Báo cáo khoa học: Role of DptE and DptF in the lipidation reaction of daptomycin ppt

Role of DptE and DptF in the lipidation reaction of daptomycin Melanie Wittmann, Uwe Linne, Verena Pohlmann and Mohamed A. Marahiel Department of Chemistry ⁄ Biochemistry, Philipps-University Marburg, Germany Daptomycin is a clinically important semi-synthetic derivative of the A21978C branched cyclic lipopeptide antibiotics produced by Streptomyces roseosporus [1] . Acidic lipopeptide antibiotics present a new class of therapeutic agents that includes compounds such as calcium dependent antibiotic (CDA) [2], A54145 [3,4] and friulimicin [5,6] with a unique mechanism of action. Daptomycin binds to Gram-positive cell membranes via its lipid moiety, followed by calcium- dependent insertion and oligomerization. Subsequently, oligomers form ion channels that disrupt the bacterial membrane potential, leading to rapid cell death [7,8]. Daptomycin comprises a 13-amino acid peptide core coupled to a fatty acid moiety (Fig. 1). The peptide core is assembled nonribosomally by dptA and dptBC. The thioesterase DptD of the daptomycin biosynthetic gene cluster catalyses the cyclization reaction between the hydroxyl group of Thr4 and the C-terminal Kyn13, resulting in a ten-membered ring [8]. More- over, several ORFs localized within the gene cluster are associated with the biosynthesis of non-proteino- genic amino acids and incorporation of the fatty acid moiety [1]. All acidic lipopeptides (except CDA) produced in vivo show some flexibility with respect to the length and branching of their N-terminally attached fatty acid groups (Fig. 1). The activity of lipopeptide antibiotics as well as the toxicity towards eukaryotic cells strongly depends on the nature of the acyl moiety [9,10]. The fine tuning between these two features is of consider- able importance for the development of selective potent drugs. The biosynthesis of the peptide core of these acidic lipopeptides via nonribosomal peptide synthetases (NRPSs) is well understood, but little is known about the incorporation of the acyl residue into the final product [11,12]. As revealed by sequence comparison, the initiation modules of such NRPSs contain unique Keywords acidic lipopeptide antibiotics; AMP ligase; daptomycin; lipidation reaction; nonribosomal peptide synthetases Correspondence M. A. Marahiel, Department of Chemistry ⁄ Biochemistry, Philipps-University Marburg, Hans-Meerwein-Strasse, D-35043 Marburg, Germany Fax: +49 6421 2822191 Tel: +49 6241 2825722 E-mail: marahiel@chemie.uni-marburg.de (Received 4 June 2008, revised 29 August 2008, accepted 1 September 2008) doi:10.1111/j.1742-4658.2008.06664.x Daptomycin and A21987C antibiotics are branched, cyclic, nonribosomally assembled acidic lipodepsipeptides produced by Streptomyces roseosporus. The antibacterial activity of daptomycin against Gram-positive bacteria strongly depends on the nature of the N-terminal fatty acid moiety. Two genes, dptE and dptF, localized upstream of the daptomycin nonribosomal peptide synthetase genes, are thought to be involved in the lipidation of daptomycin. Here we describe the cloning, heterologous expression, purifi- cation and biochemical characterization of the enzymes encoded by these genes. DptE was proven to preferentially activate branched mid- to long-chain fatty acids under ATP consumption, and these fatty acids are subsequently transferred onto DptF, the cognate acyl carrier protein. Addi- tionally, we demonstrate that lipidation of DptF by DptE in trans is based on specific protein–protein interactions, as DptF is favored over other acyl carrier proteins. Study of DptE and DptF may provide useful insights into the lipidation mechanism, and these enzymes may be used to generate novel daptomycin derivatives with altered fatty acids. Abbreviations CDA, calcium dependent antibiotic; PKS, polyketide synthase. FEBS Journal 275 (2008) 5343–5354 ª 2008 The Authors Journal compilation ª 2008 FEBS 5343 condensation (C III ) domains that are thought to cata- lyse N-acylation of the first amino acid in the peptide chain [13]. However, the fatty acid moiety must be activated prior to being incorporated into the product. Two classes of enzymes are known to catalyse such reactions. One class, acyl CoASH synthetases, recognize and activate fatty acids as acyl adenylates (acyl AMPs), and subsequently couple them to coenzyme A (CoASH). The second class, fatty acyl ACP ligases, activate and transfer fatty acids from acyl AMP to cognate acyl carrier proteins (ACPs) [14,15]. The genes dptE and dptF are localized immediately upstream of the NRPSs of A21987C. The resulting proteins DptE and DptF were predicted to be involved in the lipidation reaction based on sequence similarity [1]. DptE is similar to other adenylate- forming enzymes such as acyl CoASH synthetases, and DptF is a putative ACP. Both proteins are thought to be important for the initiation of dapto- mycin biosynthesis [1,16]. In this study, we describe the biochemical character- ization of DptE as an acyl ACP ligase, and demon- strate transfer of various fatty acids onto the ACP encoded by dptF (Fig. 2). This biochemical character- ization of the lipidation mechanism during acidic lipopeptide biosynthesis may facilitate engineering of new derivatives with altered activities. Results Initial biochemical characterization of DptE and DptF DptE shares approximately 20% sequence identity with several members of the acyl AMP ⁄ CoASH ligase super- family [17]. These enzymes catalyse the formation of fatty acyl AMP ⁄ CoASH from a fatty acid substrate, ATP and CoASH in a Mg 2+ -dependent two-step reaction [17–19]. In general, a fatty acyl adenylate intermediate is formed in the first step, followed by conversion of the fatty acyl adenylate to fatty acyl CoA with release of AMP. Fig. 1. Chemical structures of the lipopeptide antibiotics daptomycin, A54145 and