genes involved in early brain development

Genes involved in colon cancer development and progression

Genes involved in colon cancer development and progression

... well defined, there remains a poor understanding of the underlying basic mechanisms involved Section 1.4 will provide greater insights into understanding the physiological steps involved in metastasis ... category Integrins act as a relay machine by transmitting extracellular signals into activation of intracellular signaling processes Integrins are able to bind to many ECM molecules, causing the ... examples of the scoring performed on HDACs and staining Grade is defined as negative staining of the nucleus, while grades to represent increasing intensity of nuclear staining The upper panel...

Ngày tải lên: 07/10/2015, 10:02

80 115 0
báo cáo khoa học: "A microarray approach to identify genes involved in seed-pericarp cross-talk and development in peach" ppt

báo cáo khoa học: "A microarray approach to identify genes involved in seed-pericarp cross-talk and development in peach" ppt

... to early embryo development, being expressed in the endosperm and secreted in the apoplast, thus positively regulating embryo fate and patterning [17] It is interesting to note that in cv Springcrest, ... other signaling molecules, playing either direct or indirect roles Concerning hormones, parthenocarpic fruit development in some species is induced by applications of auxin or cytokinins (CKs), ... higher in mesocarp than in seed (see also Figure 3), thus suggesting a higher auxin level in EM than in ES [28,29] The main process regulated by CKs is cell division, occurring at early development...

Ngày tải lên: 11/08/2014, 11:21

14 204 0
báo cáo khoa học: "SND2, a NAC transcription factor gene, regulates genes involved in secondary cell wall development in Arabidopsis fibres and increases fibre cell area in Eucalyptus" doc

báo cáo khoa học: "SND2, a NAC transcription factor gene, regulates genes involved in secondary cell wall development in Arabidopsis fibres and increases fibre cell area in Eucalyptus" doc

... protein 2) Protein kinase family protein IQD10 (IQ-domain 10); calmodulin binding RIC2 (ROP-INTERACTIVE CRIB MOTIF-CONTAINING PROTEIN 2) Protein kinase family protein Rho GTPase activating protein, ... domain-containing protein / MATH domain-containing protein Nodulin MtN3 family protein GCN5-related N-acetyltransferase (GNAT) family protein Hydroxyproline-rich glycoprotein family protein Unknown ... Glycine-rich protein GLP10 (GERMIN-LIKE PROTEIN 10); manganese ion binding / metal ion binding / nutrient reservoir AGP4 (ARABINOGALACTAN-PROTEIN 4) FLA15 (FASCICLIN-LIKE ARABINOGALACTAN PROTEIN...

Ngày tải lên: 11/08/2014, 11:21

51 445 0
the regulation of genes involved in trichome development

the regulation of genes involved in trichome development

... calmodulin-binding kinesin-like motor protein (Oppenheimer et al., 1997) ZWI interacts with two other proteins involved with trichome branching: ANGUSTAFOLIA and KCBP-interacting Ca2+ binding protein ... neighboring cells, where it would interact preferentially with the bHLH dimer, preventing expression of genes involved in trichome development TTG would act in the cytoplasm most probably aiding in ... epidermal cell fate determination by interactions between proteins involved in trichome patterning A combination of a MYB protein (either GL1 or MYB23) with a bHLH dimer (any combination of GL3 or EGL3)...

Ngày tải lên: 14/11/2014, 11:55

186 167 0
the regulation of genes involved in trichome development(fileminimizer)

the regulation of genes involved in trichome development(fileminimizer)

... calmodulin-binding kinesin-like motor protein (Oppenheimer et al., 1997) ZWI interacts with two other proteins involved with trichome branching: ANGUSTAFOLIA and KCBP-interacting Ca2+ binding protein ... neighboring cells, where it would interact preferentially with the bHLH dimer, preventing expression of genes involved in trichome development TTG would act in the cytoplasm most probably aiding in ... epidermal cell fate determination by interactions between proteins involved in trichome patterning A combination of a MYB protein (either GL1 or MYB23) with a bHLH dimer (any combination of GL3 or EGL3)...

