a single base subunit RPN10 plays a major role in Arabdopsis (Fig 8) In yeast, RPN1 plays a major role in the recognition of RAD23 and probably also plays a minor role in the recognition of DSK2, as described previously [18] and confirmed using Y2H (Fig S8) Based on the observation that the Y2H reporter activity derived from the RPN10–DSK2 interaction is stronger than that from the RPN1–RAD23 interaction, and also on observation of the strong interaction detected by the pull-down assay, RPN10 probably plays a major role in DSK2 recognition (Figs 1B and S8) With its relatively weak binding compared with RPN10, yeast RPN13 probably plays a minor role in DSK2 recognition (Fig 4D) In humans, both RPN10 and RPN13 play a major role in the recognition of RAD23 and DSK2 homologs (Figs 1A and 4C) The role of human RPN1 in the recognition of UBL–UBA factors has not been examined Uniquely for Arabdopsis, the proteasomal docking of the RAD23 and DSK2 homologs is mediated primarily by RPN10 through separate sites (Fig 3) However, a minor role in DSK2 recognition is mediated by RPN13 (Fig 4B) Except during docking by the human RPN10 homolog (S5a), the proteasomal recognition sites of the RAD23 and DSK2 homologs are separated structurally Here, recognition of the DSK2 homolog overlaps structurally with the recognition of ubiquitylated substrates (Fig 8) For example, all the PRU domains of the RPN13 homologs are involved in the recognition of the ubiquitin chains and DSK2, except for yeast RPN13 UIM1 of Arabdopsis RPN10 and the UIM of yeast RPN10 are also involved By contrast, RAD23 recognition is mediated by a separate motif(s) ⁄ domain(s) that includes UIM3 and, to a lesser extent, UIM2 of Arabdopsis RPN10 (Fig and data not shown), LRR of yeast RPN1 [18] and a novel domain in human RPN13 (Figs 5D and 6B) However, recognition of the RAD23 and DSK2 homologs by human S5a is mediated by the two UIMs using a very similar mode to the recognition of ubiquitin chains (Fig 1A) The structural separation or overlap between the ubiquitin-binding and proteasomal recognition sites of different UBL–UBA factors is probably a critical element in the mechanistic relay or for regulation during proteasomal recognition of ubiquitylated substrates 810 Pleiotropic phenotypes of loss of function support a major role for Arabdopsis RPN10 in the direct and indirect recognition of ubiquitylated substrates The multiplicity of major recognition pathways of ubiquitylated substrates was mediated in yeast and humans through separate proteasomal subunits A nonessential role was observed for the major yeast ubiquitin receptors RPN10, RAD23 and DSK2 [11,16], suggesting their functional redundancy However, it can be predicted that simultaneous loss of the ubiquitin chain-binding activity of RPN10 and the proteasomal docking activity of RPN1 (Fig 8) would have severe consequences in yeast By contrast, the major recognition pathways (both direct and indirect) in Arabdopsis are all mediated by RPN10, suggesting an essential role in growth and development In agreement with this idea, Arabdopsis RPN10 was shown to be essential for both vegetative and reproductive growth, as reported previously [32] and here through the examination of a new T-DNA inserted null mutant Interestingly, critical roles of the RPN10 homolog in vivo were also observed in several other species, including Drosophila [34], mouse [35], Physcomitrella patens [36] and Caenorhabditis elegans [37] The observed pleiotropic phenotypes associated with rpn10-1 [32] and rpn10-2 (Fig 7D and data not shown) support defective proteolysis of the critical regulatory factors involved Accordingly, accumulation of ubiquitylated substrates and free di-ubiquitin was clearly observed; the latter is probably derived from active deubiquitylation activities that exist in vivo However, RPN10 is a protein that has multiple activities The N-terminal vWA domain is critical for the stable association between