CDA, and their natural fatty acid moieties. Daptomycin and A54145 are naturally produced with various fatty acid side chains. For daptomycin, the major fatty acids are shown. CDA is produced with the epoxidized hexanoyl moiety exclusively. Lipidation of daptomycin M. Wittmann et al. 5344 FEBS Journal 275 (2008) 5343–5354 ª 2008 The Authors Journal compilation ª 2008 FEBS DptE was cloned into the pBAD102 ⁄ D-TOPO Ò vector and overexpressed in Escherichia coli BL21(DE3). The C-terminally His6-tagged and N-ter- minally thioredoxin-fused protein was purified, yielding 4.4 mgÆL )1 of culture. The identity of the protein was confirmed by SDS–PAGE (Fig. 3) and mass spectro- metry (Table 1). An initial fatty acid-dependent ATP ⁄ PP i exchange assay according to functionally related adenylation domains of NRPSs showed no activity (data not shown). To determine whether CoASH is the physiological substrate of DptE and required for enzyme activity, we determined the activity of DptE with ATP, MgCl 2 and CoASH under various conditions. However, no acyl CoA was detect- able by HPLC-MS (data not shown). As we were not able to detect any in vitro activity of DptE using ATP ⁄ PP i exchange assays, and no lipidation of CoASH was observed in the presence of fatty acids, we next focused on the transcriptionally coupled dptF, which encodes a stand alone putative ACP [20]. ACPs contain the modestly conserved motif GxDS(I ⁄ L), in which the serine residue is post-translationally modified by covalent attachment of a 4¢-phosphopantethein group [21,22]. The motif present in DptF is GLDSV, indicating that this putative ACP domain is one of the few ACPs in which valine replaces isoleucine (I) or leucine (L) in the conserved sequence. To determine whether DptF is the putative partner of DptE, we expressed dptF using the pQTev vector in E. coli and purified the resulting ACP as an N-terminal His7 fusion protein (Fig. 3) with a yield of 9.5 mgÆL )1 of culture. The identity of the protein was proven by SDS–PAGE + decanoic acid DptE +ATP PP i O O – 7 SH holo-ACP DptF DptA DptBC DptD daptomycin DptF S O decanoyl-S-ACP 7 Mg 2+ AMP DptE O O 7 AMP Fig. 2. Proposed mechanism for the lipidation of daptomycin by DptE and DptF. Decanoic acid is activated by the putative adenylating enzyme DptE under ATP con- sumption. The fatty acid is then transferred onto the acyl carrier protein DptF. The C domain of DptA is predicted to catalyse the condensation reaction between the fatty acid and tryptophan. kDa DptE aDptF hDptF aLipD kDa hLipD hAcpK 80 25 20 15 30 40 50 60 100 150 Fig. 3. Coomassie blue-stained SDS–PAGE gel of purified apo-DptF (aDptF, 13.5 kDa), holo-DptF (hDptF, 13.8 kDa), apo-LipD (aLipD, 11.1 kDa), holo-LipD (11.5 kDa), hAcpK (B. subtilis, holo form; 10.9 kDa) and DptE (80.5 kDa). SDS–PAGE was performed using a NuPAGE 4-12% Bis-Tris gel (Invitrogen). The protein ladder was from New England Biolabs (P7703, 10-250 kDa). Table 1. [M+H] + mass values for the proteins, substrates and products. [M+H] + (Da) Sample Mass observed Mass calculated apo-DptF 13 491.6 13 491.9 holo-DptF 13 831.7 13 831.9 apo-LipD 11 140.2 11 140.4 holo-LipD 11 480.4 11 480.5 apo-AcpK 10 561.5 10 561.0 holo-AcpK 10 901.6 10 901.0 decanoyl-DptF 13 986.9 13 986.9 decanoyl-LipD 11 635.6 11 635.7 decanoyl-AcpK 11 056.7 11 056.8 M. Wittmann et al. Lipidation of daptomycin FEBS Journal 275 (2008) 5343–5354 ª 2008 The Authors Journal compilation ª 2008 FEBS 5345 and tryptic digestion followed by mass spectrometry. Subsequently, DptF was incubated with the promiscu- ous 4¢-phosphopantetheinyl transferase Sfp from Bacil- lus subtilis and fluoresceinyl CoA [23]. The successful 4¢-phosphopantetheinylation of DptF was monitored by the in-gel fluorescence of the reaction mixture (Fig. 4). For subsequent acylation studies, holo-DptF was produced in the sfp-containing E. coli strain HM0079 [24]. The in vivo modification of DptF by Sfp resulted in 100% conversion of apo-DptF to holo-DptF as estimated by tandem fourier transform ion cyclotron resonance-MS (Fig. 5 and Table 1). Lipidation of DptF by DptE Initially, 50 lm holo-DptF was incubated with 500 lm decanoic acid, 10 mm MgCl 2 ,1mm ATP and 1 lm DptE (Fig. 5). The reaction mixture was quenched with 10% formic acid after 10 min and subjected to HPLC- ESI-MS analysis (Table 1). DptF was quantitatively acylated with decanoic acid. Subsequently, we deter- mined the pH and temperature for maximum forma- tion of decanoyl-S-ACP catalysed by DptE. Suitable reaction conditions were determined to be pH 7.0 and 37 °C, in agreement with those reported for other acyl AMP ⁄ ACP ⁄ CoASH ligases [15,25]. Omitting DptE or ATP abolished the acylation of DptF completely. These results indicate that decanoic acid is activated as a fatty acyl AMP and subsequently transferred onto holo-DptF by the acyl ACP synthetase DptE. To detect the adenylate intermediate, we repeated the reaction with apo-DptF rather than holo-DptF, which should lead to accumulation of the acyl adenylate intermedi- ate. The reaction was stopped using 10% formic acid and subjected to LC-MS to detect decanoic AMP (data not shown). However, we were not able to detect the adenylate intermediate using this approach. Next, we performed an ATP ⁄ PP i exchange assay with apo-DptF in the presence of phosphate buffer. Control reactions were performed without radioactively labelled PP i, DptE, apo-DptF, MgCl 2 , or ATP. In the presence of apo-DptF, we observed an approximately 100-fold higher activity of DptE compared to the control reac- tions (Fig. 6). The above-mentioned conditions were used for determination of steady-state kinetic para- meters. The K M and k cat values of DptE for holo-DptF (with concentrations between 2.5 and 250 lm) were 29.4 lm and 7.4 min )1 under decanoic acid satura- tion (500 lm), resulting in a catalytic efficiency of 0.25 min )1 Ælm )1 . Addition of CoASH to the reaction 10 15 20 30 Sfp ++–– 50 kDa kDa apo-DptF apo-AcpK SDS-PAGE UV-irradiation at 312 nm kDa kDa apo-DptF apo-AcpK +– + – Fig. 4. In vitro phosphopantetheinylation of apo-DptF and apo- AcpK. Coomassie blue-stained SDS–PAGE gel (left) and in-gel fluo- rescence (right) of the fluoresceinyl-ACP. (+) indicates the reaction with Sfp; ()) indicates the reaction without Sfp. m/z 13491.6 apo-DptF + Na + Ka Relative abundance 13 200 13 300 13 400 13 500 13 600 13 700 13 800 13 900 13 600 13 700 13 800 13 900 14 000 14 100 13 500 Relative abundance 13831.7 holo-DptF + Na + Ka m/z 13986.9 decanoyl-DptF + Ka + Na Relative abundance 13 500 13 600 13 700 13 800 13 900 14 000 14 100 Sfp / CoASH/Mg 2+ -5'-3'-ADP DptE -AMP + PPi +ATP m/z Fig. 5. Fourier transform MS spectra of apo-DptF (left), holo-DptF (middle) and decanoic acid-loaded DptF (right). 