Clock synchronization by remote detection of correlated photon pairs

... Caleb Ho, Antia Lamas-Linares and Christian Kursiefer "Clock Synchronization by remote detection of correlated photon pairs" New Journal of Physics, Vol 11 (2009) ... all of the people in the Quantum Optics group who have made this journey possible ii Summary This document is a summary of my studies on the synchronization of two remote clocks by detection of...

Ngày tải lên: 03/10/2015, 20:57

... Compound Nouns based on Character Cooccurrence and Its Evaluation (in Japanese) Journal of Natural Language Processing, 4(3):83-99 Masahiro Oku 1994 Handling Japanese Homophone Errors in Revision ... of elements of the homophone set increases Our method has an advantage that the size of DL1 is smaller The size of the decision list has no relation to the precision and th...

Ngày tải lên: 22/02/2014, 03:20

... salt (Tiron) was from Shanghai Reagent Co Ltd (Shanghai, China) All chemicals were of analytical reagent grade, and double-distilled water was used throughout RAW264.7 cells were from American ... with an argon ion laser Acquired images were analyzed using image-pro plus 4.5 software Materials o-Aminobenzenothiol was purchased from Fluka (Shanghai, China) A stock solution (1 mm)...

Ngày tải lên: 16/03/2014, 11:20

... ii Rubber in Laos Detection of actual and assessment of potential plantations in Lao PDR using GIS and remote sensing technologies Diplomarbeit der Philosophisch-naturwissenschaftlichen ... regarding decision-making and elaboration of development strategies Using my GIS and Remote Sensing competence and my fascination for the possibilities o...

Ngày tải lên: 17/03/2014, 11:20

... HuPON1 stereospecific hydrolysis of GD D T Yeung et al Results Analysis of GD stereoisomer hydrolysis using GC ⁄ MS The decrease in the concentration of each of the GD isomers in the presence of HuPON1 ... binding and ⁄ or hydrolysis of the C±P+ stereoisomers was preferred The only previous report of a lack of stereospecificity in the enzyme-catalyzed hydrolysis of G...

Ngày tải lên: 30/03/2014, 09:20

... smaller list of NPIs as a seed set Begin with a small set of seed NPIs Iterate: (a) Use the current list of NPIs to learn a list of DEOs (b) Use the current list of DEOs to learn a list of NPIs Interestingly, ... as a generalization of this evaluation procedure that is sensitive to the ranking of DEOs and non-DEOs For development purposes, we use the list of 150 annotations...

Ngày tải lên: 31/03/2014, 20:20

... epidemiological features, application of diagnostic kit for detection of trypanosomiasis caused by Trypanosoma evansi in cattle and buffaloes in a few northern mountainous provinces and recommendation for ... effective and safe in treating trypanosomiasis in cattle and buffaloes 22 + Examination and treatment for tryp...

Ngày tải lên: 28/04/2014, 13:08

... examination In many cases, the only clinical information provided was the age, sex, cause of death and presence or absence of an antemortem clinical diagnosis of asbestosis by chest radiography ... majority of the cases The Mobile, Alabama area has a large shipbuilding industry, and the majority of autopsy cases in our study were referred by a local law firm involv...

Ngày tải lên: 20/06/2014, 00:20

... that a TNAR is available in this latter case A Unknown parameters (µs, φs) and known total noise (R, C) Under the assumptions A1 and A2 , assuming known parameters R, C and s and unknown parameters ... performance In a same way, the O9 detector, which assumes that all the parameters of the sources are unknown, has the lowest performance Moreover, for a...

Ngày tải lên: 21/06/2014, 00:20

... Cite this article as: Hong et al.: Sensitive and molecular size-selective detection of proteins using a chip-based and heteroliganded gold nanoisland by localized surface plasmon resonance spectroscopy ... determination of a protein Page of Fabrication of the gold nanoisland substrate The gold nanoisland was prepared by the thermal evapo...

Ngày tải lên: 21/06/2014, 04:20

... Rapid detection of sacbrood virus (SBV) by one-step reverse transcription loop-mediated isothermal amplification assay ArticleCategory : Short Report ... simple detection of SBV by RT-LAMP with high sensitivity and analytic specificity Keywords Sacbrood virus, Loop-mediated isothermal amplification, SYBR Green, Honeybee Sacbrood virus (SBV) prim...

Ngày tải lên: 21/06/2014, 19:20

... the example of Figure 5(a), the network synchronized using GPA requires the same number of pairwise synchronizations as that of NPA However, the number of pairwise synchronizations for GPA depends ... Receive-only synchronization Region of pairwise sync (Nodes P and A) Sender-receiver synchronization (2-way message exchanges) B P A Leader nodes Figure 1: Pairwise broa...

Ngày tải lên: 22/06/2014, 19:20

... NH2–CCATCTTTACCAGACAGTGTTA 3′ 3′ GGUAGAAAUGGUCUGUCACAAU 5′ 3′ UUGUGACUAAAGUUUACCACGAU 5′ 3′AGUAUC GGGACAUGUUACGACGA 5′ 166 H.V Tran et al / Biosensors and Bioelectronics 49 (2013) 164–169 2.5 Grafting ... formats (Xu et al., 2004, 2006; Cai et al., 2003) In this paper, we describe a label- free and reagentless miRNA sensor based on an interpenetrated network of carbon nanotube...

Ngày tải lên: 02/07/2014, 14:14

... screening in DNA detection approach (this approach is more often used than the second one of protein detection because DNA stability is much higher than that of proteins and therefore DNA detection ... study, we described the setup of a novel DNA label- free electrochemical biosensor for GMO (soybean) detection, based on MWCNT -doped PPy matrices for ODN immob...

Ngày tải lên: 02/07/2014, 14:14

... availability of the PCR assay for screening the prevalence of L intracellularis infection in the pig farms Macroscopic Detection of Lawsonia intracellularis in diagnostic specimens by one-step PCR examination ... Detection of Lawsonia intracellularis in diagnostic specimens by one-step PCR 35 swine geno- mic DNA or other bacterial strains (Fig 1) Vario...

Ngày tải lên: 07/08/2014, 14:22