the lid and base subcomplexes of RP [38], UIM1 is critical for both the direct and indirect (through DSK2) recognition of ubiquitylated substrates, and UIM3 is important for indirect (through RAD23) recognition of ubiquitylated substrates The null-mutation of rpn10-2 will allow analyses to correlate the observed phenotypes with separate RPN10 activities by complementation with site-mutagenized RPN10 mutants It can also be tested whether the direct and indirect recognition that are mediated by UIM1 and the indirect recognition that is mediated by UIM3 are redundant Functional roles of major ubiquitin receptors beyond UPP Human S5a ⁄ RPN10, RPN13 and yeast DSK2 have strong affinities, not only for K48-, but also for FEBS Journal 277 (2010) 796–816 ª 2010 The Authors Journal compilation ª 2010 FEBS A S Fatimababy et al K63-linked ubiquitin chains This suggests that additional ubiquitin recognition functions beyond UPP may be associated with these ubiquitin receptors However, ubiquitin chains of other linkage types, such as K11, K29 and K63, may still serve as competent signals for proteasomal degradation [8,9] The affinity of the major ubiquitin receptors for in vivo physiological substrates, which probably have highly extended ubiquitin chains at multiple sites, could be modulated through the interaction with associated factors or after assembly into the 26S proteasome Further differentiation of the biochemical properties of the major ubiquitin receptors may yet be discovered when more extended ubiquitin chains or physiological substrates are analyzed DDI1 homologs from various species have weak affinities for either K48- or K63-linked ubiquitin chains Weak ubiquitin chain binding is reflected by the low affinity for endogenous ubiquitylated substrates observed with Arabdopsis DDI1 (data not shown) In addition, the potential proteasomal docking site for DDI1 has not been detected in Arabdopsis, humans or yeast (Figs 1, and S8, and data not shown) These results not favor a role for DDI1 homologs as major receptors for ubiquitylated substrates during UPP However, the involvement of yeast DDI1 in the recognition of specific substrates, such as Ho endonuclease and the F-box protein of the E3 complex SCFUfo1, has been described [5,17] The human DSK2 homolog (PLIC1) has a clear preference and moderate affinity for K63-linked ubiquitin chains (Fig S3), indicating that PLIC1 plays a minor, if any, role in the recognition of ubiquitylated substrates during UPP The possible involvement of PLIC1 in the sequestration of UIM-containing endocytic components has been described previously [39] Structural divergence supports mechanistic differentiation of the major recognition pathways across species Although conserved domains ⁄ motifs are used by various ubiquitin receptors for substrate binding and proteasomal docking, a clear structural divergence of the major recognition pathways across species exists (Tables and and Fig 8) First, distinct substratebinding properties are associated with major ubiquitin receptors from different species, indicating structural differentiation For example, whereas the human RPN10 homolog binds to both the K48- and K63linked ubiquitin chains with high affinities using the two UIM sites in a cooperative manner, Arabdopsis and yeast homologs preferentially bind to K48-linked Cross-species divergence of ubiquitin receptors ubiquitin chains using a single UIM site (Fig S1) Distinct substrate-binding properties are also associated with the RPN13 and DSK2 homologs from different species (Figs S2A and S3) Second, structural divergence for ubiquitin chain binding was detected with major ubiquitin receptors For example, the human and Arabdopsis RAD23 homologs bind ubiquitin chains using both UBAs additively, whereas yeast RAD23 binds chains using a single UBA1 (Table and Fig S6A,B, and data not shown) Because the UBA was not detected in human DDI1, it is likely that a novel ubiquitin-binding