In vitro drug release mechanism from cholesteryl ester composed liquid crystalline system

In vitro drug release mechanism from cholesteryl ester composed liquid crystalline system

In vitro drug release mechanism from cholesteryl ester composed liquid crystalline system

... study has investigated the in vitro ibuprofen release profiles from a liquid crystalline system, which is composed of cholesteryl nonanoate (CNN), cholesteryl chloride (CCL) and cholesteryl oleyl ... References vi IN VITRO DRUG RELEASE MECHANISM FROM CHOLESTERYL ESTER- COMPOSED LIQUID CRYSTALLINE SYSTEM Master of Science (Pharmacy) 2009 Wu Jiao Depa...
Ngày tải lên : 09/10/2015, 11:18
  • 109
  • 274
  • 0
Tài liệu Báo cáo khoa học: Trophoblast-like human choriocarcinoma cells serve as a suitable in vitro model for selective cholesteryl ester uptake from high density lipoproteins pdf

Tài liệu Báo cáo khoa học: Trophoblast-like human choriocarcinoma cells serve as a suitable in vitro model for selective cholesteryl ester uptake from high density lipoproteins pdf

... the early trophoblast of the attachment phase or as later invasive stage [46–48] Thus, in most cases, choriocarcinoma has the appearance of trophoblast, being predominantly syncytiotrophoblastic ... cytotrophoblastic Some cytotrophoblastic choriocarcinomas secrete little human chorionic gonadotropin and some choriocarcinomas also secrete human placental lactogen [22–27] A number o...
Ngày tải lên : 20/02/2014, 23:20
  • 12
  • 470
  • 0
Báo cáo khoa học: Modulation of nitric oxide-mediated metal release from metallothionein by the redox state of glutathione in vitro doc

Báo cáo khoa học: Modulation of nitric oxide-mediated metal release from metallothionein by the redox state of glutathione in vitro doc

... tighter binding of cadmium than zinc in metallothioneins and the preference of zinc in the more flexible b-domain In addition to the already described differences in flexibility of the b-domain in MT ... reported increased metal release in the presence of oxidized glutathione (GSSG) and even slightly tighter metal binding under the in uence of reduced...
Ngày tải lên : 07/03/2014, 15:20
  • 9
  • 398
  • 0
Báo cáo khoa học: Choline increases serum insulin in rat when injected intraperitoneally and augments basal and stimulated aceylcholine release from the rat minced pancreas in vitro pptx

Báo cáo khoa học: Choline increases serum insulin in rat when injected intraperitoneally and augments basal and stimulated aceylcholine release from the rat minced pancreas in vitro pptx

... nicotinic acetylcholine receptors, prevented the choline- induced increase in serum insulin Choline increased the acetylcholine content of the pancreas, Ó FEBS 2003 Choline increases serum insulin ... acetylcholine levels in the pancreas Effect of HC-3 on choline- induced increases in acetylcholine release from the minced pancreas To determine whet...
Ngày tải lên : 17/03/2014, 09:20
  • 9
  • 338
  • 0
in vitro release of ketoprofen from proprietary and extemporaneously manufactured gels

in vitro release of ketoprofen from proprietary and extemporaneously manufactured gels

... loading concentration and solvent composition on the in vitro release of ketoprofen To compare and contrast the in vitro release rates of ketoprofen from proprietary gel products and extemporaneously ... Structure of ketoprofen 36 Stereochemistry of ketoprofen 37 Synthesis of ketoprofen starting from (3-carboxy-phenyl)-2-propionitrile .39 Synthes...
Ngày tải lên : 13/04/2014, 09:25
  • 222
  • 693
  • 0
Báo cáo y học: "Cyclooxygenase inhibition lowers prostaglandin E2 release from articular cartilage and reduces apoptosis but not proteoglycan degradation following an impact load in vitro" ppt

Báo cáo y học: "Cyclooxygenase inhibition lowers prostaglandin E2 release from articular cartilage and reduces apoptosis but not proteoglycan degradation following an impact load in vitro" ppt

... glycosaminoglycans into the culture medium following an impact load on articular cartilage explants Explants of human articular cartilage medium following an impact load on articular cartilage explants were impact ... the prostanoid may have a role in the increased apoptosis observed following trauma In an attempt to understand the physical and bioche...
Ngày tải lên : 09/08/2014, 10:22
  • 10
  • 241
  • 0
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx

Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx

... GTGATTCATGGTGGAAATACGCCCCCATCAGGGGGCTGG TTTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGCAGCCTCCAGGA CCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTTTT AAAAACCGGTTCCGCAGACCACTATGGCTCTCCCGGGAGGGGGGG TCCTGGAGGCTGCGCCCCCATCAGGGGGCTGGCGCGGCCGCAAAA ... GCCAGCCCCCTGATGGGGGCGA TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT GCCAGACACTCCACCATGAATCACTCCCCTGTGAGGAACTACTGTCTTCACG TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT TTTGCGGCCGCG...
Ngày tải lên : 20/02/2014, 01:20
  • 15
  • 597
  • 0
Tài liệu Báo cáo khoa học: A single amino acid substitution of Leu130Ile in snake DNases I contributes to the acquisition of thermal stability A clue to the molecular evolutionary mechanism from cold-blooded to warm-blooded vertebrates docx

Tài liệu Báo cáo khoa học: A single amino acid substitution of Leu130Ile in snake DNases I contributes to the acquisition of thermal stability A clue to the molecular evolutionary mechanism from cold-blooded to warm-blooded vertebrates docx

... substitution mutant snake DNases I The thermal stabilities of the wild-type and mutant enzymes of the snakes were examined by measuring the activities remaining after incubation for 40 at various ... mechanism of generating a thermally stable enzyme form from a thermally unstable one: frog, toad and newt DNases I all have a Ser205 insertion in a domai...
Ngày tải lên : 20/02/2014, 23:20
  • 8
  • 500
  • 0
Báo cáo Y học: A Ca2+/CaM-dependent kinase from pea is stress regulated and in vitro phosphorylates a protein that binds to AtCaM5 promoter ppt

Báo cáo Y học: A Ca2+/CaM-dependent kinase from pea is stress regulated and in vitro phosphorylates a protein that binds to AtCaM5 promoter ppt

... 5¢-CAAGGACGTTCGATGCA CTTCCAAAAAACATATAAT-3¢; Oligo II, 5¢-CAAT GTAGTATTAAAAAGTAGTAGTTAAAAGC-3¢; Oligo III, 5¢-GTTTTTATCCGATGCAAATTTTTGCTTTGT GATTG-3¢ The reaction was performed in 20 lL DNA-binding ... PsCCaMK suggesting that this kinase is not a general stress- regulated kinase but may specifically be involved in a signaling pathway associated with salinity and low temper...
Ngày tải lên : 18/03/2014, 01:20
  • 12
  • 365
  • 0
Báo cáo khoa học: The mitochondrial permeability transition from in vitro artifact to disease target ppt

Báo cáo khoa học: The mitochondrial permeability transition from in vitro artifact to disease target ppt

... [157,158] In these cells, PBR promotes the transport of cholesterol into the mitochondrial matrix, a rate-limiting step in steroid synthesis [159] The PBR also binds some porphyrins, including protoporphyrin ... mitochondria have demonstrated that the effect of these drugs in The mitochondrial permeability transition promoting the opening of the PTP, and of apoptos...
Ngày tải lên : 30/03/2014, 11:20
  • 23
  • 345
  • 0
Báo cáo " Isomeranzin against Herpes simplex virus in vitro from Clausena heptaphylla (Roxb.) W. & ARN.: Isolation, structure and biological assay " potx

Báo cáo " Isomeranzin against Herpes simplex virus in vitro from Clausena heptaphylla (Roxb.) W. & ARN.: Isolation, structure and biological assay " potx

... compound in 10% ethanol) or ml of saline (for virus control and cell control) and given ml 2x MEM The cells were incubated for 72 hours and observed for cytopathic effects from the virus and cytotoxic ... trace chemicals remaining from the extraction process, or from the compound itself is uncertain When the compound was dissolved in ethyl acetate, it was effective agai...
Ngày tải lên : 03/04/2014, 15:20
  • 6
  • 384
  • 0
báo cáo hóa học:" Stem cells from umbilical cord blood do have myogenic potential, with and without differentiation induction in vitro" pdf

báo cáo hóa học:" Stem cells from umbilical cord blood do have myogenic potential, with and without differentiation induction in vitro" pdf

... http://www.translational-medicine.com/content/7/1/6 Materials and methods Isolation and characterization of human CD34+ cells from the umbilical cord blood CD34+ stem cells from human umbilical cord were obtained from ... cells were washed in PBS 1× and cultured protected from light Stained stem cells were used in co-cultures of DMD muscle cells and...
Ngày tải lên : 18/06/2014, 15:20
  • 9
  • 551
  • 0

Xem thêm