Topic 63: Discuss the role of the police force in society

Tài liệu Role of diffusion-weighted imaging in the diagnosis of gynecological diseases pdf

Tài liệu Role of diffusion-weighted imaging in the diagnosis of gynecological diseases pdf

... satisfactory in the evaluation of nodal status in this patient group Since the highly cellular tissue in reactive lymph nodes may also show increased intensity, the role of DWI and ADC in distinguishing ... parallel imaging technique (SENSE factor of 2) Imaging time of DWI was 90 s for 20 slices Detection of uterine malignancy The ADC values of uterine cancer...

Ngày tải lên: 13/02/2014, 06:20

16 830 0
Tài liệu Báo cáo khoa học: Mitochondrial targeting of intact CYP2B1 and CYP2E1 and N-terminal truncated CYP1A1 proteins in Saccharomyces cerevisiae ) role of protein kinase A in the mitochondrial targeting of CYP2E1 pdf

Tài liệu Báo cáo khoa học: Mitochondrial targeting of intact CYP2B1 and CYP2E1 and N-terminal truncated CYP1A1 proteins in Saccharomyces cerevisiae ) role of protein kinase A in the mitochondrial targeting of CYP2E1 pdf

... Bhagwat SV, Biswas G, Anandatheerthavarada HK, Addya S, Pandak W & Avadhani NG (199 9) Dual targeting property of the N-terminal signal sequence of P450 1A1 Targeting of heterologous proteins to ... open N-terminal signal domain is critical for protein targeting to the ER (Fig 2D) In contrast to the targeting of CYP 1A1 requiring N-terminal truncation, w...

Ngày tải lên: 18/02/2014, 16:20

16 651 0
Tài liệu Báo cáo khoa học: Role of K22 and R120 in the covalent binding of the antibiotic fosfomycin and the substrate-induced conformational change in UDP-N-acetylglucosamine enol pyruvyl transferase docx

Tài liệu Báo cáo khoa học: Role of K22 and R120 in the covalent binding of the antibiotic fosfomycin and the substrate-induced conformational change in UDP-N-acetylglucosamine enol pyruvyl transferase docx

... chain of K22 participates in fosfomycin binding, thus providing a rationale for the loss of fosfomycin binding to the K22V and K22E mutant proteins However, two other positively charged amino ... enthalpies of binding and stoichiometries were determined from the binding isotherm by fitting a : binding model to the data using the software provided by the m...

Ngày tải lên: 19/02/2014, 13:20

9 708 0
Tài liệu Báo cáo khoa học: Models and mechanisms of O-O bond activation by cytochrome P450 A critical assessment of the potential role of multiple active intermediates in oxidative catalysis doc

Tài liệu Báo cáo khoa học: Models and mechanisms of O-O bond activation by cytochrome P450 A critical assessment of the potential role of multiple active intermediates in oxidative catalysis doc

... [106,107] A step forward in the analysis of Fe(III)-OO(H) as a potential catalyst was thought to be offered by the use of mutated P450s, bearing alanine or some other amino acid in place of the highly ... Hlavica, P (1983) Mechanisms of extrahepatic bioactivation of aromatic amines: the role of hemoglobin in the N-oxidation of 4-chloraniline In Extr...

Ngày tải lên: 19/02/2014, 16:20

26 747 0
Tài liệu The Role of Public Regional Universities in Community and Economic Development doc

Tài liệu The Role of Public Regional Universities in Community and Economic Development doc

... stable supply of knowledge and skills in high need areas Increase the size, diversity of skills and productivity of the labor force Dimensions of Social and Economic Value Regional public institutions ... business Best Practice Highlights Slippery Rock University Regional Learning Alliance – workforce development and training/collaborations with business and...

Ngày tải lên: 21/02/2014, 01:20

29 655 0
Tài liệu Báo cáo khoa học: Electrostatic role of aromatic ring stacking in the pH-sensitive modulation of a chymotrypsin-type serine protease, Achromobacter protease I pdf

Tài liệu Báo cáo khoa học: Electrostatic role of aromatic ring stacking in the pH-sensitive modulation of a chymotrypsin-type serine protease, Achromobacter protease I pdf

... 2002 Aromatic stacking in API (Eur J Biochem 269) 4153 Fig Stick models of the reactive site in bovine trypsin and API The catalytic triad residues of trypsin and API are Ser195–His57– Asp102 and ... because several serine proteases not have an aspartate as the catalytic apparatus M NaCl However, for chymotrypsin-type serine proteases, the replacement of this aspar...

