In vitro and in vivo study of vitamin e TPGs coated immunoliposomes for sustained and targeted delivery of docetaxel
In vitro and in vivo study of vitamin e TPGs coated immunoliposomes for sustained and targeted delivery of docetaxel
... the herceptin conjugated liposomes Thus the herceptin conjugated Vitamin E TPGS coated liposomes showed greater potential for sustained and targeted chemotherapy in the treatment of HER2 over expressing ... have been discovered and developed since the past few decades Together with the problems faced in traditional ways in which cancer patients are treated, this regimen has even become more and ... formulations were provided Then, Chapter presents the preparation and characterization vitamin E TPGS coated and herceptin conjugated liposomes The liposomes were prepared by solvent injection method and...
- 121
- 326
- 0
In vitro and in vivo study of ABT 869 in treatment acute myeloid leukemia (AML) alone or in combination with chemotherapy or HDAC inhibitors insight into molecular mechanism and biologic characterization
... In vitro and In vivo study of ABT- 869 in treatment acute myeloid leukemia (AML) alone or in combination with chemotherapy or HDAC inhibitors: insight into molecular mechanism and biologic characterization ... target of STAT3 3.3.9 In vivo efficacy of IDR E804 in combination with ABT- 869 for treatment of MV4-11-R mouse xenografts 69 Discussion 73 References 78 Chapter The combination of HDAC Inhibitors and ... CalcuSyn software for (A) simultaneous combination of ABT- 869 with Ara-C, (B) simultaneous combination of ABT- 869 and Dox , (C) pretreatment with ABT- 869 first followed by Ara-C, (D) pretreatment with...
- 121
- 368
- 0
Vitamin e TPGS based nanomedicine for multimodality treatment of cancer
... treatment Therefore, we propose the nanomedicine for multimodality treatment of cancer The concept and property of nanomedicine for multimodality treatment of cancer are illustrated in Figure ... nanomedicine for multimodality treatment of cancer? 38 2.4.3 Examples of nanomedicine for multimodality treatment of cancer 41 2.5 Approaches of nanomedicine for multimodality treatment of cancer ... multimodality treatment, and the current results of nanomedicine for multimodality treatment of cancer Chapter represents the design and synthesis of TPGS2 k micelles for docetaxel delivery The result...
- 249
- 413
- 0
Báo cáo khoa học: "Comparative study on the in vitro and in vivo properties of two bovine herpesvirus-5 reference strains" pptx
... point, a direct comparison of the pathogenecity of these strains is difficult to make In this context, the aim of the present study is to compare the in vitro and in vivo properties of these two ... to the sensitivity of the ELISA test available In the case of animal 191, as discussed above, the reason could have been the lack of infection Page of Conclusions The in vitro and in vivo properties ... Comparative study on the in vitro and in vivo properties of two bovine herpesvirus-5 reference strains Acta Veterinaria Scandinavica 2011 53:37 Submit your next manuscript to BioMed Central and take...
- 8
- 366
- 0
Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc
... amplification with primers 5¢-GCGGAGCTCATGGCCAC AAGCGCATCAGC-3¢ and 5¢-GTGGTGGTGGTGGTGG TGGAAATGGGTTTTTCCGTTCTGC-3¢ (His-tag underlined) or 5¢-TGGAGCCACCCGCAGTTCGAAAAAGAA GCTGGAGATGATCGTGCT-3¢ (Strep-tag ... template Primers were designed as follows: PSAG with a C-terminal hexa-histidine tag (PSI -G- HisTerm), 5¢-GCGGAGCTCAT GGCCACAAGCGCATCAGC-3¢ and 5¢-GCGGCATGCT CAGTGGTGGTGGTGGTGGTGTCCAAAGAAGCTTG GGTCGTAT-3¢ ... shielded from trypsin digestion on the cis-side of the membrane The A B 4004 Fig Determination of the topology of PSI -G in the thylakoid membrane using in vitro import experiments (A) Insertion...
