Genes involved in colon cancer development and progression

... understanding of the underlying basic mechanisms involved Section 1.4 will provide greater insights into understanding the physiological steps involved in metastasis A surprisingly small number of genes ... steps, which results in the development of colon cancer The remaining 15% of colon cancer cases not involve APC mutation and are often found to have activating mutati...

Ngày tải lên: 07/10/2015, 10:02

... LRF/FBI-1 initially downregulates COMP and collagen type II in human OA, which in turn enhances the matrix breakdown and thereby increasing the mechanical load of the diseased tissue, this mechanical ... detection of cartilage oligomeric protein (COMP) and its mRNA (a) Staining for COMP is seen in the interterritorial matrix of the superficial and mid...

Ngày tải lên: 09/08/2014, 07:20

... used for microarray transcriptome analyses in order to identify genes possibly involved in seed-pericarp cross-talk or useful as organ and developmental phase molecular markers Data obtained from ... negligible during late development ABA is known to play an antagonistic role with respect to auxin, GAs and CKs, as observed during fruit development in avocado [4...

Ngày tải lên: 11/08/2014, 11:21

... / transcription factor ANAC019 (Arabidopsis NAC domain containing protein 19); transcription factor ANAC012/NST3/SND1 (ARABIDOPSIS NAC DOMAIN CONTAINING PROTEIN 12); transcription factor Zinc ... SND2, a NAC transcription factor gene, regulates genes involved in secondary cell wall development in Arabidopsis fibres and increases fibre c...

Ngày tải lên: 11/08/2014, 11:21

... ethanol- regulated genes were involved using KEGG (Kyoto Encyclopedia of Genes and Genomes) [36] and GenMAPP (Gene Microarray Pathway Profiler) [37] analysis As shown in Table 2, only ITGB4 was found to be involved ... considering the reported high expression of the ankyrin-repeat oncoprotein (gankyrin) in human hepatocellular carcinoma Gankyrin binds to the cell-...

Ngày tải lên: 31/10/2012, 15:28

... seen in the putative T-box DNA-binding domain of t-bet, the STAT protein interaction domain, STAT protein all-alpha domain, STAT protein DNA-binding domain and SH2 domain of stat6, and the zinc-finger ... implicated in other protein–protein interactions, a STAT protein DNA-binding domain and an SH2 domain, which binds phosphorylated tyrosine residues in the context...

Ngày tải lên: 16/02/2014, 09:20

... devoid of a given essential amino acid Our data suggest that the GCN2 pathway is directly involved in the regulation of amino acid and protein metabolism, as many of the genes involved in these processes ... their biological processes reveals that amino acid limitation regulates groups of genes that are involved in amino acid and pro...

Ngày tải lên: 07/03/2014, 03:20

... suggests that the vacuole content may include mucin 3, which may play a protective role In summary, the data reveal that IxoA shows potent antiproliferative and apoptosis activity in human colon cancer ... To investigate the effects of IxoA on apoptosis, we 5720 used acridine orange ⁄ ethidium bromide staining and DAPI staining and found a marked increase in...

Ngày tải lên: 23/03/2014, 10:20

... set of genes involved in a cyclic process and the set of noncycle -involved genes recognized in biological experiments The cycle -involved genes are used to initialize the proposed algorithm, and ... as Algorithm Lines to accept inputs and initialize the target cyclic gene set with the spectral analysis results and the prior cycle -involved genes Inside them...

Ngày tải lên: 22/06/2014, 00:20

... (11.9%), in ascending colon of 14 patients (15.2%), in transverse colon of subjects (8.7%), in hepatic flexure of patients (8.7%), in splenic flexure of patients (7.6%), in descending colon of 10 ... resection and type of operation are important prognostic factors In a recent Table 2: Results of multivariate analysis of clinical and laboratory data...

Ngày tải lên: 09/08/2014, 07:21

... this article as: Li et al.: High levels of nucleotide diversity and fast decline of linkage disequilibrium in rye (Secale cereale L.) genes involved in frost response BMC Plant Biology 2011 11:6 ... region; I: intron Failure of amplification in some of the lines may be due to the presence of SNPs/Indels in the binding sites of the sequence...

Ngày tải lên: 11/08/2014, 11:21

... and PGB04 (AACAAATTTACTCATTTA CCCGTGA, CCCATCAAAATCCATGCCCAAG, TTCCAAGTTCTTGTGGGAGGAG, GACTGATTTTCTCTCCACCAAGCAAG) Sequence analysis Repetitive DNA was identified with the RepeatMasker software ... on the BAC scaffolds of PGB02 (3CAR) (ACCCATCTTCACAAAATTAC, GTAGTCCATAACGAGCAGAA) and PGB04 (CYP720B4) (TGATATTTGGTCTGCCATGGGCG, CATTTCCCTGCATGTATTCAATGCC, CCACCACATAGTTAGACCGTGATGC) Auth...

Ngày tải lên: 12/08/2014, 03:21

... article as: Haseneyer et al.: DNA polymorphisms and haplotype patterns of transcription factors involved in barley endosperm development are associated with key agronomic traits BMC Plant Biology ... Carbonero P: An endospermspecific DOF protein from barley, highly conserved in wheat, binds to and activates transcription from the prolamin-box of a...

Ngày tải lên: 12/08/2014, 03:21

... acid, and camptothecin levels in Camptotheca acuminata seedlings Physiol Plant 1999, 105:402-408 27 Liu Z: Drought-induced in vivo synthesis of camptothecin in Camptotheca acuminata seedlings ... Sites of accumulation of the anti-tumor alkaloid camptothecin in Camptotheca acuminata Planta Med 1994, 60:558-560 12 Liu Z, Adams J: Camptothecin yield and dist...

Ngày tải lên: 12/08/2014, 03:21

... first work studying concerted gene expression of sunflower in response to salinity, allowing the identification of genes involved in common regulatory mechanisms to both Page 11 of 18 (page number ... by salt stress per se In another study the expression of 150 genes in response to wounding and insect feeding was carried out [58], finding that some of the...

Ngày tải lên: 12/08/2014, 05:20