Ngày tải lên: 21/02/2014, 03:20

7 603 0
Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

... 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG)-3¢ The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAA AAAATTG)-3¢ and the downstream primer containing the ... value almost 2.5-fold higher than the native cold adapted enzyme (Table 1) The mutant G26 1A /Y2 6 9A exhibits an Ea almost the same as in the case of the native enzy...

Ngày tải lên: 22/02/2014, 04:20

6 489 0
Báo cáo khoa học: Role of DptE and DptF in the lipidation reaction of daptomycin ppt

Báo cáo khoa học: Role of DptE and DptF in the lipidation reaction of daptomycin ppt

... proteins (ACPs) [14,15] The genes dptE and dptF are localized immediately upstream of the NRPSs of A21987C The resulting proteins DptE and DptF were predicted to be involved in the lipidation reaction ... the initiation module of daptomycin That DptE and DptF are involved in the lipidation process of daptomycin was first shown by Miao et al [...

Ngày tải lên: 07/03/2014, 04:20

12 674 0
Báo cáo khoa học: The role of interface framework residues in determining antibody VH ⁄ VL interaction strength and antigen-binding affinity pptx

Báo cáo khoa học: The role of interface framework residues in determining antibody VH ⁄ VL interaction strength and antigen-binding affinity pptx

... observed in weaker binders Evaluation of the VH ⁄ VL interaction strength To evaluate the VH ⁄ VL interaction strength of these 36 clones, phages were used to infect a nonsuppressing strain, HB2151, ... strong VH ⁄ VL binder, to describe the relationship, and also to identify key residues in determining the interdomain interaction stren...

Ngày tải lên: 07/03/2014, 12:20

11 462 0
Báo cáo khoa học: "The Role of Lexico-Semantic Feedback in Open-Domain Textual Question-Answering" ppt

Báo cáo khoa học: "The Role of Lexico-Semantic Feedback in Open-Domain Textual Question-Answering" ppt

... Claire Cardie, Vincent Ng, David Pierce, Chris Buckley Examining the role of statistical and linguistic knowledge sources in a general-knowledge que stion answering system In Proceedings of the 6th ... periments with Open-Domain Textual Question Answering In the Proceedings of the 18th International Conference on Computational Linguistics (COLING-2000), pages 292298, 2000 Fr...

Ngày tải lên: 08/03/2014, 05:20

8 508 0
Báo cáo " THE ROLE OF GIFT RECIPIENT PERCEPTION IN CHANGING BRAND ATTITUDES AND GIVER - RECIPIENT RELATIONSHIP " potx

Báo cáo " THE ROLE OF GIFT RECIPIENT PERCEPTION IN CHANGING BRAND ATTITUDES AND GIVER - RECIPIENT RELATIONSHIP " potx

... 5.2.) Hypothesis 2: When the gift recipient s perception of prior attitude toward a brand is neutral and the giver -recipient relationship is strong, then the gift recipient s post -brand attitude ... level of recipient s perception of prior brand attitudes - Hypothesis 7a: The recipient s post brand attitude change is greater when receiving the...

Ngày tải lên: 14/03/2014, 14:20

10 482 0
The Role of Savings and Wealth in Reducing ―Wilt‖ between Expectations and College Attendance pdf

The Role of Savings and Wealth in Reducing ―Wilt‖ between Expectations and College Attendance pdf

... Sherraden, and Julia Stevens for comments CENTER FOR SOCIAL DEVELOPMENT WASHINGTON UNIVERSITY IN ST LOUIS i REDUCING WILT The Role of Savings and Wealth in Reducing ―Wilt‖ between Expectations and College ... Destin, 2009) Charles, Roscigno, and Torres (2007) is the only study of the seven to examine the relationship between parent school savings...

Ngày tải lên: 15/03/2014, 10:20

22 515 0
Topic 63: Discuss the role of the police force in society

Topic 63: Discuss the role of the police force in society

... vậy, 14 interference (n) : can thiệp, xen vào 15 law-abiding : trung thành với pháp luật, tuân theo luật pháp 16 frown (v) : không lòng, phản đối 17 prove (v): tỏ ra, chứng tỏ, chứng minh 18 dedicated

Ngày tải lên: 21/10/2015, 07:07

2 195 0
w