0 5000 10 000 15 000 20 000 25 000 c.p.m. Assay -PPi* -DptE -ATP -MgCl 2 30 000 Fig. 6. ATP ⁄ PP i exchange assay of DptE in the presence of apo- DptF, and control reactions without radioactive labeled PP i (PP i *), DptE, ATP or MgCl 2 . Lipidation of daptomycin M. Wittmann et al. 5346 FEBS Journal 275 (2008) 5343–5354 ª 2008 The Authors Journal compilation ª 2008 FEBS mixture did not affect the product formation activity (data not shown). Therefore, the results clearly demon- strate that holo-DptF is the cognate acceptor substrate of DptE (Table 2). Fatty acid specificity of the AMP ligase DptE Having proven a functional interaction of DptE and DptF utilizing decanoic acid as a standard substrate, we addressed the important question of DptE specific- ity. We systematically utilized a range of linear and branched chain fatty acids as well as hydroxy-fatty acids with various chain lengths and varied the concen- trations between 2.5 and 500 lm. Kinetic constants were determined by Michaelis–Menten fitting of the data sets. The summarized kinetic data, which were obtained under ATP and holo-DptF saturation, are presented in Table 2. As expected, the fatty acids (branched and linear, between 10 and 12 carbon units) that are known to be present in naturally produced A21987C lipopeptides and in the drug CubicinÒ (dap- tomycin formulated for injection) were observed to be excellent substrates, with K M values ranging from 8 to 20 lm and k cat values between 3.4 and 18.3 min )1 . Catalytic efficiencies were 0.29–0.95 min )1 Ælm )1 . These values are in good agreement with those observed for other systems in which a fatty acyl ACP synthetase lipidates a cognate holo-ACP in trans [26]. Octanoic acid, tetradecanoic acid and the 3-hydroxy fatty acid, which have not been reported as occurring in the natural compound, were relatively poor substrates, with K M values 2–13-fold higher than those for fatty acids naturally found in A21987C. Hexanoic acid, palmitic acid and 15-methylhexadecanoic acid were not accepted by DptE. In summary, DptE is capable of transferring a variety of fatty acids to the cognate ACP DptF in vitro. The kinetic data presented in this study indicate that DptE has a general preference for linear fatty acids with chain lengths between 8 and 14 carbon units, particularly iso ⁄ anteiso-branched chain fatty acids and Table 2. Kinetic parameters for steady-state analysis of the DptE- catalysed lipidation of DptF determined at varying concentrations of fatty acids or DptF, LipD and AcpK. Substrate K M (lM) k cat (min )1 ) k cat ⁄ K M (min )1 ÆlM )1 ) Linear a C8 65.0 ± 1.2 7.2 ± 0.5 0.11 ± 0.01 C10 8.2 ± 0.4 3.4 ± 0.2 0.42 ± 0.04 C12 10.9 ± 0.3 3.1 ± 0.1 0.29 ± 0.01 C14 26.6 ± 0.9 1.3 ± 0.2 0.05 ± 0.01 Branched b iso-C10 19.3 ± 0.5 17.9 ± 0.5 0.93 ± 0.05 iso-C12 19.2 ± 0.4 18.3 ± 0.5 0 .95 ± 0.05 iso-C13 16.1 ± 0.6 15.3 ± 0.7 0.95 ± 0.08 anteiso-C12 14.1 ± 0.8 13.1 ± 0.2 0.93 ± 0.08 Hydroxylated 3OH-C12 114.2 ± 4.2 5.1 ± 0.4 0.04 ± 0.01 ACPs holo-DptF 29.4 ± 0.4 7.4 ± 0.2 0.25 ± 0.01 holo-LipD 135.0 ± 0.5 6.3 ± 0.3 0.05 ± 0.03 holo-AcpK ND ND ND a Substrates C6 and C16 were not activated. b Substrate anteiso- C16 was not activated. + Na 10901.6 holo-AcpK 10 600 10 500 10 700 10 800 10 900 11 000 Relative abundance m/z 10901.6 holo-AcpK + Na 10561.5 apo-AcpK m/z 10 600 10 700 10 800 10 900 11 000 11 100 11 200 11 300 Relative abundance -5'-3'-ADP Sfp / CoASH/ Mg 2+ Fig. 7. AcpK expressed in its active holo form in M15 ⁄ pRep4-gsp cells (HM404). Only approximately 40% of AcpK is expressed in the holo form (upper). Phosphopantetheinylation of apo-AcpK with Sfp after expressing in M15 ⁄ pRep4-gsp cells (HM404) (lower). M. Wittmann et al. Lipidation of daptomycin FEBS Journal 275 (2008) 5343–5354 ª 2008 The Authors Journal compilation ª 2008 FEBS 5347 decanoic acid, while long chain fatty acids such as palmitic acid or 15-methylhexadecanoic acid are not recognized at all. Hydroxylated fatty acids are accepted, but with lower efficiencies. ACP specificity of the acyl ACP ligase DptE The results presented above confirm that DptE acti- vates various fatty acids and transfers them onto DptF. To address the question of the specificity of DptE towards ACPs, we utilized as alternative ACPs LipD, an ACP that is involved in friulimicin biosyn- thesis and shows approximately 31% sequence identity with DptF, and holo-AcpK (Fig. 7) from B. subtilis, which shares approximately 13% sequence identity with DptF. Mass spectrometry analysis of the assayed holo-AcpK showed no product formation. In a reaction mixture containing both DptF and AcpK, acylation of DptF exclusively was observed (data not shown). LipD was only partially acylated in presence or absence of DptF. For better comparison of the reaction velocities obtained with DptF and LipD, we performed kinetic studies. To determine kinetic data for LipD, this protein was expressed in vivo in its active holo form (see Experimental procedures). The reaction mixtures contained 1 mm ATP, 10 mm MgCl 2 , 2–250 lm holo-LipD, 1% dimethylsulfoxide and 500 lm decanoic acid. Michaelis–Menten