Ngày tải lên: 14/11/2014, 12:16

186 210 0
Báo cáo y học: "Functional genomics analysis of low concentration of ethanol in human hepatocellular carcinoma (HepG2) cells. Role of genes involved in transcriptional and translational processes"

Báo cáo y học: "Functional genomics analysis of low concentration of ethanol in human hepatocellular carcinoma (HepG2) cells. Role of genes involved in transcriptional and translational processes"

... NM_014393 ▲ 1.52 regulation of transcription protein binding double-stranded RNA binding DNA binding ▼ 5.02 protein binding NM_001149 NM_004242 ▲- increased ▼- decreased Validation of microarray ... ethanol-induced expression and activation of cytokines and chemokines in monocytes and macrophages (including Kupffer cells) [41, 42], and ethanol-induced mucosal injury in the upper gastrointestinal ... of genes involved in transcriptional and translational processes Integrins act as signal transducing molecules trough mitogen-activated protein (MAP) kinase like extracellular-regulated kinase...

Ngày tải lên: 31/10/2012, 15:28

8 703 0
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

... adjacent DNA-binding sites, a coiled-coil STAT protein all-alpha domain, which is implicated in other protein–protein interactions, a STAT protein DNA-binding domain and an SH2 domain, which binds phosphorylated ... STAT protein all-alpha domain, STAT protein DNA-binding domain and SH2 domain of stat6, and the zinc-finger domain, leucine-zipper domain and fork-head domain of foxp3 In addition, for stat6 and ... CTCGAGATCGATGCGGCCGC Initial PCR Initial PCR Initial PCR Initial PCR 3¢-RACE 3¢-RACE 5¢-RACE 5¢-RACE 3¢-RACE 3¢-RACE Initial PCR Initial PCR 3¢-RACE 3¢-RACE 5¢-RACE 5¢-RACE Initial PCR Initial PCR Initial PCR Initial...

Ngày tải lên: 16/02/2014, 09:20

20 690 0
Tài liệu Báo cáo Y học: Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf

Tài liệu Báo cáo Y học: Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf

... transcription terminator The resulting fragment only contains the initial 67 bp and the final 68 bp of the pur4 coding sequence It was inserted in plasmid pGM9 The resulting construct was introduced, ... expected that genes involved in A201A biosynthesis in S capreolus are also clustered with those encoding resistance conforming a hereafter named ata (for A two zero one A) cluster In this respect, ... Chemical structure of A201A and puromycin In actinomycetes, it is well established that genes implicated in antibiotic biosynthesis, including those encoding self-resistance, are clustered [10,11]...

Ngày tải lên: 21/02/2014, 01:21

9 728 0
Báo cáo khoa học: Amino acid limitation regulates the expression of genes involved in several specific biological processes through GCN2-dependent and GCN2-independent pathways ppt

Báo cáo khoa học: Amino acid limitation regulates the expression of genes involved in several specific biological processes through GCN2-dependent and GCN2-independent pathways ppt

... described for the amino acid-dependent regulation of several genes, including Chop, Atf3, Cat-1 and insulinlike growth factor binding protein (Igfbp1), making it possible that amino acid availability ... is directly involved in the regulation of amino acid and protein metabolism, as many of the genes involved in these processes are not regulated in GCN2) ⁄ ) cells These results are in good agreement ... regulatory mechanisms are involved Our results clearly show that GCN2 is involved in this process, at least for a certain set of genes The simplest hypothesis to explain the role of this pathway...

Ngày tải lên: 07/03/2014, 03:20

12 561 0
Báo cáo hóa học: " Research Article Identifying Genes Involved in Cyclic Processes by Combining Gene Expression Analysis and Prior Knowledge" pot

Báo cáo hóa học: " Research Article Identifying Genes Involved in Cyclic Processes by Combining Gene Expression Analysis and Prior Knowledge" pot

... sets, that is, the set of genes involved in a cyclic process and the set of noncycle -involved genes recognized in biological experiments The cycle -involved genes are used to initialize the proposed ... proteins or are involved in ribosome biogenesis It has been verified that ribosome biogenesis consumes up to 80% of proliferating energy, and it is linked to cell cycle in metazoan cells However, in ... In other words, cell wall proteins are highly likely to be involved in the cell 725 genes identified by the proposed algorithm 800 genes identified by Spellman et al 400 periodic genes used in...

Ngày tải lên: 22/06/2014, 00:20

9 253 0
Báo cáo y học: "Cartilage oligomeric matrix protein is involved in human limb development and in the pathogenesis of osteoarthriti" pptx

Báo cáo y học: "Cartilage oligomeric matrix protein is involved in human limb development and in the pathogenesis of osteoarthriti" pptx

... reducing and denaturing conditions Protein separation was performed applying SDS-PAGE and using systems containing 6% acrylamide in stacking gels and 12% in the separation gel Tris-glycine was ... protease inhibitors NEM (N-ethylmaleimide), EDTA, benzamidine hydrochloride, and amino caproic acid, precipitated in ethanol, washed in PBS, precipitated again, and finally dissolved in PBS containing ... developing joint space The arrowhead indicates the area from which the high-magnification micrograph was taken (inset) The arrowhead in the inset indicates COMP staining (f) At gw 12, COMP staining is...

