... 5¢-CAGAATTCatg gagcagaagctgatctccgaggaggacctgctgGTGAACAACTCCAC CAACTCCTCCAACAACTCCCTGGCTCTTACAAGTC CTTATAAGACA-3¢; HsM2-as, 5¢-TTACCTTGTAGCG CCTATGTTCTTATAATG-3¢ (An engineered EcoRI recognition ... the coupling of M2 with GOA-1 We prepared an M2 mutant: :GOA-1 fusion protein and directly assessed the muscarinic- ligand-dependent activation of GOA-1 Results Expressio...
Ngày tải lên: 07/03/2014, 11:20
... not only enhance the hydrophobicity and thereby strengthen the membrane association of GRK6-A, but also increase the kinase catalytic activity of the protein Along the same lines, the C-terminal ... removal of the C-terminal- most 16 residues of mGRK6-A M1 affected the activity of the protein toward rhodopsin in a nonuniform manner Thus, removal of the C...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: Allosteric functioning of dimeric class C G-protein-coupled receptors doc
... general conformation of the HD dimer upon receptor activation [39] Allosteric functioning of the HD of class C GPCRs As observed for class A GPCRs, some class C receptors display constitutive, agonist-independent ... multiple domains of class C GPCRs In contrast to most class A rhodopsin-like GPCRs, class C receptors are composed of three main structural...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: G protein-coupled receptor 30 down-regulates cofactor expression and interferes with the transcriptional activity of glucocorticoid pdf
... sites The following primers were used for cloning at the pLEGFP-N1 vector: GPR30-forward 5¢-TAATAAGTCGACGGGTC TCTTCCT-3¢ and GPR30-reverse 5¢-ATTATTGGATC CTACACGGCACTGC-3¢ Viruses capable of introducing ... Statistical significance was calculated using the t-test as indicated in Fig C, control GPR30 C TIF-2 C GPR30 Fig GPR30 down-regulates the expression of TIF2 protein The...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: The impact of G-protein-coupled receptor hetero-oligomerization on function and pharmacology pptx
... Function and pharmacology of hetero-oligomers Effect of hetero-oligomerization on G-protein coupling and function To make the issue even more complicated, hetero-oligomerization has been ... molecules of b-arrestin and then the activation of ERK (B) Only one molecule of b-arrestin binds to the ligand-saturated receptor dimer and activates ERK (C) A dimer...
Ngày tải lên: 16/03/2014, 22:20
Báo cáo khoa học: The study of G-protein coupled receptor oligomerization with computational modeling and bioinformatics doc
... and the selection of the sequences in the alignment determine the nature of the answers returned by the application of the computational tools The statistical nature of these tools makes their ... comparing the results of all these methods is beyond the scope of this review The main features of the approach are illustrated here for the combination...
Ngày tải lên: 16/03/2014, 22:20
Báo cáo khoa học: Methods to monitor the quaternary structure of G protein-coupled receptors doc
... assessing the effect of ligand-binding on the quaternary structure of the receptors, the possibility that the antibodies could inhibit binding to the receptor also needs to be controlled Finally, the ... FEBS GPCR quaternary structure Fig Differentially epitope-tagged forms of the a1b-adrenoceptor have to be coexpressed to be coimmunoprecipitated N-termi...
Ngày tải lên: 16/03/2014, 22:20
Báo cáo khoa học: Identification of sites of phosphorylation by G-protein-coupled receptor kinase 2 in b-tubulin ppt
... for GRK2 have been reported, including synucleins [22 ], phosducin, and phosducin-like protein [23 ] The phosphorylation sites in synucleins and phosducin are located in their C-terminal domains, ... (b-adrenergic -receptor kinase- 1) by a muscarinic receptor m2 mutant lacking phosphorylation sites Eur J Biochem 22 6, 26 7 27 6 11 Haga, K & Haga, T (19 92) Activation by...
Ngày tải lên: 17/03/2014, 09:20
Báo cáo khoa học: Characterization of native and recombinant A4 glyceraldehyde 3-phosphate dehydrogenase Kinetic evidence for conformation changes upon association with the small protein CP12 pptx
... for recombinant and native GAPDH with a multit using a common value of Km and different values of kcat The estimated parameters had a value of 25 lM for the Km, and the kcat for recombinant and ... those of native GAPDH The decrease of the catalytic constant is a fast process compared to the decrease of the K0.5 for BPGA These changes are...
Ngày tải lên: 23/03/2014, 20:22
Báo cáo sinh học: " Kaposi''''s sarcoma associated herpesvirus G-protein coupled receptor activation of cyclooxygenase-2 in vascular endothelial ce" pptx
... Chiozzini C, Dias S, Silverstein RL, Rafii S, Mesri EA: Kaposi's sarcoma associated herpesvirus G protein -coupled receptor immortalizes human endothelial cells by activation of the VEGF receptor- 2/KDR ... MM, Chandran B: Cyclooxygenase induced by Kaposi's sarcoma- associated herpesvirus early during in vitro infection of target cells plays a role in the maintenanc...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo hóa học: " Kaposi''''s sarcoma associated herpesvirus G-protein coupled receptor activation of cyclooxygenase-2 in vascular endothelial cells" ppt
... Chiozzini C, Dias S, Silverstein RL, Rafii S, Mesri EA: Kaposi's sarcoma associated herpesvirus G protein -coupled receptor immortalizes human endothelial cells by activation of the VEGF receptor- 2/KDR ... MM, Chandran B: Cyclooxygenase induced by Kaposi's sarcoma- associated herpesvirus early during in vitro infection of target cells plays a role in the maintenanc...
Ngày tải lên: 20/06/2014, 01:20
báo cáo khoa học: " Nucleoside conjugates of quantum dots for characterization of G protein-coupled receptors: strategies for immobilizing A2A adenosine receptor agonists" pdf
... conjugates of quantum dots for characterization of G protein-coupled receptors: strategies for immobilizing A2A adenosine receptor agonists Journal of Nanobiotechnology 2010, 8:11 Page 19 of 19 ... ability of QD derivatives to interact with "soft" biopolymers, such as receptors, by coating the "hard" nanoparticle core with a dendritic "soft" shell This al...
Ngày tải lên: 11/08/2014, 00:22
Báo cáo y học: " Signaling and regulation of G protein-coupled receptors in airway smooth muscle" ppsx
... receptor signaling in airway smooth muscle contributing to elevated airway smooth muscle tone Within the context of airway remodeling, G protein-coupled receptor (GPCR) signaling leading to airway smooth ... that inflammation may modulate homologous GPCR desensitization in the airway This may preferentially affect β2AR signaling in ASM, in light of findin...
Ngày tải lên: 13/08/2014, 13:20