fitting of the experimental data set resulted in a K M of 135 lm and a k cat of 6.3 min )1 . The catalytic efficiency of the transfer reaction to LipD (0.047 min )1 Ælm )1 ) was approximately five times lower than that for DptF (0.25 min )1 Ælm )1 ) (Table 2). In conclusion, these results suggest that there is specific recognition between DptE and DptF. Discussion Daptomycin is a prominent member of the pharmaco- logically important class of antimicrobial acidic lipo- peptides. It has been commercialized as CubicinÒ (Cubist Pharmaceuticals Inc., Lexington, PA, USA) for the treatment of serious infections caused by Gram-positive bacteria [27]. Recently, it has been shown that the activity of these acidic lipopeptides is significantly influenced by the length and structure of their fatty acid moieties [9,10]. In the fermentation of these natural products, some flexibility with respect to the length and branching of the lipid side chain has been observed [10]. Complete biochemical characteri- zation of the lipidation reaction may allow the engineering of lipopeptides with modified fatty acid moieties, which could lead to new antibiotics active against a wide range of bacteria, preventing damage to eukaryotic cells. For incorporation of the fatty acid moiety into nonribosomal peptides, condensation of the fatty acid with the N-terminal tryptophan of the nonribosomally synthesized peptide is necessary. Here, we report the results of a steady-state kinetic analysis of DptE. The aim of this kinetic study was to determine the specificity of DptE for various fatty acids and noncognate ACPs. The Michaelis–Menten kinetic values indicate catalysis of the two-step reaction with one substrate (fatty acid or ACP) under saturating or non-saturating conditions. The kinetic data for the various fatty acids transferred onto DptF by DptE reported here indicate the preference of DptE for those found in the naturally produced daptomycin derivatives. Additionally, it was observed that long- chain (16 carbon units or more) and short-chain fatty acids (six carbon units or fewer) are not accepted by DptE. The observation that DptE is able to activate and transfer a broad range of fatty acids fits well with results for other fatty acid CoASH synthetases such as Faa1p from Saccaromyces cerevisiae [28] or CpPKS1- AL from Cryptosporidium parvum [26]. Faa1p func- tions in the vectorial acylation of exogenous long-chain fatty acids, and has a preference for fatty acid sub- strates with 10–18 carbons. The K M value of Faa1p for oleate is 71.1 lm. The CpPKS1-AL domain has been proposed to be involved in the biosynthesis of a yet undetermined polyketide. This domain also shows broad substrate acceptance but with a preference for long-chain fatty acids, particularly arachidic acid. The actual substrates for the fatty acid CoASH ⁄ ACP synthetases will be limited by the availability of fatty acids in the host organism. Interestingly, comparison of the k cat ⁄ K M values for DptE revealed that it is five times more active with the physiologically relevant ACP DptF than with to LipD (Table 2), and is inactive with AcpK. Therefore, the in trans lipidation of DptF appears to be the result of specific protein–protein communication [29]. Faa1p, which functions by a common ‘ping pong BI-BI’ mechanism [30–32], showed a K M of 18.3 lm for its cognate ACP. In the case of CpPKS1-AL, the K M for the lipidation of ACP was 3.53 lm. These findings are in good agreement with those for DptE, which has a K M of 29.4 lm for its cognate ACP. In microorganisms, various strategies exist for the activation of fatty acids. Gokhale et al. [14,33,34] found several enzymes for fatty acid activation in Mycobacterium tuberculosis. These putative enzymes were cloned and expressed in E. coli, and two distinct classes were found, namely fatty acyl AMP ligases and fatty acyl CoASH ligases. The AMP ligases activate Lipidation of daptomycin M. Wittmann et al. 5348 FEBS Journal 275 (2008) 5343–5354 ª 2008 The Authors Journal compilation ª 2008 FEBS metabolic fatty acids as acyl adenylates, which are sub- sequently transferred to a cognate holo-ACP domain. In contrast, the acyl CoASH ligases catalyse transfer onto CoASH, forming an acyl thioester, which subsequently undergoes transthiolation with the HS-phosphopantetheine group of an ACP [14,33,34]. The loading module of the polyketide synthase (PKS) ⁄ NRPS hybrid mycosubtilin was recently characterized [35,36]. It was shown that priming of ACP 1 with a fatty acid occurs via an acyl AMP ligase domain in cis. The latter type of fatty acid activation and loading was exclusively reported for PKS systems [14]. Recently, lipidation of the acidic lipopeptide CDA was investigated in vivo and in vitro [16]. However, CDA is an exception within the acidic lipopeptides, as only 2,3-epoxy-hexanoic acid is incorporated into the final product, and two specific enzymes encoded by fabH3 and fabH4 are thought to synthesize hexanoic acid directly on an ACP. Two additional proteins encoded in the CDA fab operon, HxcO and HcmO, are responsible for the subsequent epoxidation of hexa- noyl S-ACP [37]. Interestingly, in the case of the lipopeptide surfactin, neither an acyl CoASH ligase-like domain nor an ACP could be identified within the biosynthetic gene cluster using bioinformatic tools [38]. Previously, an unknown 40 kDa protein was thought to be the candidate for lipidation. However, it has been suggested that the activated 3-hydroxymyristoyl CoA substrate is bio- synthesized by the primary metabolism. Recently, it was reported that the acyl CoA substrate is transferred to the initiation module SrfA-A1. This transfer is stimulated by the surfactin thioesterase II SrfD [38]. However, the reaction also took place in the absence of the thioesterase, but with reduced turnover. To date, no additional enzyme such as an acyltransferase or an acyl CoASH ligase has