Cloning of medaka glial cell derived neurotrophic factor (GDNF) and its receptor GFR alpha 1

Cloning of medaka glial cell derived neurotrophic factor (GDNF) and its receptor GFR alpha 1

Cloning of medaka glial cell derived neurotrophic factor (GDNF) and its receptor GFR alpha 1

... GFRa1 Dr GFRa1a Dr GFRa1b Rn GFRa1 Hs GFRa1 Mm GFRa1 (1) (1) (1) (1) (1) (1) Ol GFRa1 Dr GFRa1a Dr GFRa1b Rn GFRa1 Hs GFRa1 Mm GFRa1 (69) (72) ( 81) (69) (69) (69) Ol GFRa1 Dr GFRa1a Dr GFRa1b ... Rn GFRa1 Hs GFRa1 Mm GFRa1 (14 5) (14 8) (15 7) (14 9) (14 9) (14 9) Ol GFRa1 Dr GFRa1a Dr GFRa1b Rn GFRa1 Hs GFRa1 Mm GFRa1 (225) (228) (237) (225) (225) (225) Ol GFRa1 Dr GFRa1a Dr GFRa1b Rn GFRa1...

Ngày tải lên: 03/10/2015, 20:57

48 214 0
Báo cáo y học: "Expression of leukemia inhibitory factor (LIF) and its receptor gp190 in human liver and in cultured human liver myofibroblasts. Cloning of new isoforms of LIF mRNA" pdf

Báo cáo y học: "Expression of leukemia inhibitory factor (LIF) and its receptor gp190 in human liver and in cultured human liver myofibroblasts. Cloning of new isoforms of LIF mRNA" pdf

... study was to examine the expression of LIF and of its specific receptor gp190 in human liver Results obtained with immunostaining of liver sections led us to examine LIF expression by cultured liver ... of LIF secretion by interleukin-4 Regulation of LIF secretion by interleukin-4 Confluent cultures of human liver myofibroblasts were cultured in...

Ngày tải lên: 13/08/2014, 13:20

10 288 0
Expression and function of glial cell line derived neurotrophic factor family receptor alpha 1 alternatively spliced isoforms

Expression and function of glial cell line derived neurotrophic factor family receptor alpha 1 alternatively spliced isoforms

... effects of GDNF 1. 5 GFR 1 9 10 11 1. 5 .1 GFR 1 and its spliced isoforms 11 1. 5.2 Expression and functional role of GFRα1a 12 ii 1. 6 Alternatively spliced isoforms 13 1. 7 Quantification of gene expression ... of The Two GFR 1 Spliced Receptor Isoforms 54 4 .1 Introduction 55 4.2 Materials and Methods 56 4.2 .1 Stably transfected cell lin...

Ngày tải lên: 05/10/2015, 22:31

106 348 0
Glial cell line drived neurotrophic factor (GDNF) family of ligands is a mitogenic agent in human glioblastoma and confers chemoresistance in a ligand specific fashion

Glial cell line drived neurotrophic factor (GDNF) family of ligands is a mitogenic agent in human glioblastoma and confers chemoresistance in a ligand specific fashion

... and Akt in both LN-229 and A1 72 human glioblastoma cell lines GDNF was however found to reduce the background activation of JNK and the A1 72 human glioblastoma cell line in a timedependent fashion ... potentiate adjuvant therapy It is likely that the chemoresistance properties are potentiated by autocrine and paracrine pathways and facilitated by mit...

Ngày tải lên: 14/09/2015, 12:13

203 290 0
Báo cáo hóa học: " Modulation of the major histocompatibility complex by neural stem cell-derived neurotrophic factors used for regenerative therapy in a rat model of stroke" ppt

Báo cáo hóa học: " Modulation of the major histocompatibility complex by neural stem cell-derived neurotrophic factors used for regenerative therapy in a rat model of stroke" ppt

... with an intra-peritoneal injection of 400 mg/kg chloral hydrate (Pharmaceutical Plant of Tiantan Hospital, Beijing, China) The rectal temperature was monitored and maintained at 37.5°C A scalp incision ... infarcted brain parenchyma of transplanted rats (A- iii and A- iv) A comparable extent of class II MHC was noted in ischemic rats irrespective of any therapy but unrema...

Ngày tải lên: 18/06/2014, 16:20

10 702 0
Báo cáo y học: "Genome-wide identification of novel expression signatures reveal distinct patterns and prevalence of binding motifs for p53, nuclear factor-κB and other signal transcription factors in head and neck squamous cell carcinoma" docx

Báo cáo y học: "Genome-wide identification of novel expression signatures reveal distinct patterns and prevalence of binding motifs for p53, nuclear factor-κB and other signal transcription factors in head and neck squamous cell carcinoma" docx

... regulatory modules including TBPF (TATA -binding protein factors) , ECAT (enhancer of CCAAT binding factors) , or PCAT (promoter of CCAAT binding factors) p53 binding motifs were also displayed '(+)' and ... genotype and protein expression in UM-SCC cell lines p53 genotype and protein expression in UM-SCC cell lines (a) The p53 genotype of ten University o...

Ngày tải lên: 14/08/2014, 07:21

25 350 0
Tài liệu Báo cáo khoa học: Analysis of the molecular dynamics of medaka nuage proteins by fluorescence correlation spectroscopy and fluorescence recovery after photobleaching doc

Tài liệu Báo cáo khoa học: Analysis of the molecular dynamics of medaka nuage proteins by fluorescence correlation spectroscopy and fluorescence recovery after photobleaching doc

... measure the mobility of the components in the PGCs The medaka embryo was peeled off the chorion, and the segment containing the part of PGCs was excised for observation by microscopy and FCS ... dynamic nature of the nuage Schematic diagram of the preparation of PGCs of medaka specimen (A) OlvasGFP was expressed in the medaka PGC at stage 24 and...

