Atomic force microscope imaging of human red blood cells and theri mechanical properties

... Summary Topographical imaging and force imaging by the Atomic Force Microscopy (AFM) has been applied on three kinds of human Red Blood Cells (RBC) dehydrated RBC, swollen RBC and fresh RBC in PBS ... the AFM images of living cells and is the paramount element that determines the micro -mechanical properties of cells Studies show quantitatively and quali...

Ngày tải lên: 30/09/2015, 14:23

... assay as a marker of classification of RNA- positive reticulocytes and erythrocytes 10, 11, 12 or by attempts to describe of human erythroid gene activity, planed to be finished in 5-10 years ... human RBCs The purity of erythrocyte fraction achieved 99,99997% and was confirmed by Pappenheim staining of blood slides, flow cytometry (MÖLAB, Germany) and FACS analysis (Cytomic...

Ngày tải lên: 03/11/2012, 10:58

... was observed when COS cells were co-cultured with macrophages and this effect was reduced by NOS inhibitors The cause of the induction of NOS II is not clear: the levels of some cytokines as interferongamma ... Bickle2 Laboratory of Dr Ettrich, Institute of Physical Biology of USB and Institute of Landscape Ecology of AS CR, Nove Hrady, Czech Republic, 2Laboratory of Dr...

Ngày tải lên: 30/03/2014, 20:20

... cRBCs Defining the glycans present on the surface of cRBCs will allow either for the design of strategies to optimize the agglutination assay or the design of alternative strategies for the detection ... measurement of various concentrations of solutions can then be used to quantify viral titer Additionally, the introduction of antisera capable of neutralizing...

Ngày tải lên: 14/02/2014, 19:20

... RBC-specific data included the age of the RBC unit at the time of transfusion and the leukodepletion status The age of the blood was determined by subtracting the date of collection from the date of transfusion ... against maximum age of red blood cells A locally weighted nonparametric smoother (LOWESS) for the predicted probability of death an...

Ngày tải lên: 14/08/2014, 08:21

... Rada-Iglesias A, Wysocka J: Epigenomics of human embryonic stem cells and induced pluripotent stem cells: insights into pluripotency and implications for disease Genome Medicine 2011, 3:36 ... Feinberg AP: Differential methylation of tissue- and cancer-specific CpG island shores distinguishes human induced pluripotent stem cells, embryonic stem...

Ngày tải lên: 11/08/2014, 12:21

... CATGTTCGGTTGGTCAAAGA CCCAAGAGATCCCCCACAT GTTGTTACCTCAAACCTCCTTTCC GCACCACGAACGCCTTTG GCGGTGTGCGGATGGTA CCCTAGAGATAAGGCGCTTCAG AAGATGGTGGATGCTTCCAAAA ACCACTCGGAGGACCTGTTTT ACAGCAAATGACAGCTGCAAA ... GACCTCCACAGTTGTAGCAA 3’ TRCN 0000102579 LIN28sh2F 5’ CGCGTCATCTGTAAGTGGTTCAACGTTTCAAGAGAACGTTGAACCAC TTACAGATGTTTTTCATATGAT 3’ LIN28sh2R 5’ CGATCATATGAAAAACATCTGTAAGTGGTTCAACGTTCTCTTGAAAC GTTGAACCAC...

Ngày tải lên: 16/10/2015, 11:58

... ATOMIC FORCE MICROSCOPY STUDY OF MALARIA INFECTED RED BLOOD CELLS LI ANG (B S., FUDAN UNIVERSITY, CHINA) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF MACHANICAL ... surface of the Plasmodium (P.) spp infected red blood cells (IRBCs) have a profound importance on the pathobiology of human malaria Knob-like protrusions have been...

Ngày tải lên: 11/09/2015, 14:34

... scanned over the silicon surface at speed of 0.1– m=s leads to an 0.2–2 nm-thick oxide pattern of width 20 –60 nm The oxide features formed by AFM lithography can be then transferred to the silicon ... supported on an insulating layer (Fig 1) As-doped Unibond J silicon- on-insulator (SOI) samples with an ultra-thin single- crystal silicon top layer (typically 15 –20 nm) we...

Ngày tải lên: 16/03/2014, 15:15

Ngày tải lên: 13/11/2014, 10:36

... properties of the patterns are investigated A brief summary of the concepts of nanofabrication, various lithography technique, atomic force microscope technique and nanolithography of polymer ... Discussion 172 7.3.1 Nanofabrication of oligomer of 173 7.3 7.3.1.1 Patterning of hydrophilic oligomer 173 7.3.1.2 Patterning of amphiphilic oligomer 175 7.3.1.3 Patterning o...

Ngày tải lên: 12/09/2015, 11:29

... R F Science 20 02, 29 8, 23 22 29 Brown, D H.; Smith, W E Chem Soc Rev 1980, 9, 21 7 30 Frens, G Nature: Phys Sci 1973, 24 1, 20 31 Schmid, G Clusters and Colloids, VCH, Weinheim, 1994 32 Bradley, ... New functions Bottom up 1960 1970 1980 1990 20 00 20 10 20 20 20 30 Figure 1 .2 Schematic representation of evolution of top-down and bottom approach for nanofabrication On the...

Ngày tải lên: 14/09/2015, 11:38

... The effects of emodin on the filamentous structures of MCF 7 cells were examined  by acquiring AFM images from three sets of samples: MCF 7 cells, MCF 7 cells pre‐ treated with 20µM emodin,  and MCF 7 cells pre treated with DMSO. About 5 to 10  ... The effects of emodin on the elasticity of MCF 7 cells were examined by collecting  force curves on three sets of samples: MCF 7 cells, MCF 7 ce...

Ngày tải lên: 30/09/2015, 14:23

... that pseudotyped virus comprising a lentivirus, which does not require replicating host cells for integration of its genome, together with an envelope containing vesicular stomatitis virus glycoprotein ... chTCR cassette into the human genome Retroviruses have the unique advantage of integration into all host cell genomes and infect a broad range of cell-types The c...

Ngày tải lên: 19/06/2014, 08:20

... CD33 Cell surface antigen Figure of CD46 MACS blood of adult donors (PB)CD34+, CD38+, CD33+ hematopoietic from G-CSFcells from cord blood cells [triangles] and molecules on cell CD34+ cells of ... leukapheresis blood of1 adult donors blood[ B, circles]squares], cells mature leukocytes of from molecules on cell membranes of [C, triDetection(LP )CD46...

Ngày tải lên: 20/06/2014, 01:20