been reported to be involved in the surfactin initiation process. Another possibility for lipidation of secondary metabolites could be the interaction of fatty acid synthase-like enzymes or substrates from the primary metabolism with NRPSs or PKSs, as shown for afla- toxin produced by the fungi Asparagillus parasiticus and A. flavus [39,40]. In this example, the fatty acid synthase-like enzymes HexA and HexB synthesize hexanoic acid from acetyl CoA and two units of malonyl CoA. This hexanoic acid serves as a precursor for initiation of the PKS of aflatoxin biosynthesis. As shown here, the acyl ACP ligase DptE of the daptomycin biosynthetic gene cluster appears to directly select and activate cytosolic fatty acids from primary metabolism as fatty acyl adenylates in a mech- anism analogous to the adenylation domains of NRPSs [41]. Subsequently, the fatty acids are trans- ferred in trans onto holo-DptF to generate fatty acyl S-ACP. No lipidation was observed without ATP, confirming our conclusion that the fatty acid has to be activated as an adenylate prior to esterfication by the cognate ACP. Interestingly, we detected a 100-fold higher activity over background in the ATP ⁄ PP i exchange assay with DptE when it was performed in the presence of nonre- active apo-DptF (approximately 26 500 c.p.m.). In the absence of DptE we found only a marginal activity (approximately 250 c.p.m.). This leads to the conclu- sion that DptE requires DptF for its activity. We sug- gest that the reason that a fatty acid adenylate intermediate was not detected using apo-DptF in an LC-MS approach is that the back reaction was too fast or the amount of product was below the detection limit. Summarizing, the present study focuses on the bio- chemical characterization of DptE and DptF. To date, we cannot rule out the possibility that similar fatty acid CoA derivatives will also be recognized by the C domain of the initiation module of dapto- mycin. That DptE and DptF are involved in the lipidation process of daptomycin was first shown by Miao et al. [1]. In their work, the daptomycin gene cluster was heterologously expressed in Streptomyces lividans. Only authentic daptomycin derivatives were found and no derivatives with common fatty acids of the S. lividans organism. Studies utilizing deletion mutants or biochemical studies involving the initia- tion module of daptomycin synthetase are required to prove whether DptE and DptF are essential for lipidation or whether there are additionally alterna- tive pathways. In conclusion, DptE was observed to recognize a variety of fatty acid moieties. After activation of the fatty acids under ATP consumption, most likely as fatty acyl AMPs, DptE subsequently catalyses specific transfer onto the 4¢-phosphopantethein group of DptF. The observed substrate tolerance for loading a variety of fatty acids onto the ACP will facilitate future pro- jects on the manipulation and combinatorial biosyn- thesis of acidic lipopeptides. Hopefully, the recognition and efficient transfer of new building blocks can be achieved using DptE and DptF. This is important, as the fatty acid moiety has been proven to have a high impact on the bioactivity and bioselectivity of these antibiotics [9,10]. It remains to be clarified whether all of the fatty acids activated by DptE can be incorpo- rated into the final product or whether there is an interfering specificity of the C III domain of the initia- tion module. M. Wittmann et al. Lipidation of daptomycin FEBS Journal 275 (2008) 5343–5354 ª 2008 The Authors Journal compilation ª 2008 FEBS 5349 Experimental procedures Materials Electrocompetent Top10 and BL21 (DE3) E. coli cells were purchased from Invitrogen (Carlsbad, CA, USA). All restriction endonucleases and T4 DNA ligase were obtained from New England Biolabs (NEB GmbH, Hilden, Germany). Oligonucleotides were purchased from Operon (Operon Biotechnologies GmbH, Cologne, Germany). Plasmid DNA isolation was performed using a Qiagen spin miniprep kit (Qiagen GmbH, Hilden, Germany). DNA sequencing was performed at GATC Biotech AG (Konstanz, Germany). The plasmid pBAD102 ⁄ D-TOPO Ò was purchased from Invitrogen. The pQTev vector, which is a derivative of pQE60, was purchased from Qiagen. Fatty acids were purchased from Larodan (LARODAN Fine Chemicals AB, Malmoe, Sweden). All other materials were purchased from Sigma-Aldrich (Sigma Aldrich Chemie GmbH, Munich, Germany). DNA isolation S. roseosporus NRLL 11379 was inoculated in nutrient broth and grown at 37 °C for 48 h with agitation. Genomic DNA was isolated using a DNeasy Blood and Tissue kit (Qiagen). Cloning and expression of DptF The 270 bp dptF gene was amplified by PCR from S. roseosp- orus NRLL 11379 genomic DNA using high-fidelity Phusion DNA polymerase (Finnzymes, Espoo, Finland) and primers dptF-for (5¢-TAT GGATCCAACCCGCCCGAAGC GGTC-3¢) and dptF-rev (5¢-ATA GCGGCCGCGGTGCGGTCGGCC AACTG-3¢) (underlining indicates artificial BamHI and NotI restriction sites). The amplified product was purified on a 1.2% agarose gel using a PCR gel extraction kit (Qiagen), digested with BamHI and NotI, and ligated into the same sites of the pQTev vector to yield the plasmid pQTev-dptF. The integrity of the plasmid was confirmed by sequencing. The resulting plasmid was used to transform E. coli BL21 (DE3) or E. coli HM0079 [24] for gene expression. The cul- tures were grown in LB medium supplemented with 100 lgÆmL )1 ampicillin. Cultures were grown at 37 °Ctoan attenuance at 600 nm of 0.5, and then the temperature was decreased to 30 °C and gene expression was induced by addi- tion of 0.1 mm isopropyl thio-b-d-galactoside (IPTG, final concentration). Cultures were grown for an additional 4 h and then harvested by centrifugation (4000 g,4°C, 15 min). Cloning and expression of DptE The 1795 bp dptE gene was amplified from Strepto- myces roseosporus NRLL 11379 genomic DNA using high- fidelity Phusion DNA