0

trace of a second rank tensor

Báo cáo khoa học: Identification and functional expression of a second human b-galactoside a2,6-sialyltransferase, ST6Gal II docx

Báo cáo khoa học: Identification and functional expression of a second human b-galactoside a2,6-sialyltransferase, ST6Gal II docx

Báo cáo khoa học

... HepG2cDNA library (C. Baisezand A. Harduin-Lepers, unpublished data), as the templateand two specific primers For 6I 5¢-CGATGAATTCGTTAACGCTCATCACCATCACCATCACGGGAAATTGGCCATGGGGT-3¢ containing a HpaIsiteandBack6I ... 00Fetuin NeuAca2-3Galb1-3GalNAca1-O-Ser/Thrc0 1.4NeuAca2-3Galb1-3[Neu5Aca2-6]GalNAca1-O-Ser/ThrcNeuAca2-6(3)Galb1-4GlcNAc-RcAsialofetuin Galb1-3GalNAca1-O-Ser/Thr 66 83Galb1-4GlcNAc-RArylglycosides ... the annealing of the two following synthetic oligonucleotides For EGT 5¢-GATCCGCCACCATGACCATCTTATGTTGGCTCGCTCTCCTGAGCACACTCACAGCTGTTAACGCTGACATCA-3¢ and Back EGT 5¢-GATCTGATGTCAGCGTTAACAGCTGTGAGTGTGCTCAGGAGAGCGAGCCAACATAAGATGGTCATGGTGGCG-3¢....
  • 12
  • 584
  • 0
Báo cáo khoa học: Characterization of a second proliferating cell nuclear antigen (PCNA2) from Drosophila melanogaster docx

Báo cáo khoa học: Characterization of a second proliferating cell nuclear antigen (PCNA2) from Drosophila melanogaster docx

Báo cáo khoa học

... initiation, 5¢-(C ⁄ A) AA (A ⁄ C)ATG, and a putativepoly (A) addition signal sequence, 5¢-AATAAA [17,18].It encoded a predicted product of 255 amino acidswith a molecular mass of 28.5 kDa, and ... detection reagents (Amersham PharmaciaBiotech, Piscataway, NJ).Animals were fed water and standard rabbit food andmaintained on a 12 h light/dark cycle. Polyclonal antiserumto the peptide was raised ... proliferating cell nuclear antigen 2 (DmPCNA2) and DmPCNA1 in response toDNA-damaging agents. (A) Immunofluorescent analysis of the localization of V5-tagged DmPCNA2 and Flag-tagged DmPCNA1. DmPCNA2...
  • 12
  • 404
  • 0
A History of Medicine SECOND EDITION doc

A History of Medicine SECOND EDITION doc

Sức khỏe giới tính

... Slaves apparentlycarried a 30-day warranty against certain disorders. For example, if a slave was attack ed by epilepsy within one m onth of purchase, the sellerhad to reclaim that slave an d ... remaining tissue is sewn shut. Female circumcision is seen as a way of ensuring chastity and was often practiced as a coming of age ritualand a prerequisite to marriage.HEALING RITUALS, TRADITIONS, ... scope and quality. Part of the problem was undoubtedlylack of systematic knowledge of anatomy, asepsis, anesthesia, and thefailure of a small tribal unit to provide enough ‘‘clinical material’’...
  • 626
  • 383
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Automatic Acquisition of English Topic Signatures Based on a Second Language" potx

Báo cáo khoa học

... Association of Artificial Intelligence.Rada Mihalcea. 2003. The role of non-ambiguouswords in natural language disambiguation. In Pro-ceedings of the Conference on Recent Advancesin Natural Language ... sense-tagged corpus,the TWA Sense Tagged Data Set, manually pro-duced by Rada Mihalcea and Li Yang (Mihalcea,2003), from text drawn from the British NationalCorpus. We calculated a ‘supervised’ ... MachineTranslation, pages 101–112.Rada Mihalcea and Dan I. Moldovan. 1999. An auto-matic method for generating sense tagged corpora.In Proceedings of the 16thConference of the Amer-ican Association...
  • 6
  • 471
  • 0
Gold, Peace, and Prosperity..Gold, Peace, and Prosperity:The Birth of a New Currency Second pptx

Gold, Peace, and Prosperity..Gold, Peace, and Prosperity:The Birth of a New Currency Second pptx

Khoa học xã hội

... sepa-rated, and they stand or fall together.Ron Paul understands that all three parts of this system of liberty have been under grave attack for decades, and that the main problem is the federal ... individual’s natural right to be free of assault and aggression, and of his right to keep the property that he has earned on the free market, and not have it stolen from him by confiscatory taxes ... coinage of the United States.“Without the automatic check of a gold standard,” wrote Professor William Quirk in the New Republic, “the Nixon and Carter administrations were able, in a remarkably...
  • 111
  • 1,231
  • 0
Báo cáo Y học: The role of the second binding loop of the cysteine protease inhibitor, cystatin A (stefin A), in stabilizing complexes with target proteases is exerted predominantly by Leu73 pdf