Ngày tải lên: 09/08/2014, 07:20

10 480 0
báo cáo khoa học: "Prospecting for Genes involved in transcriptional regulation of plant defenses, a bioinformatics approach" pdf

báo cáo khoa học: "Prospecting for Genes involved in transcriptional regulation of plant defenses, a bioinformatics approach" pdf

... of SA and induction of JA defense genes; yellow boxes, genes involved in JA biosynthesis; light blue boxes, genes involved in ET biosynthesis; pink boxes, genes involved in ET signaling van Verk ... coexpression analysis Examples are: genes involved in root development [22], genes involved in mitochondrial functions [23], clusters of genes involved in primary and secondary cell wall formation ... the pink and green dot almost in the middle of the network), are in between the super cluster with the genes encoding proteins involved in SA signaling (red dots), Flg22-initiated MAPK kinase...

Ngày tải lên: 11/08/2014, 11:20

12 331 0
báo cáo khoa học: " High levels of nucleotide diversity and fast decline of linkage disequilibrium in rye (Secale cereale L.) genes involved in frost response" doc

báo cáo khoa học: " High levels of nucleotide diversity and fast decline of linkage disequilibrium in rye (Secale cereale L.) genes involved in frost response" doc

... Responsive (COR) genes through binding to cis-elements in the promoters of COR genes under cold stress in Arabidopsis [12] More than 70 proteins encoded by COR genes are involved in direct response ... lines differed from gene to gene ranging from 128 lines (64%) in ScCbf11 to 198 (98%) in ScVrn1 Missing amplification products in individual lines were most likely the result of SNPs/Indels in ... are significantly higher in lines harbouring the vrn1 winter allele than in lines harbouring the Vrn1 spring allele [19] It remains unknown how the Cbf family members interact with Vrn1 under...

Ngày tải lên: 11/08/2014, 11:21

14 313 0
báo cáo khoa học:" The role of apoptosis in early embryonic development of the adenohypophysis in rats" ppsx

báo cáo khoa học:" The role of apoptosis in early embryonic development of the adenohypophysis in rats" ppsx

... open and not yet completely closed The developmental stage outlined here is in agreement with Keibel's (1937) findings [8], however, in his experiments involving Rattus norwegicus Erxleben this ... activity was not found in the remaining areas of the developing adenohypophysis H&Emarginal with basallysection (4 μm) through adenophaFigure nohypophysis, 10× and staining of paraffin located S = stomatodeum, ... Defects in apoptosis cause or contribute to developmental malformation, cancer, and degenerative disorders Apoptosis can be induced in response to many external stimuli (extrinsic pathway) including...

Ngày tải lên: 12/08/2014, 01:22

5 299 0
báo cáo khoa học: " Targeted isolation, sequence assembly and characterization of two white spruce (Picea glauca) BAC clones for terpenoid synthase and cytochrome P450 genes involved in conifer defence reveal insights into a conifer genome" pdf

báo cáo khoa học: " Targeted isolation, sequence assembly and characterization of two white spruce (Picea glauca) BAC clones for terpenoid synthase and cytochrome P450 genes involved in conifer defence reveal insights into a conifer genome" pdf

... containing genes of interest involved in conifer defence First, many conifer defence genes exist as closely related members of large families For example, genes encoding the oleoresin producing ... binding site analysis In addition, several cis-acting elements previously identified in other plant species to be involved in responses to giberellin (GARE, TAACAGA; Pbox; GCCTTTTGAGT), auxin ... in defence and stress responsivenes (Nicotiana tabacum); TCA, cis-acting element involved in salicylic acid responsiveness (Brassica oleracea); TGACG, cis-acting regulatory element involved in...

Ngày tải lên: 12/08/2014, 03:21

13 329 0
báo cáo khoa học: " DNA polymorphisms and haplotype patterns of transcription factors involved in barley endosperm development are associated with key agronomic traits" pot

báo cáo khoa học: " DNA polymorphisms and haplotype patterns of transcription factors involved in barley endosperm development are associated with key agronomic traits" pot

... conserved cis-acting element, which contains two distinct protein binding sites: the prolamin-box (PB) and the GCN4-like motif (GLM) Four transcription factors (TFs) are the gibberellin-regulated ... (GAMYB), the barley leucine zippers and (BLZ1, BLZ2), and the barley prolamin box binding factor Page of 11 (BPBF) that were shown to be involved in the transcription of B-hordeins encoded by the ... protein specifically binds to the GLM [12] As indicated by its designation, the BPBF has been shown to activate hordein genes through binding to the PB [13,14] Transient expression experiments in...