domain is involved Also, divergence of the interface of the UBA in yeast DDI1 was detected by mutagenesis (Fig S6C, left) Moreover, divergence of the PRU interface was detected in yeast RPN13, and this observation agrees with the lack of affinity for ubiquitin chains and conjugates (Fig S4) Third, structural divergence was detected in the interaction interfaces between the proteasomal docking subunits and the UBL–UBA factors in different species Although overall structural conservation was detected for the interfaces of RPN10–RAD23, RPN10–DSK2 and RPN13–DSK2 (when examined using cross-species interaction analyses; Figs and 5), nevertheless, divergent interfaces were detected (Fig 8) The most obvious example of a divergent interface is the UBL of yeast RAD23 (Fig S7) This divergence leads to a loss of binding to RPN10 (Fig 3A–C, upper) However, yeast RPN10 retains the ability to bind the UBLs of the RAD23 homologs from Arabdopsis and humans (Fig 3C) Uniquely, yeast RPN1 acquired the LRR for binding with the UBL of RAD23, which appears to be divergent in Arabdopsis Functional divergence of the conserved residues in the UBL interfaces of human RAD23 (I47; Fig 2A) and yeast DSK2 (L44, I45, L70 and V70; Fig 2B) for association with the RPN10 homolog were detected Cross-species interaction analysis between human S5a and the yeast DSK2 homolog also supports a divergent UBL in yeast DSK2 Although both UIM1 and UIM2 of human RPN10 ⁄ S5a are important for the interaction with yeast DSK2, UIM1 is more critical This is different from the interaction of S5a with the human or Arabdopsis DSK2 homolog, in which UIM2 is more critical (Fig 3E) We also detected divergence in the UBL interfaces of Arabdopsis DSK2 (V87, Fig 6A) and yeast DSK2 (L44, L70 and V71; Fig 6C) in their association with RPN13 The novel interfaces between the human RPN13 and RAD23 homologs appear to be partly divergent in other species RAD23 homologs from Arabdopsis and yeast are still capable of interacting with human FEBS Journal 277 (2010) 796–816 ª 2010 The Authors Journal compilation ª 2010 FEBS 811 Cross-species divergence of ubiquitin receptors A S Fatimababy et al RPN13 (Fig 5D), indicating that their interaction interfaces (which not involve UBLs, Figs 5D and 6B) are still conserved when compared with the human RAD23 homolog By contrast, RPN13 homologs from Arabdopsis and yeast did not interact with the human RAD23 homolog, indicating that their binding interfaces had diverged (data not shown) Mechanistic differentiation across species, supported by divergent structural requirements, may potentially lead to distinct functions for the different recognition pathways, as exemplified here by Arabdopsis RPN10, and different in vivo regulation (such as the association with distinct regulators) Because the specificity of UPP can be modulated at the ubiquitylated substrate recognition step [4,5,17], additional structural elements or associated factors probably play roles in determining substrate specificity Taking these suggestions together, it is likely that more subtle mechanistic components are involved in the proteasomal recognition of ubiquitylated substrates, and these may have diverged in the major recognition pathways across species Further structural analyses and comparisons are required to resolve the divergence detected in this study to provide a solid basis for mechanistic insight In vivo studies, including loss- and gain-of-function analyses and structure ⁄ function correlations, are required to determine the functional roles associated with the various recognition pathways Alternatively, identification of specific substrates using proteomic approaches may also contribute functional insights into the various recognition pathways Experimental procedures Characterization of the Arabdopsis T-DNA insertion line rpn10-2 The GABI-Kat T-DNA insertion line GK-734B02 (in the Col-0 background) designated here as rpn10-2 was ordered from the