polymerase (Finnzymes) and primers dptE-for (5¢- CACCATGAGTGAGAGCCGCTGTGCCG G-3¢; underlining indicates the sequence overhang for the TOPO cloning) and dptE-rev (5¢-CGCGGGGTGCGGA TGTGGAG-3¢). The amplified product was purified from a 0.8% agarose gel using a PCR gel extraction kit (Qiagen), and ligated into pBAD102 ⁄ D-TOPOÒ (Invitrogen) accord- ing to manufacturer’s instructions to yield the plasmid pBAD102 ⁄ D-TOPO-dptE. The integrity of the plasmid was confirmed by sequencing. The resulting plasmid was used to transform E. coli BL21 (DE3) for gene expression. The cultures were grown at 37 °C in LB medium supplemented with 100 lgÆmL )1 ampicillin to an attenuance at 600 nm of 0.5. The temperature was then decreased to 28 °C, and gene expression was induced by addition of 0.1 m m IPTG (final concentration). Cultures were grown for an additional 4 h and then harvested by centrifugation (4000 g,4°C, 15 min). Purification of recombinant expressed proteins DptE and DptF For purification of DptE and DptF, cell pellets from 1 litre of culture were resuspended in 10 mL of buffer A (50 mm phosphate buffer, 300 mm NaCl, pH 7.0) and disrupted using a French press (SLM Aminco; Thermo French Ò press, G. Heinemann Labortechnik, Schwaebisch Gemuend, Ger- many). Insoluble cell debris was removed by centrifugation (17 000 g,4°C, 45 min). Purification of the His-tagged fusion proteins using Ni 2+ -NTA superflow resin (Qiagen) was performed on an FPLC system (Amersham Pharmacia Biotechnology, Amersham, UK) according to manufac- turer’s standard protocol. Briefly, fractions containing the recombinant proteins were monitored by SDS–PAGE, pooled, and dialysed against phosphate buffer with 100 mm NaCl using HiTrapÔ desalting columns (GE Healthcare Eur- ope GmbH, Freiburg, Germany). The recombinant proteins were then concentrated using membrane-based Amicon Ò Ultra-15 concentrators (Millipore GmbH, Schwalbach, Germany) with a molecular mass cut-off of 10 kDa (DptF) and 50 kDa (DptE). Protein concentrations were determined by NanoDropÒ spectrophotometer ND-1000 (PeqLab Biotechnologie GmbH, Erlangen, Germany) measurements. The affinity-purified proteins were stored at )80 °C. In vitro 4¢-phosphopantetheinylation of apo-DptF A reaction mixture containing 200 lm fluoresceinyl CoA or CoASH [42], 50 lm DptF, 10 mm MgCl 2 and 0.5 lm recom- binant Bacillus subtilis 4¢-phosphopantetheine transferase Sfp in assay buffer (50 mm phosphate buffer, 100 mm NaCl, pH 7.0) was incubated at 37 °C for 5–30 min and analysed on an SDS–PAGE gel by measuring the in-gel fluorescence. The Sfp substrate fluoresceinyl CoA was generated as previously described [23]. The CoASH Lipidation of daptomycin M. Wittmann et al. 5350 FEBS Journal 275 (2008) 5343–5354 ª 2008 The Authors Journal compilation ª 2008 FEBS modification of DptF was verified by ESI-MS using an LTQ-FT mass spectrometer (Thermo Fisher Scientific, Bremen, Germany). ATP-pyrophosphate exchange assay The ATP ⁄ PP i exchange reaction was used to determine the activity and substrate specificity of DptE. For all assays, the enzyme concentration varied from 300 nm to 1 mm, and the ATP concentration was at a saturating level of 2mm. All reactions were performed at 37 °C. ATP ⁄ PP i reactions were performed for 30 s to 1 min. Reaction mixtures contained 50 mm Hepes, pH 8.0, 100 mm NaCl, 10 mm MgCl 2 , 500 nm decanoic acid and 300 nm to 1 lm DptE (in a final volume of 100 lL). The reaction was initiated by addition of ATP, 50 lm tetrasodium pyrophos- phate (NaPP i ) and 0.15 lCi (16 CiÆmmol )1 ) of tetrasodium pyrophosphate (radioactive labeled PP i , Perkin Elmer, Waltham, MA, USA). The reactions were quenched by adding 500 lL of a stop mix containing 1.2% w ⁄ v acti- vated charcoal, 0.1 m tetrasodium pyrophosphate and 0.35 m perchloric acid. Subsequently, the charcoal was pelleted by centrifugation (4000 g,4°C, 3 min), washed twice with 1 mL water (vortexed for 30 s), and once with 0.5 mL water. After addition of 0.5 mL water and 3.5 mL of liquid scintillation fluid (Rotiscint Eco Plus, CarlRoth GmbH and Co. KG, Karlsruhe, Germany), the charcoal- bound radioactivity was determined by liquid scintillation counting using a 1900CA Tri-carb liquid scintillation analyser (Packard Instruments, Meriden, CT, USA). Activity assay of DptE with CoASH Acyl CoASH synthetases ⁄ ligases are thought to catalyse the thioesterification of a fatty acid with CoASH. In this study, we showed that DptE was not able to react with CoASH as a substrate. However, a typical reaction mixture (100 lL) was composed of 50 mm phosphate buffer, 100 mm NaCl, 10 mm MgCl 2 ,1mm ATP, 300 lm CoASH, 500 lm decanoic acid, 1% dimethylsulfoxide and 1 mm DptE. After incubation at 37 °C for 30 min, reactions were stopped with 10 lL formic acid. The product formation was measured by HPLC-MS. Separation of the reaction products was achieved on a 250 ⁄ 3 Nucleosil C8 column (3 lm, Macherey-Nagel GmbH & Co. KG, Du ¨ ren, Germany) by applying the following gradient at a flow rate of 0.3 mLÆmin )1 [buffer A: 2mm triethylamine ⁄ water; buffer B: 2mm triethylamino ⁄ 80% acetonitrile ⁄ 20% water (v ⁄ v)], column temperature 30 °C: loading 5% buffer B, after 5 min linear gradient up to 95% buffer B in 37 min, and then holding 100% buffer B for 5 min. The product was identified by UV detection at 215 nm and by on-line ESI-MS analysis with an Agilent 1100 MSD (Agilent Technologies Deutschland GmbH, Boeblingen, Germany) in the negative single ion monitoring (SIM) mode. DptE-mediated transfer of long-chain fatty acids to holo-DptF For this reaction, we used holo-DptF that was heterolo- gously expressed in sfp-containing E. coli HM0079 cells. A typical reaction mixture contained 50 lm holo-DptF, 250 lm fatty acid, 10 mm MgCl 2 ,1mm ATP, 1% dimethyl- sulfoxide and 1 lm DptE in a total volume of 25 lL 50 mm phosphate buffer (pH 7.0) with 100 mm NaCl. After incubation at 37 °C for 