Báo cáo Y học: The role of the second binding loop of the cysteine protease inhibitor, cystatin A (stefin A), in stabilizing complexes with target proteases is exerted predominantly by Leu73 pdf

Báo cáo khoa học

... Forward CAAAAGTCTTGGCGGACAAAATGAGGACTTGGTACReverse CATTTTGTCCGCCAAGACTTTTGAATACTT TCAAGTGCQ76G Forward CTTCCCGGAGGAAATGAGGACTTGGTACTTACTGReverse CCTCATTTCCTCCGGGAAGACTTTTGAATA CN77G Forward ... SequenceStandard All ForwardGCTCAGGCGACCATGGGCCATCATCATCReverse CTTGCATGCCCTGCAGGTCGMutagenic L73G Forward GTATTCAAAAGTGGTCCCGGACAAAATGAG GACTTGReverse TCCGGGACCACTTTTGAATACTTTCAAGTGCATATATTTATTP74G ... sequence of the second binding loop of the related family 1 cystatin,cystatin A, differs appreciably from that of cystatin B.Most notably, cystatin A lacks the essential His75 andinstead has a Gly...
  • 10
  • 533
  • 0
The Gospels in the Second Century An Examination of the Critical Part of a Work Entitled ''''Supernatural Religion'''' pptx

The Gospels in the Second Century An Examination of the Critical Part of a Work Entitled ''''Supernatural Religion'''' pptx

Khoa học xã hội

... apokatastaesei panta, lego de humin, hoti Aelias aedae aelthe kai oukepegnosan auton all' epoiaesan auto hosa aethelaesan. Kai gegraptai hoti tote sunaekan oi mathaetai, hoti periIoannon tou Baptistou ... eipen autois.]_Matt._ xvii. 11-13.[Greek: Aelias men erchetai apokatastaesei panta, lego de humin hoti Aelias aedae aelthen kai ouk epegnosanauton, alla epoiaesan auto hosa aethelaesan, [outos ... representation of events in the early part of the rising of the Jews under Barcochba; Judith is Judaea, Nebuchadnezzar Trajan;Assyria stands for Syria, Nineveh for Antioch, Arphaxad for a Parthian...
  • 162
  • 496
  • 0
Báo cáo khoa học: Properties and significance of apoFNR as a second form of air-inactivated [4Fe-4S]ÆFNR of Escherichia coli pot

Báo cáo khoa học: Properties and significance of apoFNR as a second form of air-inactivated [4Fe-4S]ÆFNR of Escherichia coli pot

Báo cáo khoa học

... of aerobically and anaerobically prepared apoFNR. Aerobicallyor anaerobically prepared apoFNR were incubated with GnHCl +iodoacetate and digested with trypsin, and after separation on Sepha-dex ... anaerobic apoFNR consisted of one majorsignal at 28 408 Da after alkylation equivalent to five-fold alkylated apoFNR, and a minor signal of three-fold alkylated FNR (Fig. 1B). Therefore, aerobic andanaerobic ... MALDI-TOF spectra of peptides derived from carboxymeth-ylated aerobic (A) and anaerobic (B) apoFNR (trypsin digest). Thesamples (carboxymethylated tryptic digest of aerobic or anaerobicapoFNR)...
  • 10
  • 477
  • 0
Báo cáo khoa học: Crystal structure of the second PDZ domain of SAP97 in complex with a GluR-A C-terminal peptide ppt

Báo cáo khoa học: Crystal structure of the second PDZ domain of SAP97 in complex with a GluR-A C-terminal peptide ppt

Báo cáo khoa học

... sixb-strands (bAtobF) and two a- helices (aA and aB)(Fig. 4). The structure of the C378G variant of SAP97PDZ2was practically identical to that of C378Svariant, except for the mutated residue, and ... 890–907) of GluR -A and of twovariant PDZ2 domains in unliganded state at 1.8–2.44 A ˚resolutions.SAP97PDZ2folds to a compact globular domain comprising six b-strandsand two a- helices, a typical ... that trans-genic mice expressing GluR -A variant lacking sevenC-terminal residues display apparently normal synapticplasticity and basal GluR -A localization [10], suggest-ing developmental...
  • 11
  • 458
  • 0
The Design and Implementation of a Log-Structured File System

The Design and Implementation of a Log-Structured File System

Quản trị mạng

... log as the most up to date ‘‘truth’’ aboutthe state of the data on disk. The main difference is thatdatabase systems do not use the log as the final repositoryfor data: a separate data area is ... purpose.The separate data area of these database systems meansthat they do not need the segment cleaning mechanisms of the Sprite LFS to reclaim log space. The space occupiedby the log in a database system ... The bandwidth of each of the five phases isshown separately. Sprite LFS has a higher write bandwidth andthe same read bandwidth as SunOS with the exception of sequen-tial reading of a file that...
  • 15
  • 1,434
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25