European Arabdopsis Stock Center (University of Nottingham, Loughborough, UK) The T-DNA insertion site was determined by sequencing a PCR fragment amplified from the junction using the primer pair GABI-LB2 and RPN10-3¢a To complement the rpn10-2 phenotypes, the Arabdopsis RPN10 coding region was amplified from firststrand cDNAs using the primer pair cRPN10–Sma and cRPN10–Sst (these added SmaI and SstI restriction sites, respectively) and cloned into pBI121, downstream of the CaMV 35S promoter [40] This construct was mobilized into Agrobacterium GV3101 using a freeze–thaw method Arabdopsis was transformed as described previously [41] To grow Col-0, rpn10-2 or complemented rpn10-2 Arabdopsis, we surface sterilized the seeds using 20% bleach and 812 0.05% Tween 20 and stratified them for days on plates at °C in the dark The seeds were germinated on halfstrength MS solid medium (0.8% agar, pH 5.8) supplemented with 1% sucrose Two-week-old seedlings were transferred to soil (equal parts of humus, vermiculite and perlite) and grown using a 16 h light ⁄ h dark photoperiod with a light intensity of  120 lmolỈm)2Ỉs)1 at 22 °C For genotyping, a single rosette leaf was mashed in 600 lL of extraction buffer using a SH-48 homogenizer (J&H Technology, Taipei, Taiwan) and the genomic DNA was extracted as described [42] For RT-PCR, total RNA was isolated from 30-day-old rosette leaves using TRIzol according to manufacturer’s instructions (Invitrogen, Carlsbad, CA, USA) RNA was quantified using a NanoDrop ND-1000 (NanoDrop Technologies, Wilmington, DE, USA) Three micrograms of total RNA were used for firststrand cDNA synthesis in a 20 lL reaction using poly(T), random primers and SuperScript III reverse transcriptase (Invitrogen) Sterile water was added to achieve a final volume of 150 lL, and 2.5 lL was used as the template for each PCR The PCR primer pairs used to detect the endogenous RPN10, T-DNA insertion, RPN10 complementation construct, RPN10 coding region and a UBQ10 cDNA fragment were RPN10-5¢b ⁄ RPN10-3¢B, RPN10-3¢B ⁄ GABILB4, 35S-Fw-T ⁄ RPN10-3¢B, cRPN10-Sma ⁄ cRPN10-Sst and UBQ10-5¢ ⁄ UBQ10-3¢, respectively The sequences of the primers used are listed in 5¢ to 3¢ direction as follows: RPN10-3¢a, CACCCGTGAATCACGGTGTGCTGGA AG; RPN10-5¢b, GAGTTTGACATCAATTTGCTACTTG CGTC; RPN10-3¢B, CTGCGGCCGCTGCAGCAGCTG CCGCAG; GABI-LB2, GCTGATCCATGTAGATTTCCC CGGACATG; GABI-LB4, CACGGATGATCTCGCGGA GGGTAG; 35S-Fw-T, CTCGGATTCCATTGCCCAGCT ATCTG; cRPN10–Sma, TCCCCGGGATGGTTCTCGAG GCGACTATG; cRPN10–Sst, ATGAGCTCTCACTTCT TCTCATCCTCGCC; UBQ10-5¢, GTGGTGGTTTCTAAA TCTCGTCTCTG; UBQ10-3¢, GAAGAAGTTCGACTTG TCATTAGAAAG Preparation of crude protein extracts from Arabdopsis To prepare crude protein extracts for the detection of RPN10, CSN5 and the ubiquitylated conjugates by immunoblotting, we ground rosette leaves in liquid nitrogen using an equal volume of pull-down binding buffer (see below) supplemented with 1· protease inhibitor cocktail (Roche Diagnostics, Indianapolis, IN, USA) or vol of sample buffer (to detect the ubiquitylated conjugates) Samples were dissolved by vortexing, incubated on ice for min, centrifuged at 16 000 g and °C, and filtered using 0.45 lm filters (Millipore Corp., Bedford, MA, USA) For pulling-down endogenous Arabdopsis ubiquitin conjugates, we prepared the crude Arabdopsis extract from the upper FEBS Journal 277 (2010) 796–816 ª 2010 The Authors Journal compilation ª 2010 FEBS A S Fatimababy et al parts of 1-month-old plants using pull-down binding buffer supplemented with 1· protease inhibitor cocktail (Roche Diagnostics), 50 lm proteasome inhibitor MG132 (Biomol International, Plymouth Meeting, PA, USA) and 50 lm Nethylmaleimide (Sigma-Aldrich, St Louis, MO, USA) The protein concentration was determined using Protein Assay reagent (Bio-Rad Laboratories, Hercules, CA, USA) Protein expression constructs The coding sequences for wild-type, site-mutagenized and deletion variants of Arabdopsis, yeast and human