0–30 min, the reaction was quenched by addition of 7.5 lL formic acid and directly analysed by mass spectrometry using an LTQ-FT instru- ment (Thermo Fisher Scientific), with desalting using an 8 ⁄ 2 Nucleodur C4 pre-column (Macherey & Nagel). The solvents used were water with 0.05% formic acid and acetonitrile with 0.045% formic acid. The following gradient was applied at a flow rate of 0.2 mL Æ min )1 and a column temperature of 40 °C. The sample was loaded with 95% buffer A for 3 min, followed by a linear gradient down to 60% buffer A in 15 min, followed by a linear gradient down to 5% buffer A in 2 min. 5% buffer A was held for an additional 2 min and followed by a linear gradient up to 95% buffer A in 6 min. Determination of the acyl adenylate intermediate LC-MS approach To identify decanoic AMP by LC-MS, reactions (100 lL) containing decanoic acid (500 lm), ATP (1 lm), MgCl 2 (10 mm), apo-DptF (50 lm), 1% dimethylsulfoxide and phosphate buffer (pH 7.0, 50 mm) were performed at 37 °C. Reactions were initiated by addition of DptE (5 lm) and stopped after 1 h by addition of 30 lL formic acid. Samples were analysed by HPLC-MS as described above. ATP/PP i -exchange approach For activity measurements, DptE (1 lm) was rapidily mixed with 0.15 lCi (16 CiÆmmol )1 ) hot PP i in the presence of 500 lm decanoic acid, 1% dimethylsulfoxide, 10 mm MgCl 2 ,1mm ATP, 10 lm apo-DptF and 5 mm NaPP i phosphate buffer (pH 7.0, 50 mm)at37°C. The enzyme activity was also checked in the absence apo-DptF, hot PP i , DptE or MgCl 2 as control reactions. The reactions were stopped after 60 min by addition of 500 lL stop mix. Sam- ples were washed and analysed as described above. Determination of the kinetic parameters of DptF lipidation by DptE To determine the kinetic parameters for holo-DtpF lipida- tion by DptE, we performed the reactions under ACP satu- ration and varied the fatty acid concentrations. Depending on the substrate, we varied the reaction time between 30 s M. Wittmann et al. Lipidation of daptomycin FEBS Journal 275 (2008) 5343–5354 ª 2008 The Authors Journal compilation ª 2008 FEBS 5351 and 4 min. The reactions were carried out at 37 °Cina total volume of 25 lL. Unless otherwise indicated, the reaction mixtures contained 50 mm phosphate buffer, 100 mm NaCl, pH 7.0, 10 mm MgCl 2 ,1mm ATP, 1 mm DptE, 50 lm holo-DptF, 1% dimethylsulfoxide and various concentrations of fatty acids (10–250 lm). The reactions were stopped by the addition of 7.5 lL acetic acid. The conversion rate of holo-DptF into fatty acyl S-DptF was analysed by LC-ESI-MS as described above. The steady- state parameters k cat and k cat ⁄ K M and their standard errors were determined using nonlinear regression with sigmaplot 8.0 (Systat Software GmbH, Erkrath, Germany) to fit the data to the Michaelis–Menten equation. Determination of DptE specificity towards other ACPs E. coli HM404 cells (E. coli M15 ⁄ pREP4-gsp transformed with pQE60-acpK) [43] were a gift from H. D. Mootz (Fachbereich Chemische Biologie, Technische Universita ¨ t Dortmund, Germany). The expression The E. coli HM404 cells were grown in the presence of 25 lgÆmL )1 kanamy- cin, induced, harvested and disrupted, and the crude cell extract was centrifuged as described above for DptF. Pro- tein purification was performed as described previously [43]. The yield of purified protein was 5.5 mgÆL )1 of culture (Fig. 7). The lipD gene was amplified from genomic DNA using Phusion DNA polymerase (Finnzymes) and the synthetic oligonucleotide primers 5¢-AAAAAA GAATTCATGTCA GACCTCAGCACCGC-3¢ and 5¢-AAAAA AAGCTTTCA GGCGGAACGCAGCTC-3¢ (EcoRI and HindIII restric- tion sites are underlined). The resulting 291 bp PCR frag- ment was purified, digested with EcoRI and HindIII, and ligated into a pET28a(+) derivative (Novagen, Merck KGaA, Darmstadt, Germany), digested with the same enzymes. The identity of the resulting plasmid pCB28a(+)- lipD with an N-terminal hexahistidine tag was confirmed by DNA sequencing. The plasmid was used to transform E. coli strain BL21(DE3) (Novagen) and the enzyme was overproduced in LB medium supplemented with kanamycin (50 lgÆmL )1 ). The cultures were grown to an absorbance of 0.3 at 30 °C. The cultures were cooled to 18 °C and protein production was induced by the addition of IPTG to a final concentra- tion of 0.1 mm. The cultures were incubated for a further 18 h. After harvesting by centrifugation (6500 g, 15 min, 4 °C) and resuspension in 50 mm Hepes, pH 8.0, 300 mm NaCl, purification of the recombinant protein was per- formed as previously described [44]. Fractions containing LipD (11.1 kDa) were identified by 15% SDS–PAGE anal- ysis, pooled, and dialysed against 10 mm Tris ⁄ HCl, pH 8.0, using HiTrap desalting columns (Amersham Pharmacia Biotechnology). Protein concentration was determined spectrophotometrically using the calculated extinction coefficient at 280 nm. The yield of purified protein was 2mgÆL )1 of culture. In vitro 4¢-phosphopantetheinylation of apo-AcpK and apo-LipD was performed as described above for apo-DptF. In vivo 4¢-phosphopantetheinylation of apo-LipD was car- ried out in BL21(DE3)-pRep4-gsp. The transfer assays to holo-LipD and holo-AcpK and determination of the kinetic parameters for the DptE-mediated transfer to holo-LipD were performed as described above (see Determination of the kinetic parameters of DptF lipidation by DptE). Acknowledgements We thank Dr Georg Scho ¨ nafinger, Dr Christoph Mahl- ert and Thomas Knappe (Department of Chemistry ⁄ Biochemistry, Philipps-University Marburg, Germany) for helpful discussions and critical comments on the manuscript. Dr Henning D. Mootz provided the HM0079 and HM404 strains. This work was supported by the Deutsche Forschungsgemeinschaft and the Fonds der Chemischen Industrie. References 1 Miao V, Coeffet-Legal MF, Brian P, Brost R, Penn J, Whiting A, Martin S, Ford R, Parr I, Bouchard M et al. (2005) Daptomycin biosynthesis in Streptomyces roseosp- orus: cloning and analysis of the gene cluster and revision of peptide stereochemistry. Microbiology 151, 1507–1523. 