Ngày tải lên: 12/08/2014, 03:21

11 724 0
báo cáo khoa học: " Cell-specific expression of tryptophan decarboxylase and 10-hydroxygeraniol oxidoreductase, key genes involved in camptothecin biosynthesis in Camptotheca acuminata Decne (Nyssaceae)" ppt

báo cáo khoa học: " Cell-specific expression of tryptophan decarboxylase and 10-hydroxygeraniol oxidoreductase, key genes involved in camptothecin biosynthesis in Camptotheca acuminata Decne (Nyssaceae)" ppt

... expression of genes involved in their biosynthetic pathway In C roseus, RNA in situ hybridization combined with immunocytolocalization techniques has demonstrated that the genes involved in the early ... and camptothecin levels in Camptotheca acuminata seedlings Physiol Plant 1999, 105:402-408 27 Liu Z: Drought-induced in vivo synthesis of camptothecin in Camptotheca acuminata seedlings Physiol ... http://www.biomedcentral.com/1471-2229/10/69 vindoline biosynthesis (TDC and STR1) are expressed in the epidermis of the stem, leaf, and flower bud, and in the apical meristem of the root tip, whereas the genes involved in the terminal...

Ngày tải lên: 12/08/2014, 03:21

10 197 0
báo cáo khoa học: " Transcriptomic identification of candidate genes involved in sunflower responses to chilling and salt stresses based on cDNA microarray analysis" pps

báo cáo khoa học: " Transcriptomic identification of candidate genes involved in sunflower responses to chilling and salt stresses based on cDNA microarray analysis" pps

... expression of 150 genes in response to wounding and insect feeding was carried out [58], finding that some of the responding genes, for which the inducing stimulus was unclear in these processes, ... stresses in sunflower Among them, many genes potentially encoding components involved in photosynthesis, such as photosystem proteins, chlorophyllbinding proteins, Rubisco and light harvesting proteins ... http://www.biomedcentral.com/1471-2229/8/11 elements binding proteins) TFs While cis elements in cold response genes bind DREB1/CBF TFs, regulatory regions of drought response genes bind TFs belonging to DREB type protein [5,31-33]...

Ngày tải lên: 12/08/2014, 05:20

18 493 0
Báo cáo y học: " Transcriptome profiling of primary murine monocytes, lung macrophages and lung dendritic cells reveals a distinct expression of genes involved in cell trafficking" pot

Báo cáo y học: " Transcriptome profiling of primary murine monocytes, lung macrophages and lung dendritic cells reveals a distinct expression of genes involved in cell trafficking" pot

... Il18r1 interleukin alpha [NM_010554] interleukin [NM_031168] interleukin 18 [NM_008360] interleukin 17D [NM_145837] interleukin beta [NM_008361] interleukin 11 receptor, alpha chain [NM_010549] interleukin ... grouped into trafficking related clusters such as integrins, Mmps, chemokine and chemokine receptors, and interleukins and interleukin receptors Integrins are key mediators of cell-cell interactions, ... PBMo GR-1low iM rAM DC Integrin M (CD11b) Integrin (CD49d) Integrin (CD61) Integrin Integrin E (CD103) Figure 11 of the expression pattern of differentially regulated integrins with flow cytometry...

Ngày tải lên: 12/08/2014, 14:20

16 320 0
Báo cáo y học: " Expression profiling identifies genes involved in emphysema severity" ppsx

Báo cáo y học: " Expression profiling identifies genes involved in emphysema severity" ppsx

... candidate genes Ingenuity Pathway Analysis (IPA) on the seven validated candidate genes Bold lines indicates direct link, dotted lines indicate indirect link Grey nodes indicate input genes into the ... and SERPINF1, are concordantly increased in three different studies It is highly likely that pathways rather than single genes are involved in progression of emphysema, mandating further investigation ... these genes could be involved, such as cell cycle checkpoint, p53 signaling, IGF-1 signaling, NRF2 mediated oxidative stress, Wnt/Catenin signaling and others (see Additional file 6) The genes...

Ngày tải lên: 12/08/2014, 14:20

10 251 0
w