ubiquitin receptors were generated by PCR and inserted into either pET42a or pET28a (Novagen, Madison, WI, USA) to yield constructs that encoded for GST ⁄ HIS- or T7 ⁄ HIS-tagged proteins, respectively (Table S1) Site-directed mutagenesis was performed using a QuickChange Kit with PfuTurbo and paired primers that were centered at the mutation sites according to the manufacturer’s protocols (Stratagene, La Jolla, CA, USA) Double-site mutants were generated by sequential mutagenesis The coding sequences for human S5a (U51007), hHR23b (D21090), PLIC1 (BC010066), DDI1 (NM032341) and RPN13 (NM175573) were amplified using PCR from first-strand cDNAs prepared from human HeLa S3 cells (Stratagene) The coding sequences for yeast RAD23, DSK2 and DDI1 were PCR-amplified or subcloned (DSK2) from Y2H constructs (see the Doc S1 and Table S1) The coding sequence for yeast RPN13 (U20939) was isolated from genomic DNA prepared from the DF5 strain [11] All expression constructs were confirmed by DNA sequencing using an ABI Prism 3700 DNA Analyzer (Applied Biosystems, Foster City, CA, USA) Recombinant protein purification from Escherichia coli The various recombinant proteins were expressed in BL21 (DE3) cells using the pET28a or pET42a expression plasmids (Novagen) Bacterial cultures were induced at D600 = 0.6 for protein expression with mm isopropyl thiob-d-galactoside and incubated at 16, 30 or 37 °C depending on the construct Escherichia coli cells were resuspended in 1· GST- or HIS-binding buffer (Novagen), supplemented with 200 lgỈmL)1 lysozyme, 0.1% NP-40, 10% glycerol and 1· protease inhibitor cocktail (Roche Diagnostics) Resuspended cells were incubated for 15 at room temperature and sonicated on ice for 5–10 (15% power, 30-s pulses with 30-s intermittent pauses; Misonix XL2020, Farmingdale, NY, USA) His- and GST-tagged recombinant proteins were purified by immobilized metal- or glutathioneaffinity chromatography, respectively (Novagen) using buffers and procedures recommended by the manufacturer Purified proteins were dialyzed and concentrated in GST pull-down binding buffer (see below) using Microcon Ultracel YM-30 filter units (Millipore Corp.) Cross-species divergence of ubiquitin receptors GST pull-down analyses and immunoblotting GST pull-down experiments were performed using immobilized glutathione according to the manufacturer’s instructions (Pierce, Rockford, IL, USA) Briefly, the glutathione resin (25 lL final bed volume for each reaction) was washed five times with 400 lL of binding buffer (50 mm Tris ⁄ HCl, pH 7.5, 25 °C, 100 mm NaCl, mm EDTA and 0.1% NP-40) GST-fused baits were then individually immobilized on the resin in 400 lL of binding buffer for h on ice (gently mixed by inverting) The immobilized baits were washed five times with 400 lL of binding buffer A specific prey was then added, and the resin complexes were incubated for h on ice, with gentle mixing by inverting After five washes with 400 lL of binding buffer, the pulled-down products were boiled for in sample buffer, analyzed by SDS ⁄ PAGE and detected by immunoblotting using chemiluminescence (Perkin–Elmer, Shelton, CT, USA) or color development The NaCl concentration in the binding buffer was increased to 150 mm when analyzing the interactions between the UBL–UBA factors and the RPN10 or RPN13 variants To detect the ubiquitin chains or conjugates, the proteins were transferred onto Hybond ECL nitrocellulose membranes (0.45 lm; Amersham Biosciences, Freiburg, Germany) following separation by SDS ⁄ PAGE The membrane was then sandwiched between two glass plates and autoclaved for 20 in transfer buffer to assist epitope exposure For other immunoblotting assays, poly(vinylidene difluoride) membranes were used (Perkin–Elmer, Boston, MA, USA) To visualize the pulleddown ubiquitin chains, conjugates and T7-tagged recombinant proteins, we used either rabbit anti-human ubiquitin (Santa Cruz Biotechnology, Santa Cruz, CA, USA) or mouse