- 9
- 422
- 0
Báo cáo khoa học: In vivo studies of altered expression patterns of p53 and proliferative control genes in chronic vitamin A deficiency and hypervitaminosis pot
... procedures A single band of about 53 kDa was detected in liver and lung indicating that the amount of p53 protein was significantly increased in the liver and lung from vitamin A- deficient rats that in controls ... provides a mechanism that cult parturition in the rat as a result of vitamin A deficiency Am J Anat 57, 303–349 may explain in part the regulation of control of proliferative Ó FEBS 2003 Vitamin A status ... analysis of c-jun, p53 and p21WAF1/CIF1 in liver and lung of control, chronic vitamin A- deficiency and hypervitaminosis rats Based on the results found in the differential display study and taking...
- 9
- 508
- 0
Báo cáo khoa học: A study of microRNAs in silico and in vivo: bioimaging of microRNA biogenesis and regulation doc
... stages and the changes of these networks in disease and after application of a variety of therapeutic strategies Critically, 2172 the noninvasive imaging approach of miRNA generation and its activity ... monitoring the therapeutic potential of miRNAs in cancer Bioimaging of microRNA biogenesis The molecular mechanisms involved in miRNA generation are complex, and at least several processing steps in ... measuring the decrease of optical signal in vivo [34] Also, miRNA21 is a potential therapeutic 2170 target for cancer treatment, as overexpression of antimiRNA21 in hepatocellular carcinoma and...
- 10
- 463
- 0
Báo cáo y học: "Discrepancy between the in vitro and in vivo effects of murine mesenchymal stem cells on T-cell proliferation and collagen-induced arthritis" doc
... and cellular responses; and analysis of T-cell proliferation LG contributed to CIA induction and evaluation and to analysis of T-cell proliferation PM contributed to the design of the study and ... inhibition of T-cell proliferation was demonstrated by the addition of inhibitors of these enzymes - GW274150 and indomethacin [8,36], respectively - to the co-cultures The addition of these inhibitors ... Discrepancy between the in vitro and in vivo effects of murine mesenchymal stem cells on T-cell proliferation and collagen-induced arthritis Arthritis Research & Therapy 2010 12:R31 Submit your next manuscript...
- 11
- 464
- 0
Báo cáo y học: "In vitro and in vivo evaluation of a new active heat moisture exchange" potx
... Performer and the Hygrobac had significantly higher airway temperature and AH than did the Hygroster (Fig 5) Active Performer, regardless of the level of heating, always had a higher temperature and AH ... inspiratory flow; VT = tidal volume Statistical analysis All data are expressed as mean ± standard deviation For the in vitro study, we compared the three HMEs using a one-way analysis of variance ... evaporation In the present study we assessed the efficiency and stability of this new active moisture exchanger in delivering heat and moisture to inspired gases, as compared with widely used heat and moisture...
- 8
- 360
- 0
Báo cáo y học: " Sodium nitroprusside and peroxynitrite effect on hepatic DNases: an in vitro and in vivo study" potx
... group oxidation, carbonyl group formation, lipid peroxidation and DNA modification An assay of enzyme activity was performed using liver tissue after in vivo administration and in vitro treatment ... the reducing agent cysteine mmol) or peroxynitrite (Fig 3) The formation of 8-nitroguanine, 8-oxo-deoxyguanine and oxazolone and the oxidative modification of 2'-deoxyribose into TBA-responsive ... data concerning their in vivo tolerability and in vitro ability to induce apoptotic effects [39,40] The calculation of peroxynitrite intra-arterial concentration (6 nmol) was done according to...
- 9
- 361
- 0
In vitro and in vivo assessments of PCL TCP composites for bone tissue engineering
... bone tissue engineering for an ideal bone substitute 1.1.3 Strategies in BTE Tissue engineering is the restoration, improvement, maintenance and substitution of damaged tissues and organs using ... will be in solutions (Lakes, 2007) TCP is found naturally in the inorganic phase of bone in form of hydroxyapatite TCP is also responsible for the hardness of bone, dentine and enamel TCP exhibit ... 70-90% of minerals with the rest in the form of proteins Within the proteins in bone, the ratio of collagenous to noncollagenous stands at 9:1 This is in stark contrast with other tissues consisting...
