... CGCCAGGGAGCTCACATGCCGTT), and three 3¢ oligonucleotides (primer 3, GAAAAGCTTCAGCTGGAA GTTGAACGGCAT; primer 4, AACAAGCTTCACGAA ATCTCCCAGGTCCAC; primer 7, AACAAGCTTGA AATCTCCCAGGTCCACGGT) were used To facilitate cloning ... C quinquefasciatus laboratory colony Results Identification of proteins in larvae BBMF that bind specifically to Bin toxin As an initial approach to identify the m...
Ngày tải lên: 19/02/2014, 07:20
... 5¢-AGGCCCCGGGTCACCTC CTAGCTAGAATTC-3¢ for a1 ; and 5¢-AGGTGATC ATATGCTTCTAGAGAAGAGTGAAATA-3¢ and 5¢-AG AGGATCCTCAGCCCATTTGGAGGGCGG-3¢ for b1 In each case, the forward primer introduced a unique NdeI ... 93 3A 94 4A Satomura T, Kawakami R, Sakuraba H & Ohshima T (2002) Dye-linked d-proline dehydrogenase from hyperthermophilic archaeon Pyrobaculum islandicum is a novel FAD...
Ngày tải lên: 20/02/2014, 01:20
Tài liệu GLOBAL EMPLOYMENT TRENDS 2013 Recovering from a second jobs dip docx
... Hungary Hungary Ireland Latvia Austria Malta Malta Estonia Bulgaria Slovakia Romania Cyprus Slovenia Luxembourg Germany Belgium Italy Austria Slovakia Czech Rep Greece Portugal Croatia Lithuania ... Economies and European Union Central and SouthEastern Europe (non-EU) and CIS East Asia South-East Asia and the Pacific South Asia Latin America and the Caribbean Middle East North Africa SubSahara...
Ngày tải lên: 20/02/2014, 05:22
Tài liệu English as a Second Language Standards docx
... ESL Standards for Pre-K-12 Students (Alexandria, VA: Teachers of English to Speakers of Other Languages Inc., 1997) ENGLISH AS A SECOND LANGUAGE STANDARDS ENGLISH AS A SECOND LANGUAGE STANDARDS ... for academic purposes in all content areas ENGLISH AS A SECOND LANGUAGE STANDARDS 15 16 ENGLISH AS A SECOND LANGUAGE STANDARDS PRIMARY ST...
Ngày tải lên: 24/02/2014, 18:20
Tài liệu Supporting Children Learning English as a Second Language in the Early Years (birth to six years) docx
... in a language other than English 11 Supporting Children Learning English as a Second Language in the Early Years (birth to six years) Learning English as a second or an additional language Babies ... English as a Second Language in the Early Years (birth to six years) Language delay Research has shown that mos...
Ngày tải lên: 24/02/2014, 18:20
Báo cáo khoa học: "Automatic Acquisition of English Topic Signatures Based on a Second Language" potx
... disambiguation methods In Proceedings of the International Conference on Theoretical and Methodological Issues in Machine Translation, pages 101–112 Rada Mihalcea and Dan I Moldovan 1999 An automatic ... topic signatures from Japanese text In particular cases, where one only cares about translation ambiguity, this technique can work on any language pair Conclusion and Future Work We...
Ngày tải lên: 08/03/2014, 04:22
Báo cáo khoa học: Identification and functional expression of a second human b-galactoside a2,6-sialyltransferase, ST6Gal II docx
... NeuAca2-6Galb1-4GlcNAc-R NeuAca2-3Galb1-3GalNAca1-O-Ser/Thrc NeuAca2-3Galb1-3[Neu5Aca2-6]GalNAca1-O-Ser/Thrc NeuAca2-6(3)Galb1-4GlcNAc-Rc Galb1-3GalNAca1-O-Ser/Thr Galb1-4GlcNAc-R Gala1-O-pNp GalNAca1-O-pNp ... weakly in placenta, lung, aorta, amygdala, occipital and parietal lobe and salivary gland Almost no expression was observed in fetal lung and heart, uterus, bladder, kidney, du...