anti-T7 primary serum (Novagen) Horseradish peroxidase-conjugated goat anti-(rabbit IgG) serum or anti(mouse IgG) serum (Santa Cruz Biotechnology) were used as secondary antibodies To detect RPN10, CSN5 and the conjugates from the Arabdopsis crude extracts, we used primary rabbit polyclonal antibodies raised against Arabdopsis RPN10, CSN5 (custom-made by Genesis Biotech, Taipei, Taiwan or purchased from Biomol, respectively), or human ubiquitin (Santa Cruz Biotechnology) These were used in conjunction with an alkaline phosphatase-labeled goat anti-(rabbit IgG) serum (Santa Cruz Biotechnology) and the substrates Nitro blue tetrazolium and 5-bromo-4chloro-3-indolyl phosphate (Sigma-Aldrich) The K48- and K63-linked ubiquitin chains (Ub2–7) and tetra-ubiquitin were purchased from BostonBiochem (Cambridge, MA, USA) Sequence analyses The presence of UIM, UBA and other protein domains was detected using available web programs from the ExPASy proteomics server (Swiss Institute of Bioinformatics, FEBS Journal 277 (2010) 796–816 ª 2010 The Authors Journal compilation ª 2010 FEBS 813 Cross-species divergence of ubiquitin receptors A S Fatimababy et al http://www.expasy.ch/) Routine sequence analyses were performed using version 10.3 of the wisconsin gcg package (Accelrys, San Diego, CA, USA) Acknowledgements We thank Drs Michael H Glickman, Richard D Vierstra and Shu-Hsing Wu for critical reading of the manuscript, Dr Michael H Glickman for the Y2H bait constructs BD-UB and BD-UB5, and for the Y2H constructs of yeast RAD23, DSK2 and DDI1 We also thank Tzuning Ho and Ting-Ting Yu for technical assistance R Radjacommare is the recipient of a postdoctoral fellowship from Academia Sinica (2005– 2006) Y.L Lin is supported by a graduate fellowship from the Taiwan International Graduate Program (2003-2006; National Chung-Hsing University and Academia Sinica) This work was supported by grants from the National Science Council (NSC 88-2311B001-127, NSC 89-2311-B001-125, and NSC 89-2311B001-044, NSC 95-2311-B-001-045-MY3) and from Academia Sinica (AS-94-TP-B08 and AS-97-TP-B03), Taipei, Taiwan References Hershko A & Ciechanover A (1998) The ubiquitin system Annu Rev Biochem 67, 425–479 Petroski MD & Deshaies RJ (2005) Mechanism of lysine 48-linked ubiquitin-chain synthesis by the Cullin–RING ubiquitin–ligase complex SCF–Cdc34 Cell 123, 1107–1120 Ravid T & Hochstrasser M (2008) Diversity of degradation signals in the ubiquitin–proteasome system Nat Rev Mol Cell Biol 9, 679–690 Verma R, Oania R, Graumann J & Deshaies RJ (2004) Multiubiquitin chain receptors define a layer of substrate selectivity in the ubiquitin–proteasome system Cell 118, 99–110 Ivantsiv Y, Kaplun L, Tzirkin-Goldin R, Shabek N & Raveh D (2006) Unique role for the UbL–UbA protein Ddi1 in turnover of SCFUfo1 complexes Mol Cell Biol 26, 1579–1588 Thrower J, Hoffman L, Rechsteiner M & Pickart C (2000) Recognition of the polyubiquitin proteolytic signal EMBO J 19, 94–102 Beal R, Deveraux Q, Xia G, Rechsteiner M & Pickart C (1996) Surface hydrophobic residues of multiubiquitin chains essential for proteolytic targeting Proc Natl Acad Sci USA 93, 861–866 Jin L, Williamson A, Banerjee S, Philipp I & Rape M (2008) Mechanism of ubiquitin-chain formation by the human anaphase-promoting complex Cell 133, 653–665 814 Johnson ES, Ma PCM, Ota IM & Varshavsky A (1995) A proteolytic pathway that recognizes ubiquitin as a degradation signal J Biol Chem 270, 17442–17456 10 Hofmann RM & Pickart CM (2001) In vitro assembly and recognition of Lys-63 polyubiquitin chains J Biol Chem 276, 27936–27943 11 van Nocker S, Sadis S, Rubin D, Glickman M, Fu H, Coux O, Wefes I, Finley D & Vierstra R (1996) The multiubiquitin-chain-binding protein Mcb1 is a component of the 26S proteasome in Saccharomyces cerevisiae and plays a nonessential, substrate-specific role in protein turnover Mol Cell Biol 16, 6020–6028 12 Husnjak K, Elsasser S, Zhang N, Chen X, Randles L, Shi Y, Hofmann K, Walters