- 94
- 546
- 0
In vitro and in vivo characterisation of recombinant lactobacilli expressing house dust mite allergen
... IN VITRO AND IN VIVO CHARACTERIZATION OF RECOMBINANT LACTOBACILLI EXPRESSING HOUSE DUST MITE ALLERGEN LIEW LEE MEI 2009 IN VITRO AND IN VIVO CHARACTERIZATION OF RECOMBINANT LACTOBACILLI EXPRESSING ... Chapter 4: The in vivo evaluation of the recombinant lactobacilli 97-133 in mouse allergy models 4.1 Introduction 97 4.2 Results 100 The immunogenicity of recombinant lactobacilli in vivo 100 4.2.1.1 ... evaluation of in vivo 101 immunogenicity of the Blo t expressed in recombinant lactobacilli Figure 4.2 Oral feeding of recombinant Lactobacillus plantarum NC8 104 induced the production of Blo t...
- 193
- 613
- 0
In vitro and in vivo evaluation of customized polycaprolactone tricalcium phosphate scaffolds for bone tissue engineering
... submitted for the degree of Master of Engineering in the Department of Mechanical Engineering at the National University of Singapore under the supervision of Professor Teoh Swee Hin and Dr Alvin Yeo ... secrete bone tissue and form the tissue around itself like a protective wall of bone tissue They are responsible for the maintenance of healthy bone by secreting enzymes and directing the bone mineral ... CHAPTER 4: OPTIMIZATION OF NATIVE AND CUSTOMIZED SCAFFOLDS IN VITRO AND THEIR EFFECTS IN INITIAL BONE HEALING 4.1 INTRODUCTION 44 4.1.1 In vitro degradation study 44 4.1.2 In vivo degradation study...
- 143
- 472
- 0
In vitro and in vivo evaluation of transferrin conjugated lipid shell and polymer core nanoparticles for targeted delivery of docetaxel
... IN VITRO AND IN VIVO EVALUATION OF TRANSFERRIN- CONJUGATED LIPID SHELL AND POLYMER CORE NANOPARTICLES FOR TARGETED DELIVERY OF DOCETAXEL PHYO WAI MIN (M.B.,B.S (YGN) U.M(1)) ... the synthesis and characterization of transferrin conjugated lipid shell and polymer core nanoparticles are discussed in Chapter In Chapter 5, in vitro cellular study of transferrin conjugated LPNPs ... Organization In this thesis, formulations of lipid shell and polymer core nanoparticles are developed for the clinical administration of docetaxel At the same time, the effect of different lipids used in...
- 129
- 286
- 0
In vitro and in vivo investigation of nanoparticles of a novel copolymer for substained and controlled delivery of docetaxel
... IN VITRO AND IN VIVO INVESTIGATION OF NANOPARTICLES OF A NOVEL BIODEGRADABLE COPOLYMER FOR SUSTAINED AND CONTROLLED DELIVERY OF DOCETAXEL GAN CHEE WEE (B.Eng (Hons.), NUS) A THESIS SUBMITTED ... many anticancer drugs, including docetaxel, by internalization mechanism of drug-loaded nanoparticles such as endocytic process (Panyam and Labhasetwar, 2003; Bareford and Swaan, 2007) Meanwhile, ... potential biomedical applications, including formulation of imaging agents for cellular and molecular imaging and targeted drug therapy (Zhang et al., 2007; Pan and Feng, 2009) 1.2 Objectives and...
- 163
- 932
- 0
Từ khóa: in vivo and in vitro applications to the study of enzymin vitro and in vivo analysis of the cellan in vivo study evaluating the relationship between bmd and screw loosening loss of correction and nonunion in plif in the osteoporotic spinein vitro and in vivo degradation of phytateapos apos 8p specific apos apos microarrays two novel metastatic suppressors were identified and proved to suppress in vitro invasion and in vivo metastasis of hccin vitro in vivo extrapolation of drug diffusion velocity and p gp efflux rate parameterslearning and acquisition in the study of vocabularygenomics gene arrays and proteomics in the study of liver diseasesome developments in the study of market choice public choice and institutional choicea disease model in the study of vascular development aberrant vasculogenesis and angiogenesisapplications and use in the study of protein kinases and phosphatasesoverexpression purification and in vivo reconstitution of hexahistidine tagged wild type and b d186 433 coran in vivo study evaluating the relationship between the insertional torque bmd and screw loosening in plifsearching for in vivo traces of mesenchymal stem cells and their ancestorsex vivo and in vivo effects of pnaBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhThơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