Ngày tải lên: 18/02/2014, 16:20

9 655 0
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

... CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * 1888 CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTT...

Ngày tải lên: 07/03/2014, 16:20

12 772 0
Báo cáo khoa học: Regulation of arginase II by interferon regulatory factor 3 and the involvement of polyamines in the antiviral response potx

Báo cáo khoa học: Regulation of arginase II by interferon regulatory factor 3 and the involvement of polyamines in the antiviral response potx

... IRF -3 responsive, including the gene encoding arginase II (ArgII) ArgII is the extrahepatic isoform of the arginase type enzymes, and ArgI is the hepatic-specific counterpart [16] The two isoforms ... ArgII expression was inhibited by MG- 132 [20], suggesting indirectly an involvement of NF-jB in ArgII regulation Our study is thus the first direct demonstration...

Ngày tải lên: 07/03/2014, 21:20

12 498 0
Báo cáo Y học: Interaction of bovine coagulation factor X and its glutamic-acid-containing fragments with phospholipid membranes A surface plasmon resonance study pdf

Báo cáo Y học: Interaction of bovine coagulation factor X and its glutamic-acid-containing fragments with phospholipid membranes A surface plasmon resonance study pdf

... zymogen factor X, activated factor X (factor Xa) and the active site inhibited form DEGR -factor Xa as well as the the factor X peptides were studied with surface plasmon resonance The Ca2+ concentration ... filters Membrane binding experiments on factor X, factor Xa, DEGR -factor Xa and the Gla-containing fragments of factor X were performed with memb...

Ngày tải lên: 08/03/2014, 23:20

6 402 0
Báo cáo hóa học: " The effect of red blood cell transfusion on tissue oxygenation and microcirculation in severe septic patients" pdf

Báo cáo hóa học: " The effect of red blood cell transfusion on tissue oxygenation and microcirculation in severe septic patients" pdf

... analyzing the data and interpreting the results, drafting and revising the manuscript, and approving the manuscript in its final form RA, KK, and JO contributed to acquiring and managing the data, ... really influence the final response to RBC transfusion NIRS monitors hemoglobin oxygen saturation in arterioles, venules, and capillaries in the measured volume...

Ngày tải lên: 20/06/2014, 22:20

11 587 0
Báo cáo hóa học: " Research Article Karhunen-Lo` ve-Based Reduced-Complexity Representation e of the Mixed-Density Messages in SPA on Factor Graph and Its Impact on BER" ppt

Báo cáo hóa học: " Research Article Karhunen-Lo` ve-Based Reduced-Complexity Representation e of the Mixed-Density Messages in SPA on Factor Graph and Its Impact on BER" ppt

... parameterization (e. g., Gaussian message) These messages are presented in the AWGN channel model The rest of the messages are mixed continuous and discrete messages These mixture messages are continuously ... description) 4.2.2 Message Types Presented in the FG /SPA The FG cont-ains both discrete and continuous messages The discrete messages are presented...

Ngày tải lên: 21/06/2014, 07:20

11 389 0
Báo cáo y học: "Enumeration and phenotypical analysis of distinct dendritic cell subsets in psoriatic arthritis and rheumatoid arthritis" pps

Báo cáo y học: "Enumeration and phenotypical analysis of distinct dendritic cell subsets in psoriatic arthritis and rheumatoid arthritis" pps

... of such membrane DC subsets is now necessary, and will offer insight into the migratory pathway and functional activities of distinct DC subsets in chronic synovitis Finally, the trend towards ... Immunohistochemical analysis of synovial membranes from inflammatory and non-inflammatory arthritides: scarcity of CD5 positive B cells and IL2 receptor bearing T cells Pat...

Ngày tải lên: 09/08/2014, 07:20

13 438 0
Báo cáo y học: "Rapid construction of a dendritic cell vaccine through physical perturbation and apoptotic malignant T cell loading" pot

Báo cáo y học: "Rapid construction of a dendritic cell vaccine through physical perturbation and apoptotic malignant T cell loading" pot

... methodology, demonstrated a significantly enhanced stimulatory capacity in mixed leukocyte culture and the ability to promote CD8 T cell expansion and cytolytic capacity Therefore, this approach yields ... have begun to investigate the capacity of the DC harvested after column perturbation and apoptotic malignant T cell loading to induce and expand an anti-tumor CD8...

Ngày tải lên: 11/08/2014, 10:23

16 251 0
Báo cáo y học: "Functional significance of nerve growth factor and its receptor (TrkA) in inflammatory arthritis" pps

Báo cáo y học: "Functional significance of nerve growth factor and its receptor (TrkA) in inflammatory arthritis" pps

... to in uence the in ammatory and proliferative cascades of PsA and RA Abbreviations ELISA, enzyme-linked immunosorbent assay; FLS, fibroblast-like synoviocyte; NGF, nerve growth factor; NGF-R, nerve ... expression in rheumatoid arthritis and spondyloarthritis Arthritis Res Ther 2009, 11:R82 Raychaudhuri SP, Raychaudhuri SK: The regulatory role of nerve growth factor...

Ngày tải lên: 12/08/2014, 14:21

2 264 0
w