KJ, Finley D & Dikic I (2008) Proteasome subunit Rpn13 is a novel ubiquitin receptor Nature 453, 481–488 13 Schreiner P, Chen X, Husnjak K, Randles L, Zhang N, Elsasser S, Finley D, Dikic I, Walters KJ & Groll M (2008) Ubiquitin docking at the proteasome through a novel pleckstrin–homology domain interaction Nature 453, 548–552 14 Lam YA, Lawson TG, Velayutham M, Zweier JL & Pickart CM (2002) A proteasomal ATPase subunit recognizes the polyubiquitin degradation signal Nature 416, 763–767 15 Saeki Y, Sone T, Toh-e A & Yokosawa H (2002) Identification of ubiquitin-like protein-binding subunits of the 26S proteasome Biochem Biophys Res Commun 296, 813–819 16 Funakoshi M, Sasaki T, Nishimoto T & Kobayashi H (2002) Budding yeast Dsk2p is a polyubiquitin-binding protein that can interact with the proteasome Proc Natl Acad Sci USA 99, 745–750 17 Kaplun L, Tzirkin R, Bakhrat A, Shabek N, Ivantsiv Y & Raveh D (2005) The DNA damage-inducible UbL–UbA protein Ddi1 participates in Mec1-mediated degradation of Ho endonuclease Mol Cell Biol 25, 5355–5362 18 Elsasser S, Gali RR, Schwickart M, Larsen CN, Leggett DS, Muller B, Feng MT, Tubing F, Dittmar GAG & Finley D (2002) Proteasome subunit Rpn1 binds ubiquitin-like protein domains Nat Cell Biol 4, 725–730 19 Elsasser S & Finley D (2005) Delivery of ubiquitinated substrates to protein-unfolding machines Nat Cell Biol 7, 742–749 20 Raasi S & Wolf DH (2007) Ubiquitin receptors and ERAD: a network of pathways to the proteasome Semin Cell Dev Biol 18, 780–791 21 Hicke L, Schubert HL & Hill CP (2005) Ubiquitinbinding domains Nat Rev Mol Cell Biol 6, 610–621 22 Hurley J, Lee S & Prag G (2006) Ubiquitin-binding domains Biochem J 399, 361–372 23 Wang B, Alam SL, Meyer HH, Payne M, Stemmler TL, Davis DR & Sundquist WI (2003) Structure and FEBS Journal 277 (2010) 796–816 ª 2010 The Authors Journal compilation ª 2010 FEBS A S Fatimababy et al 24 25 26 27 28 29 30 31 32 33 34 35 ubiquitin interactions of the conserved zinc finger domain of Npl4 J Biol Chem 278, 20225–20234 Yuan X, Simpson P, McKeown C, Kondo H, Uchiyama K, Wallis R, Dreveny I, Keetch C, Zhang X, Robinson C et al (2004) Structure, dynamics and interactions of p47, a major adaptor of the AAA ATPase, p97 EMBO J 23, 1463–1473 Park S, Isaacson R, Kim HT, Silver PA & Wagner G (2005) Ufd1 exhibits the AAA–ATPase fold with two distinct ubiquitin interaction sites Structure 13, 995– 1005 Raasi S, Varadan R, Fushman D & Pickart CM (2005) Diverse polyubiquitin interaction properties of ubiquitin-associated domains Nat Struct Mol Biol 12, 708–714 Hicke L & Dunn R (2003) Regulation of membrane protein transport by ubiquitin and ubiquitin-binding proteins Annu Rev Cell Dev Biol 19, 141–172 Kanayama A, Seth RB, Sun L, Ea C-K, Hong M, Shaito A, Chiu Y-H, Deng L & Chen ZJ (2004) TAB2 and TAB3 activate the NFjB pathway through binding to polyubiquitin chains Mol Cell 15, 535–548 Tsui C, Raguraj A & Pickart CM (2005) Ubiquitin binding site of the ubiquitin E2 variant (UEV) protein Mms2 is required for DNA damage tolerance in the yeast RAD6 pathway J Biol Chem 280, 19829–19835 Fu H, Sadis S, Rubin DM, Glickman M, van Nocker S, Finley D & Vierstra RD (1998) Multiubiquitin chain binding and protein degradation are mediated by distinct domains within the 26S proteasome subunit Mcb1 J Biol Chem 273, 1970–1981 Young P, Deveraux Q, Beal RE, Pickart CM & Rechsteiner M (1998) Characterization of two polyubiquitin binding sites in the 26S protease subunit 5a J Biol Chem 273, 5461–5467 Smalle J, Kurepa J, Yang P, Emborg TJ, Babiychuk E, Kushnir S & Vierstra RD (2003) The pleiotropic role of the 26S proteasome subunit RPN10 in Arabidopsis growth and development supports a substrate-specific function in abscisic acid signaling Plant Cell 15, 965–980 Wilkinson JE, Twell D & Lindsey K (1997) Activities of CaMV 35S and nos promoters in pollen: implications for field release of transgenic plants J Exp Bot 48, 265–275 Szlanka T, Haracska