Ngày tải lên: 08/03/2014, 08:20
Báo cáo khoa học: "Exploiting Named Entity Taggers in a Second Language" ppt
... CoNLL-2002, pages 175–178 Taipei, Taiwan Ian H Witten and Eibe Frank 1999 Data Mining, Practical Machine Learning Tools and Techniques with Java Implementations The Morgan Kaufmann Series in Data Management ... September Xavier Carreras and Llu´s Padr´ 2002 A flexible disı o tributed architecture for natural language analyzers In Proceedings of LREC’02, Las Palmas de Gran Canaria, Spain...
Ngày tải lên: 17/03/2014, 06:20
English As a Second Language and English Literacy Development: A Resource Guide pdf
... exhibit a variety of responses and behaviours as they learn a new language and adjust to a new social environment Initially, some Kindergarten children who are learning English as a second language ... grade-appropriate – understand grade-appropriate text, with assistance text that may be unfamiliar and unsupported by visual – select main ideas in short pascontext cl...
Ngày tải lên: 19/03/2014, 08:20
A kiss before dying
... tii:gg Iisisi=EttE R j 1q) R a\ a a a. a : +a^ ) a 'T-t tr-i -Y h Q R ,a) (t) R b q) F - i Lrl a ifu** gs A siii3iiit I sEI s titit t$ -r € a R ts R s $ rn Fir bo* a. i c - E a UI R q bo q) v f r'l f ... * F = ^ d b ^ F H d F A - r b ( ) H F a F F -1-.t a q) F F : L r?1 / ( - A * c Hd +J i f f i ! v a dic ! R E a - ) r- J t : Q F , t "ir P A ' a t{ {-J U v) +1 r...
Ngày tải lên: 21/03/2014, 12:05
leonardo da vinci a man before his time 1194
... a certain weigh After all Leonardo' s inventions was a success Leonardo Da Vinci was a man who exemplified the best qualities of a 15th century man In addition, he had a practical understanding ... ideas, inventions, remain today Furthermore Leonardo' s achievements had no limits Similarly he had a huge impact on mankind Furthermore, he was a man with good qualitie...
Ngày tải lên: 21/03/2014, 22:06
Báo cáo " Student writing process, perceptions, problems, and strategies in writing academic essays in a second language: A case study " docx
... library, reading too much and forgetting what was read, and not remembering where the ideas came from He then spent a lot of time reading the books again and again Hai also revealed in the informal ... Journal of Science, Foreign Languages 24 (2008) 184-197 database, and a chain of evidence (Yin [25]) and adopting a systematic and comprehensive data analysis scheme has hel...
Ngày tải lên: 22/03/2014, 10:20
Báo cáo khoa học: Characterization of a second proliferating cell nuclear antigen (PCNA2) from Drosophila melanogaster docx
... Drosophila melanogaster A Fig Interaction of Drosophila melanogaster proliferating cell nuclear antigen (DmPCNA2) and DmPCNA1 (A) In vitro interaction of DmPCNA2 and DmPCNA1 Lanes 1–5: the indicated ... of Drosophila melanogaster proliferating cell nuclear antigen (DmPCNA2) and DmPCNA1 in response to DNA-damaging agents (A) Immunofluorescent analysis of th...
Ngày tải lên: 23/03/2014, 10:20
Báo cáo khoa học: Saccharomyces cerevisiae a1,6-mannosyltransferase has a catalytic potential to transfer a second mannose molecule ppt
... contaminants may have a catalytic activity only toward the substrate (Man10GlcNAc2PA), where the first mannose was added to Man9GlcNAc2-PA, we purified Man10GlcNAc2-PA and used it as an acceptor, ... 17921–17931 Nakayama K, Nakanishi-Shindo Y, Tanaka A, HagaToda Y & Jigami Y (1997) Substrate specificity of alpha-1,6-mannosyltransferase that initiates N-linked mannose outer chain elong...
Ngày tải lên: 23/03/2014, 10:20
HALF A SECOND BEFORE TSUNAMI
... This picture was taken on the banks of Sumatra Island (the height of waves was of approx 32 m = 105 ft) It was found saved in a digital camera, after the disaster We cannot know for sure, ... likely the one who took the picture is not alive any more (it was just a matter of seconds) Today we can see the last image he/she saw before ending life on Earth
Ngày tải lên: 03/11/2015, 22:03