... of N data points to be clustered The local maximum of a data point i is the data point whose magnitude is the maximum among all the data points within a certain distance from the data point i ... the clustering results of different methods The letters L, H, K, and S stand for the LMC method, the hierarchic clustering method, the K-mean clustering...
Ngày tải lên: 23/06/2014, 01:20
... expression analysis, supervised data mining methods include class association rule mining and classification while unsupervised data mining methods mainly refer to the various clustering methods ... biological information from the huge and fast-growing gene expression data Essentially, data mining methods can be divided into two big categories: supervised and unsupervise...
Ngày tải lên: 15/09/2015, 17:09
Gene expression data analysis
... 3.3.2 32 Missing Data Estimation for Gene Microarray Expression Data Gene expression microarray experiment can generate data sets with multiple missing expression values [TCS+ 01] Two data sets we ... 33 biological area, including gene expression data analysis and protein classification According to [Aas01], let y ˜ be the gene expression vector to be the gene...
Ngày tải lên: 07/10/2015, 09:55
Báo cáo hóa học: " Research Article The Wavelet-Based Cluster Analysis for Temporal Gene Expression Data" pptx
... the localized high-frequency details of the expression signal When the wavelet is fully diluted, the length of the wavelet is more comparable to the length of the gene expression signal and therefore ... therefore it extracts the low frequency trends of the signal In order to overcome the issue in temporal gene expression data analysis we take an approach usi...
Ngày tải lên: 22/06/2014, 19:20
Báo cáo y học: "ExpressionPlot: a web-based framework for analysis of RNA-Seq and microarray gene expression data" doc
... Friedman and Maniatis Genome Biology 2011, 12:R69 http://genomebiology.com/2011/12/7/R69 SOFTWARE Open Access ExpressionPlot: a web-based framework for analysis of RNA-Seq and microarray gene expression ... data Brad A Friedman1,2,3* and Tom Maniatis4 Abstract RNA-Seq and microarray platforms have emerged as important tools for detecting changes in gene...
Ngày tải lên: 09/08/2014, 23:20
Báo cáo y học: ":Identification of novel stem cell markers using gap analysis of gene expression data" ppsx
... ebf4 ebf1 ebf2 cyp1a1 cyp1a2 cyp1b1 ) Figure Phylogenetic distribution of stem cell markers and their close paralogs in four protein families Phylogenetic distribution of stem cell markers and their ... undergone repeated gene duplication events for a phylogenetic analysis of the evolution of proteins involved in stem cell function By sequence similarity analysis,...
Ngày tải lên: 14/08/2014, 08:20
Báo cáo hóa học: " Research Article Clustering of Gene Expression Data Based on Shape Similarity" potx
... the expression magnitude can be far apart Therefore, expression shape is a more important indication of similar gene functions than expression magnitude The same clustering methods mentioned ... University of Oklahoma’s E coli Gene Expression Database, http://chase.ou.edu/oubcf/ [25] The Entrez Genome Database National Center for Biotechnology Information, National Library...
Ngày tải lên: 22/06/2014, 00:20
Báo cáo hóa học: " Research Article Inferring Time-Varying Network Topologies from Gene Expression Data" docx
... Consider N gene expression profiles, g (1) , g (2) , , g (N) ∈ RT , T being the length of each gene s temporal expression profile (as obtained from microarray expression) The jth time instant of gene ... network hereby generated resolves cyclic dependencies The main assumption for the formulation of a linear state-space model to examine the possibility of gene- gene interactions...
Ngày tải lên: 22/06/2014, 19:20
Báo cáo hóa học: " Research Article Clustering Time-Series Gene Expression Data Using Smoothing Spline Derivatives" pptx
... for clustering gene expression data, ” Bioinformatics, vol 17, no 9, pp 763–774, 2001 [21] H Chipman, T J Hastie, and T Tibshirani, Clustering microarray data, ” in Statistical Analysis of Gene Expression ... Clustering short time series gene expression data, ” Bioinformatics, vol 21, supplement 1, pp i159–i168, 2005 [7] C D Giurcˇ neanu, I Tˇ bus, and J Astola, Clustering...
Ngày tải lên: 22/06/2014, 19:20
The Biological Sample Classification Using Gene Expression Data
... expression data The quality of gene expression data strongly depends on the equiments used, the biological variation and the measurement condition Therefore, the gene expression data must be pre-processed ... data contain from 5,000 to 10,000 genes for less than 100 tumor samples The problem of classifying the biological samples using gene expression...
Ngày tải lên: 01/08/2014, 17:47
Báo cáo y học: " Dynamic gene network reconstruction from gene expression data in mice after influenza A (H1N1) infection." ppsx
... interplay In our approach we applied the Time Varying Dynamic Bayesian Networks (TV-DBNs) on a time series microarray dataset obtained from the lungs of C57BL/6J mice infected with a mouse-adapted influenza ... response, whereas the rest are mainly involved in metabolic process and system development Time Varying Dynamic Bayesian Network Modeling A Time Varying Dynamic...
Ngày tải lên: 10/08/2014, 09:22
báo cáo khoa học: " Gene expression profile analysis of tobacco leaf trichomes" docx
... http://www.biomedcentral.com/1471-2229/11/76 Page of 10 Table The 20 most abundant ESTs in the tobacco leaf trichome library with gene annotation of their closest hit identified by Blastx No of ESTs Gene ID Gene annotation of closest ... differentially expressed genes between trichomes and leaves were compared A total of 63.7% of highly expressed genes and 70.6% of low...
Ngày tải lên: 11/08/2014, 11:20
báo cáo khoa học: " Discovery of microvascular miRNAs using public gene expression data: miR-145 is expressed in pericytes and is a regulator of Fli1" pps
... UUCCCUAAGGACCCUU UUGACCUG ||| ||||||| 5' UCA-AUUCAGUGGAUGGCAACUGGAA 5' CAA-AUUCAGUGGAUGGCAACUGGAA 5' UUA-AUUCAGCGGAUGGCAACUGGAA 5' AUAUAUUCAGUGGAUGGCAACUGGAA (b) 3' UUCCCUAAGGACCCUUUUGACCUG || ... Human 5' CUUGAAGGGAAGACAAAACUGGAU Rat 5' UUUGAAGAGAUAAGAAAACUGGAU Dog 5' CUUGAAGAGAAAACAAAACUGGAU 5' 3' 3' 3' 3' Site : Fli1 3’ UTR pos 490-497 3' UUCCCUAAGGACCCUUUUGACCUG || ||||||| 5' UGAAGUUUUUUG...
Ngày tải lên: 11/08/2014, 12:20
Báo cáo sinh học: "ANMM4CBR: a case-based reasoning method for gene expression data classification" docx
... normalization method as in [19], which includes base 10 log-transformation as well as normalization to mean and variance For the data that contains negative values, we not perform log-transformation ... approach and the classifier List of abbreviations ANMM4CBR: additive nonparametric margin maximization for case-based reasoning; ANMM: additive nonparametric margin maximization; NM...
Ngày tải lên: 12/08/2014, 17:20