L, Kiss I, Deak P, Kurucz E, Ando I, Viragh E & Udvardy A (2003) Deletion of proteasomal subunit S5a ⁄ Rpn10 ⁄ p54 causes lethality, multiple mitotic defects and overexpression of proteasomal genes in Drosophila melanogaster J Cell Sci 116, 1023–1033 Hamazaki J, Sasaki K, Kawahara H, Hisanaga S-i, Tanaka K & Murata S (2007) Rpn10-mediated degradation of ubiquitinated proteins is essential for mouse development Mol Cell Biol 27, 6629–6638 Cross-species divergence of ubiquitin receptors 36 Girod P, Fu H, Zryd J & Vierstra R (1999) Multiubiquitin chain binding subunit MCB1 (RPN10) of the 26S proteasome is essential for developmental progression in Physcomitrella patens Plant Cell 11, 1457–1472 37 Shimada M, Kanematsu K, Tanaka K, Yokosawa H & Kawahara H (2006) Proteasomal ubiquitin receptor RPN-10 controls sex determination in Caenorhabditis elegans Mol Biol Cell 17, 5356–5371 38 Fu H, Reis N, Lee Y, Glickman M & Vierstra R (2001) Subunit interaction maps for the regulatory particle of the 26S proteasome and the COP9 signalosome EMBO J 20, 7096–7107 39 Regan-Klapisz E, Sorokina I, Voortman J, de Keizer P, Roovers RC, Verheesen P, Urbe S, Fallon L, Fon EA, Verkleij A et al (2005) Ubiquilin recruits Eps15 into ubiquitin-rich cytoplasmic aggregates via a UIM–UBL interaction J Cell Sci 118, 4437–4450 40 Jefferson R, Kavanagh T & Bevan M (1987) GUS fusions: beta-glucuronidase as a sensitive and versatile gene fusion marker in higher plants EMBO J 6, 3901–3907 41 Clough SJ & Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana Plant J 16, 735–743 42 Weigel D & Glazebrook J (2002) How to isolate a gene defined by a mutation In Arabidopsis: A Laboratory Manual (Weigel D & Glazebrook J eds), pp 168–169 Cold Spring Harbour Laboratory Press, Cold Spring Harbour, NY Supporting information This following supplementary material is available: Fig S1 Ubiquitin chain binding properties and the relevant domains of the human and yeast RPN10 homologs Fig S2 Ubiquitin chain binding properties of the RPN13 homologs Fig S3 Ubiquitin chain binding properties of the human and yeast RAD23, DSK2 and DDI1 homologs Fig S4 Sequence similarity among the RPN13 homologs Fig S5 Involvement of PRU in the Arabdopsis and human RPN13 homologs in the binding of ubiquitin chains Fig S6 Involvement of the UBAs of the RAD23, DSK2 and DDI1 homologs in the interaction with ubiquitin chains Fig S7 Sequence similarity of ubiquitin and the UBLs of the UBL–UBA factors Fig S8 The Y2H search for the interacting RP subunit(s) of the UBL–UBA factors Doc S1 Supplementary experimental procedures The methods used for the Y2H analyses Supplementary references FEBS Journal 277 (2010) 796–816 ª 2010 The Authors Journal compilation ª 2010 FEBS 815 Cross-species divergence of ubiquitin receptors A S Fatimababy et al Table S1 Expression constructs This supplementary material can be found in the online version of this article Please note: As a service to our authors and readers, this journal provides supporting information supplied 816 by the authors Such materials are peer-reviewed and may be re-organized for online delivery, but are not copy-edited or typeset Technical support issues arising from supporting information (other than missing files) should be addressed to the authors FEBS Journal 277 (2010) 796–816 ª 2010 The Authors Journal compilation ª 2010 FEBS ... results support a cross-species mechanistic and functional divergence of the major recognition pathways for the ubiquitylated substrates of UPP dominant targeting signal for UPP [6], the K63-linked... The divergent structural requirements of the major ubiquitin receptors for ubiquitin chain binding To examine the cross-species divergence of the structural requirements for the recognition of. .. interfaces for homologs of the major UBL–UBA factors (Table and Fig 8) in different species Our results support the mechanistic divergence across species of the major recognition pathways for ubiquitylated