2 Hojati Z, Milne C, Harvey B, Gordon L, Borg M, Flett F, Wilkinson B, Sidebottom PJ, Rudd BA, Hayes MA et al. (2002) Structure, biosynthetic origin, and engi- neered biosynthesis of calcium-dependent antibiotics from Streptomyces coelicolor. Chem Biol 9 , 1175–1187. 3 Fukuda DS, Debono M, Molloy RM & Mynderse JS (1990) A54145, a new lipopeptide antibiotic complex: microbial and chemical modification. J Antibiot 43, 601–606. 4 Miao V, Brost R, Chapple J, She K, Gal MF & Baltz RH (2006) The lipopeptide antibiotic A54145 biosynthetic gene cluster from Streptomyces fradiae. J Ind Microbiol Biotechnol 33, 129–140. 5 Heinzelmann E, Berger S, Muller C, Hartner T, Poralla K, Wohlleben W & Schwartz D (2005) An acyl-CoA dehydrogenase is involved in the formation of the Delta cis3 double bond in the acyl residue of the lipopeptide antibiotic friulimicin in Actinoplanes friuliensis. Microbi- ology 151, 1963–1974. 6 Vertesy L, Ehlers E, Kogler H, Kurz M, Meiwes J, Sei- bert G, Vogel M & Hammann P (2000) Friulimicins: novel lipopeptide antibiotics with peptidoglycan synthe- sis inhibiting activity from Actinoplanes friuliensis sp. nov. II. Isolation and structural characterization. J Anti- biot 53, 816–827. Lipidation of daptomycin M. Wittmann et al. 5352 FEBS Journal 275 (2008) 5343–5354 ª 2008 The Authors Journal compilation ª 2008 FEBS [...]... & Shen B (2001) Cloning and characterization of a phosphopantetheinyl transferase from Streptomyces verticillus ATCC15003, the producer of the hybrid peptide–polyketide antitumor drug bleomycin Chem Biol 8, 725–738 Stein DB, Linne U, Hahn M & Marahiel MA (2006) Impact of epimerization domains on the intermodular transfer of enzyme-bound intermediates in nonribosomal peptide synthesis Chembiochem 7,... Oberthur M & Marahiel MA (2008) Harnessing the chemical activation inherent to carrier protein-bound thioesters for the characterization of lipopeptide fatty acid tailoring enzymes J Am Chem Soc 130, 2656–2666 38 Steller S, Sokoll A, Wilde C, Bernhard F, Franke P & Vater J (2004) Initiation of surfactin biosynthesis and the role of the SrfD-thioesterase protein Biochemistry 43, 11331–11343 5354 39... Thurston L, Rich P, Miao V & Baltz RH (2006) Complementation of daptomycin dptA and Lipidation of daptomycin 21 22 23 24 25 26 27 28 29 30 31 32 dptD deletion mutations in trans and production of hybrid lipopeptide antibiotics Microbiology 152, 2993–3001 Tang Y, Koppisch AT & Khosla C (2004) The acyltransferase homologue from the initiation module of the R1128 polyketide synthase is an acyl-ACP thioesterase... Enzymatic and chemical modifications of lipopeptide antibiotic A21978C: the synthesis and evaluation of daptomycin (LY146032) J Antibiot 41, 1093–1105 11 Schwarzer D, Finking R & Marahiel MA (2003) Nonribosomal peptides: from genes to products Nat Prod Rep 20, 275–287 12 Kopp F & Marahiel MA (2007) Where chemistry meets biology: the chemoenzymatic synthesis of nonribosomal peptides and polyketides Curr Opin... metabolic diversity Curr Opin Struct Biol 17, 736–743 35 Hansen DB, Bumpus SB, Aron ZD, Kelleher NL & Walsh CT (2007) The loading module of mycosubtilin: an adenylation domain with fatty acid selectivity J Am Chem Soc 129, 6366–6367 36 Aron ZD, Fortin PD, Calderone CT & Walsh CT (2007) FenF: servicing the Mycosubtilin synthetase assembly line in trans Chembiochem 8, 613–616 37 Kopp F, Linne U, Oberthur M &... Chain initiation in the leinamycin-producing hybrid nonribosomal peptide ⁄ polyketide synthetase from Streptomyces atroolivaceus S-140 Discrete, monofunctional adenylation enzyme and peptidyl carrier protein that directly load d-alanine J Biol Chem 282, 20273–20282 Hisanaga Y, Ago H, Nakagawa N, Hamada K, Ida K, Yamamoto M, Hori T, Arii Y, Sugahara M, Kuramitsu S et al (2004) Structural basis of the. .. Stubbs MT & Marahiel MA (2007) Aminoacyl-coenzyme A synthesis catalyzed by adenylation domains FEBS Lett 581, 905–910 42 La Clair JJ, Foley TL, Schegg TR, Regan CM & Burkart MD (2004) Manipulation of carrier proteins in antibiotic biosynthesis Chem Biol 11, 195–201 43 Mootz HD, Finking R & Marahiel MA (2001) 4’-phosphopantetheine transfer in primary and secondary metabolism of Bacillus subtilis J Biol Chem... Yabe K (2008) Purification and gene cloning of a dehydrogenase from Lactobacillus brevis that catalyzes a reaction involved in aflatoxin biosynthesis Biosci Biotechnol Biochem 72, 724–734 40 Hitchman TS, Schmidt EW, Trail F, Rarick MD, Linz JE & Townsend CA (2001) Hexanoate synthase, a specialized type I fatty acid synthase in aflatoxin B1 biosynthesis Bioorg Chem 29, 293–307 41 Linne U, Schafer A, Stubbs... (2005) Natural products to drugs: daptomycin and related lipopeptide antibiotics Nat Prod Rep 22, 717–741 8 Kopp F, Grunewald J, Mahlert C & Marahiel MA (2006) Chemoenzymatic design of acidic lipopeptide hybrids: new insights into the structure–activity relationship of daptomycin and A54145 Biochemistry 45, 10474–10481 9 Counter FT, Allen NE, Fukuda DS, Hobbs JN, Ott J, Ensminger PW, Mynderse JS, Preston... the acyl-[acyl carrier protein] ligase in the Cryptosporidium parvum giant polyketide synthase Int J Parasitol 37, 307–316 Sauermann R, Rothenburger M, Graninger W & Joukhadar C (2008) Daptomycin: a review 4 years after first approval Pharmacology 81, 79–91 Li H, Melton EM, Quackenbush S, DiRusso CC & Black PN (2007) Mechanistic studies of the long chain acyl-CoA synthetase Faa1p from Saccharomyces cerevisiae . Role of DptE and DptF in the lipidation reaction of daptomycin Melanie Wittmann, Uwe Linne, Verena Pohlmann and Mohamed A. Marahiel Department of Chemistry. dptE and dptF are localized immediately upstream of the NRPSs of A21987C. The resulting proteins DptE and DptF were predicted to be involved in the lipidation